<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article">
 <front>
  <journal-meta>
   <journal-id journal-id-type="publisher-id">
    aim
   </journal-id>
   <journal-title-group>
    <journal-title>
     Advances in Microbiology
    </journal-title>
   </journal-title-group>
   <issn pub-type="epub">
    2165-3402
   </issn>
   <issn publication-format="print">
    2165-3410
   </issn>
   <publisher>
    <publisher-name>
     Scientific Research Publishing
    </publisher-name>
   </publisher>
  </journal-meta>
  <article-meta>
   <article-id pub-id-type="doi">
    10.4236/aim.2025.159035
   </article-id>
   <article-id pub-id-type="publisher-id">
    aim-145996
   </article-id>
   <article-categories>
    <subj-group subj-group-type="heading">
     <subject>
      Articles
     </subject>
    </subj-group>
    <subj-group subj-group-type="Discipline-v2">
     <subject>
      Biomedical 
     </subject>
     <subject>
       Life Sciences
     </subject>
    </subj-group>
   </article-categories>
   <title-group>
    Prevalence of pvl and tsst1 Virulence Genes in Staphylococcus aureus Clinical Isolates from Angré University Hospital in Abidjan, Côte d’Ivoire
   </title-group>
   <contrib-group>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Djaman Nguessan Carole
      </surname>
      <given-names>
       Obouayeba
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Gnignissemet Armel Joel
      </surname>
      <given-names>
       Bahan
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff3"> 
      <sup>3</sup>
     </xref> 
     <xref ref-type="aff" rid="aff4"> 
      <sup>4</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Gniwele Anne Edwige
      </surname>
      <given-names>
       Coulibaly
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Kobina Amandze Adams
      </surname>
      <given-names>
       Kofi
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref> 
     <xref ref-type="aff" rid="aff5"> 
      <sup>5</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Yeperi Marina
      </surname>
      <given-names>
       Diallo-Coulibaly
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff3"> 
      <sup>3</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Djama Allico
      </surname>
      <given-names>
       Joseph
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff6"> 
      <sup>6</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Adèle
      </surname>
      <given-names>
       Kacou-Ndouba
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff4"> 
      <sup>4</sup>
     </xref> 
     <xref ref-type="aff" rid="aff5"> 
      <sup>5</sup>
     </xref>
    </contrib>
   </contrib-group> 
   <aff id="aff1">
    <addr-line>
     aBiology and Health Laboratory UFR Biosciences, University Félix Houphouët Boigny, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff2">
    <addr-line>
     aHuman, Animal and Plant Health Host Team: Biology, Environment, Health Doctoral School, University Félix Houphouët Boigny, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff3">
    <addr-line>
     aMedical Biology Department, Angré University Hospital, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff4">
    <addr-line>
     aTeaching Unit of Microbiology UFR Medical Sciences, University Félix Houphouët Boigny, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff5">
    <addr-line>
     aBacteriology-Virology Unit, Treichville University Hospital, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff6">
    <addr-line>
     aDepartment of Clinical and Fundamental Biochemistry, Institut Pasteur de Côte d’Ivoire, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <pub-date pub-type="epub">
    <day>
     04
    </day> 
    <month>
     09
    </month>
    <year>
     2025
    </year>
   </pub-date> 
   <volume>
    15
   </volume> 
   <issue>
    09
   </issue>
   <fpage>
    543
   </fpage>
   <lpage>
    558
   </lpage>
   <history>
    <date date-type="received">
     <day>
      20,
     </day>
     <month>
      August
     </month>
     <year>
      2025
     </year>
    </date>
    <date date-type="published">
     <day>
      22,
     </day>
     <month>
      August
     </month>
     <year>
      2025
     </year> 
    </date> 
    <date date-type="accepted">
     <day>
      22,
     </day>
     <month>
      September
     </month>
     <year>
      2025
     </year> 
    </date>
   </history>
   <permissions>
    <copyright-statement>
     © Copyright 2014 by authors and Scientific Research Publishing Inc. 
    </copyright-statement>
    <copyright-year>
     2014
    </copyright-year>
    <license>
     <license-p>
      This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/
     </license-p>
    </license>
   </permissions>
   <abstract>
    <b>Background: </b>Staphylococcus aureus (S. aureus) is a major cause of serious human infections and produces multiple virulence factors. In Côte d’Ivoire, local molecular data remain scarce. This study evaluated the prevalence of pvl and tsst1 genes in clinical S. aureus isolates from Abidjan. 
    <b>Methods</b>: Two hundred clinical isolates (100 MRSA: methicillin-resistant S. aureus; 100 MSSA: methicillin-susceptible S. aureus) were collected at Angré University Hospital (CHU Angré) between January 2022 and February 2024. Isolates were identified using phenotypic methods, the VITEK 2 system, and PCR confirmation targeting the nuc gene. The pvl and tsst1 genes were detected using conventional PCR. Virulence profiles were compared according to hospital department, MRSA/MSSA profile, and clinical severity classification. 
    <b>Results</b>: The pvl gene was detected in 72.0% of MRSA and 60.5% of MSSA isolates. A double-positive profile (pvl
    <sup>+</sup>/tsst1
    <sup>+</sup>) was found in 54.6% of the isolates, particularly in critical care units. No significant difference was observed between MRSA and MSSA for pvl (p = 0.344) or tsst1 (p = 0.286). However, the presence of the pvl gene was strongly associated with clinical severity, with 90.09% of severe cases having the pvl gene (p = 0.0002). The tsst1 gene was more frequently found in non-severe cases (54%) than in severe cases (35%), but the difference was not significant (p = 0.374). 
    <b>Conclusion</b>: The high prevalence of pvl and tsst1 genes, including in MRSA strains, highlights the circulation of highly virulent S. aureus lineages in Abidjan. These findings emphasize the need for enhanced molecular surveillance as part of an integrated strategy to control S. aureus infections.
   </abstract>
   <kwd-group> 
    <kwd>
     Methicillin-Resistant Staphylococcus aureus (MRSA)
    </kwd> 
    <kwd>
      Panton-Valentine Leukocidin (PVL)
    </kwd> 
    <kwd>
      Toxic Shock Syndrome Toxin-1 (TSST-1)
    </kwd> 
    <kwd>
      Virulence
    </kwd>
   </kwd-group>
  </article-meta>
 </front>
 <body>
  <sec id="s1">
   <title>1. Introduction</title>
   <p>Staphylococcus aureus is a major opportunistic pathogen responsible for a wide spectrum of infections, ranging from mild skin lesions to sepsis and necrotizing pneumonia <xref ref-type="bibr" rid="scirp.145996-1">
     [1]
    </xref>. Its ability to adapt to antibiotics, particularly the emergence of methicillin-resistant strains (MRSA), makes it a major concern in both healthcare and community settings <xref ref-type="bibr" rid="scirp.145996-2">
     [2]
    </xref>. In Côte d’Ivoire, internal records from the Bacteriology unit at CHU Angré, one of the country’s most recently established hospitals, indicate that S. aureus is the most frequently isolated gram-positive bacterium in both inpatient and outpatient samples. A study conducted at Cocody University Hospital (Abidjan) in 2011 reported an MRSA prevalence of 11.8% among clinical S. aureus isolates <xref ref-type="bibr" rid="scirp.145996-3">
     [3]
    </xref>. Since then, the local epidemiology has shifted. At CHU Angré, a higher proportion of MRSA, more than half of the isolates stored, was observed, which suggests a large circulation of resistant strains and increases the need to study the associated virulence profiles.</p>
   <p>The virulence of S. aureus is mediated by several factors (enzymes, adhesins, and toxins). Two determinants are particularly notable: Panton-Valentine leukocidin (PVL), encoded by pvl genes, which lyses polymorphonuclear leukocytes via pore formation <xref ref-type="bibr" rid="scirp.145996-4">
     [4]
    </xref>, and toxic shock syndrome toxin 1 (TSST-1), encoded by tsst1, which is involved in potentially fatal systemic inflammatory responses <xref ref-type="bibr" rid="scirp.145996-5">
     [5]
    </xref>. Globally, the prevalence of pvl is variable, with high frequencies in Africa (approximately 50%, with more than 70% reported) and low frequencies in Europe (generally less than 5%) <xref ref-type="bibr" rid="scirp.145996-6">
     [6]
    </xref> <xref ref-type="bibr" rid="scirp.145996-7">
     [7]
    </xref>. For TSST-1, reported frequencies range across hospitals and settings, with levels described in some MRSA lineages compared to MRSA. In Côte d’Ivoire, published data remain limited and are derived from small Abidjan series (mostly fewer than 35 isolates). PVL prevalence reached 45.2% in the most recent study (2020) <xref ref-type="bibr" rid="scirp.145996-8">
     [8]
    </xref>, whereas TSST-1, although detected locally, lacks up-to-date estimates; to our knowledge, the only point estimate is ~3% - 4% from 2009 <xref ref-type="bibr" rid="scirp.145996-3">
     [3]
    </xref>. Moreover, current taxonomy recognizes that S. aureus belongs to a complex of related species (S. argenteus and S. schweitzeri), which are rarely distinguished in routine practice but potentially differ in virulence, supporting the need for broader surveillance <xref ref-type="bibr" rid="scirp.145996-9">
     [9]
    </xref>. Additionally, several international studies have linked PVL and TSST-1 to severe clinical presentations, notably among community-associated MRSA <xref ref-type="bibr" rid="scirp.145996-2">
     [2]
    </xref>.</p>
   <p>Against this background of limited local data and an apparent increase in MRSA, we investigated the distribution of pvl and tsst1 genes in an expanded clinical cohort at CHU Angré (Abidjan). Our objectives were to estimate the prevalence of pvl and tsst1 among clinical isolates of Staphylococcus aureus and to analyze their associations with methicillin resistance and clinical severity.</p>
  </sec><sec id="s2">
   <title>2. Materials and Methods</title>
   <sec id="s2_1">
    <title>2.1. Study Site</title>
    <p>This study was conducted at the bacteriology unit of CHU Angré.</p>
   </sec>
   <sec id="s2_2">
    <title>2.2. Sample Collection and Inclusion Criteria</title>
    <p>This study analyzed stored clinical isolates from routine inpatient and outpatient samples collected at the Angré University Hospital between January 2022 and February 2024. All unique, non-duplicate isolates phenotypically identified as Staphylococcus aureus in the microbiology laboratory were eligible. Identification was confirmed by PCR targeting the nuc gene (and the NRPS marker, when applicable).</p>
    <p>The exclusion criteria were screening/colonization specimens, environmental isolates, duplicates (per repository records), uncertain identification, and obvious contaminants. Isolates were preserved either as deep nutrient agar stabs at room temperature or at –80˚C in Brain Heart Infusion (BHI) broth supplemented with 10% glycerol.</p>
   </sec>
   <sec id="s2_3">
    <title>2.3. Isolate Selection</title>
    <p>Since 2020, the laboratory has archived approximately 100 S. aureus isolates per year (with more pronounced losses of viability in 2020). For this study, inclusion was restricted to 2022-2024 because deep nutrient agar preservation from these years was better maintained, yielding higher viability and fewer losses at subculture. Isolates were selected consecutively, without replacement, following the chronological order of archival entry until 200 unique clinical isolates were reached (100 MRSA and 100 MSSA). One isolate per patient/clinical episode was selected. If an isolate was non-viable on subculture or its record was entirely missing, the next one in chronological order was included. Selection was not conditioned by ward, and the distribution of wards among the included isolates broadly mirrored that of the available archives, indicating no notable ward-related bias. A 1:1 (MRSA/MSSA) scheme was retained, consistent with the proportions observed in the laboratory database, where methicillin-resistant and methicillin-susceptible isolates were relatively balanced and available during 2022-2024. The isolates originated from diverse clinical specimens, including wound swabs, blood, pus, urine, and puncture/aspiration fluids (ascitic and pleural).</p>
   </sec>
   <sec id="s2_4">
    <title>2.4. Isolation and Identification Procedures</title>
    <p>The collected strains were grown on nutritive and Chapman agar and incubated at 37˚C for 24 h. Preliminary identification of the strains was performed using Gram staining and catalase, DNase, and coagulase tests, supplemented by the VITEK® 2 automated system (bioMérieux, Marcy-l’Étoile, France). Preliminary identification was confirmed by molecular identification targeting the nuc gene (species-specific) and NRPS molecular marker <xref ref-type="bibr" rid="scirp.145996-10">
      [10]
     </xref> <xref ref-type="bibr" rid="scirp.145996-11">
      [11]
     </xref> by conventional PCR. Reference strains S. aureus ATCC 43300 (MRSA) and ATCC 25923 (MSSA) were used as controls. Primary culture was performed on nutrient agar and Chapman agar and incubated at 37˚C for 24 h. Initial identification relied on Gram staining and catalase, DNase, and coagulase tests, complemented by the VITEK® 2 automated system (bioMérieux, Marcy-l’Étoile, France). The identification of S. aureus was confirmed by conventional PCR targeting the nuc gene (species-specific) and the NRPS molecular marker <xref ref-type="bibr" rid="scirp.145996-10">
      [10]
     </xref> <xref ref-type="bibr" rid="scirp.145996-11">
      [11]
     </xref>. Reference strains S. aureus ATCC 43300 (MRSA) and ATCC 25923 (MSSA) were used as controls.</p>
   </sec>
   <sec id="s2_5">
    <title>2.5. Methods Definition of Clinical Severity</title>
    <p>Severity was operationalized as a binary outcome (severe versus non-severe). An episode was classified as severe if at least one of the following criteria was met: admission or transfer to the ICU or critical care; documented Staphylococcus aureus bacteremia or sepsis, defined as explicit mention in records, a positive blood culture associated with initiation of antistaphylococcal therapy, or at least two concordant positive blood cultures (excluding single positive bottles judged as contaminants or not treated and followed by a negative control); evidence of a deep or invasive infection such as pneumonia, endocarditis, osteoarticular infection, deep abscess, necrotizing fasciitis, meningitis, or pyelonephritis; requirement for drainage or surgery related to infection, including abscess evacuation, debridement, or hardware placement or revision; adverse outcomes such as death during the episode or explicit documentation of septic state, severe sepsis, or septic shock; or persistent fever, defined as either explicit mention in records or temperature ≥ 38˚C recorded on at least two occasions over 72 h despite antimicrobial therapy. Episodes that did not meet any of these criteria were classified as non-severe.</p>
    <p>Models were adjusted for covariates reliably available in the Laboratory Information System (LIS): methicillin-resistance status (MRSA/MSSA), specimen site (grouped as blood vs. other), and an age proxy based on the ward of care, with two categories: pediatrics/neonatology and adult services (internal medicine/geriatrics, surgery/traumatology, emergency/ICU, pulmonology, and other wards). This proxy was chosen because the ward is exhaustively recorded and closely reflects the age distribution at our institution. Information on immune status and prior antibiotic exposure was not captured consistently enough for valid adjustment and was, therefore, excluded.</p>
   </sec>
   <sec id="s2_6">
    <title>2.6. Determination of Resistance to Methicillin</title>
    <p>Methicillin resistance was assessed using two approaches.</p>
    <p>Agar diffusion method: A bacterial suspension equivalent to 0.5 McFarland was spread on a Mueller-Hinton agar and a cefoxitin disc (30 μg) was applied. After incubation at 37˚C for 18 - 24 h, the inhibition diameters were measured and interpreted according to the recommendations of the Antibiogram Committee of the French Society of Microbiology (CA-SFM, 2024). A diameter ≤ 22 mm was interpreted as indicative of an MRSA strain, while a diameter ≥ 22 mm indicated an MSSA strain <xref ref-type="bibr" rid="scirp.145996-12">
      [12]
     </xref>.</p>
    <p>Automated method: In parallel, a few isolates were analyzed using the VITEK® system (bioMérieux, Marcy-l’Étoile, France), which provides a sensitivity profile, including methicillin resistance detection.</p>
   </sec>
   <sec id="s2_7">
    <title>2.7. Detection of pvl and tsst1 Virulence Genes</title>
    <p>To evaluate the virulence potential of the Staphylococcus aureus isolates, conventional PCR targeted the PVL locus (lukS-PV/lukF-PV) and the tsst1 gene. PVL detection used the primer set (luk-PV-1/luk-PV-2); tsst1 was amplified with the corresponding tsst1 primer pair. Primer details and expected amplicon sizes are provided in <xref ref-type="table" rid="table1">
      Table 1
     </xref>.</p>
    <table-wrap id="table1">
     <label>
      <xref ref-type="table" rid="table1">
       Table 1
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.145996-"></xref>Table 1. Primers sequences used for detection of pvl and tsst1.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="8.73%"><p style="text-align:center">Target gene</p></td> 
       <td class="custom-bottom-td acenter" width="34.22%"><p style="text-align:center">foward luk-PV-1 (5'-3')</p></td> 
       <td class="custom-bottom-td acenter" width="32.45%"><p style="text-align:center">Reverse luk-PV-2 (5'-3')</p></td> 
       <td class="custom-bottom-td acenter" width="12.03%"><p style="text-align:center">Amplicon size</p></td> 
       <td class="custom-bottom-td acenter" width="12.57%"><p style="text-align:center">Reference</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td acenter" width="8.73%"><p style="text-align:center">pvl</p></td> 
       <td class="custom-top-td acenter" width="34.22%"><p style="text-align:center">ATCATTAGGTAAAATGTCTGGAC</p></td> 
       <td class="custom-top-td acenter" width="32.45%"><p style="text-align:center">GCATCAAGTGTATTGGATAGCA</p></td> 
       <td class="custom-top-td acenter" width="12.03%"><p style="text-align:center">433 pb</p></td> 
       <td class="custom-top-td acenter" width="12.57%"><p style="text-align:center">
         <xref ref-type="bibr" rid="scirp.145996-13">
          [13]
         </xref></p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="8.73%"><p style="text-align:center">tsst1</p></td> 
       <td class="acenter" width="34.22%"><p style="text-align:center">CTGGTATAGTAGTGGGTCTG</p></td> 
       <td class="acenter" width="32.45%"><p style="text-align:center">AGGTAGTTCTATTGGAGTAGG</p></td> 
       <td class="acenter" width="12.03%"><p style="text-align:center">271pb</p></td> 
       <td class="acenter" width="12.57%"><p style="text-align:center">
         <xref ref-type="bibr" rid="scirp.145996-14">
          [14]
         </xref></p></td> 
      </tr> 
     </table>
    </table-wrap>
    <p>Genomic DNA was extracted from fresh cultures grown on nutrient agar using the Biofact ® DNA/RNA Amplification Kit (Biofact, South Korea) according to the manufacturer’s instructions. DNA extracts were quantified by spectrophotometry using the A260/A280 ratio and stored at −20˚C for polymerase chain reaction (PCR).</p>
    <p>The pvl and tsst1 genes were detected using conventional PCR. Amplifications were run on a CFX96 thermocycler (Bio-Rad) using the HOT FIREPol® Master Mix 5× (Solis BioDyne, Tartu, Estonia), a ready-to-use mixture containing DNA polymerase, dNTPs, Mg<sup>2</sup><sup>+</sup> and reaction buffer. Each reaction was set up in a final volume of 22 µL containing 4 µL of HOT FIREPol® Master Mix 5×, 0.75 µL of each primer (10 µM), 3 µL of template DNA, and 13.5 µL of nuclease-free water.</p>
    <p>Thermal cycling comprised an initial denaturation step, followed by cycles of denaturation, annealing, and extension, and a final extension for each target (<xref ref-type="table" rid="table2">
      Table 2
     </xref>). PCR products were separated on 1.5% agarose gels containing SYBR Safe® (Invitrogen®) at 100 V for 30 min, and bands were interpreted according to their expected sizes.</p>
    <table-wrap id="table2">
     <label>
      <xref ref-type="table" rid="table2">
       Table 2
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.145996-"></xref>Table 2. Thermal cycling conditions for pvl and tsst1.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="43.08%"><p style="text-align:center">Step</p></td> 
       <td class="custom-bottom-td acenter" width="28.31%"><p style="text-align:center">Gene pvl</p></td> 
       <td class="custom-bottom-td acenter" width="28.61%"><p style="text-align:center">Gene tsst1</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td acenter" width="43.08%"><p style="text-align:center">Initiale denaturation</p></td> 
       <td class="custom-top-td acenter" width="28.31%"><p style="text-align:center">94˚C, 5 min</p></td> 
       <td class="custom-top-td acenter" width="28.61%"><p style="text-align:center">94˚C, 5 min</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="43.08%"><p style="text-align:center">Denaturation (per cycle)</p></td> 
       <td class="acenter" width="28.31%"><p style="text-align:center">94˚C, 30 s</p></td> 
       <td class="acenter" width="28.61%"><p style="text-align:center">94˚C, 1 s</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="43.08%"><p style="text-align:center">Annealing</p></td> 
       <td class="acenter" width="28.31%"><p style="text-align:center">55˚C, 30 s</p></td> 
       <td class="acenter" width="28.61%"><p style="text-align:center">54˚C, 2 s</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="43.08%"><p style="text-align:center">Extension</p></td> 
       <td class="acenter" width="28.31%"><p style="text-align:center">72˚C, 1 min</p></td> 
       <td class="acenter" width="28.61%"><p style="text-align:center">72˚C, 1 s</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="43.08%"><p style="text-align:center">Final extension</p></td> 
       <td class="acenter" width="28.31%"><p style="text-align:center">72˚C, 10 min</p></td> 
       <td class="acenter" width="28.61%"><p style="text-align:center">72˚C, 5 min</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="43.08%"><p style="text-align:center">Number of cycle</p></td> 
       <td class="acenter" width="28.31%"><p style="text-align:center">30</p></td> 
       <td class="acenter" width="28.61%"><p style="text-align:center">35</p></td> 
      </tr> 
     </table>
    </table-wrap>
   </sec>
   <sec id="s2_8">
    <title>2.8. Statistical Analysis</title>
    <p>Data were entered and analysed using Excel and R. Associations between variables were assessed using the chi-squared test, and a p-value &lt; 0.05 was considered statistically significant.</p>
   </sec>
   <sec id="s2_9">
    <title>2.9. Ethical Considerations</title>
    <p>This study used isolates stored from routine diagnostic samples collected at the Angré University Hospital. No data were collected that could be used to determine the patients’ personal data, and all information was processed in an anonymized form. In accordance with current regulations, formal ethical approval was not required.</p>
   </sec>
  </sec><sec id="s3">
   <title>3. Results</title>
   <sec id="s3_1">
    <title>3.1. General Characteristics of the Isolates</title>
    <p>A total of 200 isolates were included, with equal representation of MRSA and MSSA strains. <xref ref-type="table" rid="table3">
      Table 3
     </xref> summarizes the general characteristics of these isolates.</p>
    <table-wrap id="table3">
     <label>
      <xref ref-type="table" rid="table3">
       Table 3
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.145996-"></xref>Table 3. General characteristics of S. aureus isolates (n = 200).</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="24.99%"><p style="text-align:center">Variable</p></td> 
       <td class="custom-bottom-td acenter" width="30.54%"><p style="text-align:center">Category</p></td> 
       <td class="custom-bottom-td acenter" width="19.46%"><p style="text-align:center">N</p></td> 
       <td class="custom-bottom-td acenter" width="25.01%"><p style="text-align:center">Percent (%)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="custom-top-td acenter" width="24.99%"><p style="text-align:center">Ward</p></td> 
       <td class="custom-top-td acenter" width="30.54%"><p style="text-align:center">Adults</p></td> 
       <td class="custom-top-td acenter" width="19.46%"><p style="text-align:center">124</p></td> 
       <td class="custom-top-td acenter" width="25.01%"><p style="text-align:center">62.0</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="30.54%"><p style="text-align:center">Pediatrics</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">76</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">38.0</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="acenter" width="24.99%"><p style="text-align:center">Cefoxitin test</p></td> 
       <td class="acenter" width="30.54%"><p style="text-align:center">MSSA</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">100</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">50.0</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="30.54%"><p style="text-align:center">MRSA</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">100</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">50.0</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="acenter" width="24.99%"><p style="text-align:center">Specimen site</p></td> 
       <td class="acenter" width="30.54%"><p style="text-align:center">Blood</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">139</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">69.5</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="30.54%"><p style="text-align:center">Other</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">61</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">30.5</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="acenter" width="24.99%"><p style="text-align:center">Clinical severity</p></td> 
       <td class="acenter" width="30.54%"><p style="text-align:center">Non-severe</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">168</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">84.0</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="30.54%"><p style="text-align:center">Severe</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">32</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">16.0</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="acenter" width="24.99%"><p style="text-align:center">Age available</p></td> 
       <td class="acenter" width="30.54%"><p style="text-align:center">Yes</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">110</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">57.4</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="30.54%"><p style="text-align:center">No</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">90</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">42.6</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="acenter" width="24.99%"><p style="text-align:center">Age</p></td> 
       <td class="acenter" width="30.54%"><p style="text-align:center">≥15 years</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">49</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">42.3</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="30.54%"><p style="text-align:center">&lt;15 years</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">61</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">57.7</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="acenter" width="24.99%"><p style="text-align:center">Pvl</p></td> 
       <td class="acenter" width="30.54%"><p style="text-align:center">Positive</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">144</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">72.0</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="30.54%"><p style="text-align:center">Negative</p></td> 
       <td class="acenter" width="19.46%"><p style="text-align:center">56</p></td> 
       <td class="acenter" width="25.01%"><p style="text-align:center">28.0</p></td> 
      </tr> 
     </table>
    </table-wrap>
    <p>
     <xref ref-type="bibr" rid="scirp.145996-"></xref>Continued</p>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td rowspan="2" class="acenter" width="24.99%"><p style="text-align:center">tsst1</p></td> 
      <td class="acenter" width="30.54%"><p style="text-align:center">Positive</p></td> 
      <td class="acenter" width="19.46%"><p style="text-align:center">121</p></td> 
      <td class="acenter" width="25.01%"><p style="text-align:center">60.5</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="30.54%"><p style="text-align:center">Negative</p></td> 
      <td class="acenter" width="19.46%"><p style="text-align:center">79</p></td> 
      <td class="acenter" width="25.01%"><p style="text-align:center">39.5</p></td> 
     </tr> 
    </table>
    <p>*Subset computed only for isolates with available age data (n = 110).</p>
    <p>The 200 clinical Staphylococcus aureus isolates were evenly split between MRSA and MSSA, with most originating from adult wards. Blood was the predominant specimen type, and severe presentations were relatively uncommon (16% of cases). Age data were available for just over half of the isolates; within this subset, cases more often involved patients aged &lt; 15 years than ≥15 years. Overall, pvl (72%) and tsst1 (60.5%) were frequent, underscoring the high burden of virulence determinants in this collection.</p>
   </sec>
   <sec id="s3_2">
    <title>3.2. Prevalence of the Virulence Genes pvl and tsst1 in All Isolates</title>
    <p>Detection of virulence genes by PCR (<xref ref-type="fig" rid="fig1">
      Figure 1
     </xref>) revealed a high prevalence of pvl and tsst1 genes.</p>
    <fig id="fig1" position="float">
     <label>Figure 1</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.145996-"></xref>Figure 1. PCR detection of pvl and tsst1 genes in Staphylococcus aureus isolates. (A) pvl amplification showing the expected band at approximately 433 bp in 13/18 samples. (B) tsst1 amplification showing the expected band at ~271 bp in 10/17 samples. Amplicons were separated on 1.5% agarose gels and visualized with SYBR Safe®. M, 100 bp molecular weight marker. Braces indicate positive samples, the and absence of a band of the expected size denotes a negative result.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272214-rId15.jpeg?20250930041829" />
    </fig>
    <p>The distribution of the combined patterns was as follows: 54% of isolates (n = 108) were pvl<sup>+</sup>/tsst1<sup>+</sup>, 21% (n = 42) pvl<sup>+</sup>/tsst1<sup>−</sup>, 14% (n = 28) pvl⁻/tsst1<sup>+</sup>, and 11% (n = 22) pvl<sup>−</sup>/tsst1<sup>−</sup>.</p>
   </sec>
   <sec id="s3_3">
    <title>3.3. Distribution of pvl and tsst1 by Clinical Service</title>
    <p>The isolates were grouped into four clinical categories: pediatrics/neonatology, adult medicine, surgery/traumatology, and critical care (including ICU, pulmonology, and other high-acuity units). Pediatrics/neonatology contributed 38.0% of isolates (76/200), of which 40.8% were pvl-positive (31/76) and 48.7% were tsst1-positive (tsst1<sup>+</sup>) (37/76). Adult medicine accounted for 26.5% (53/200), with 81.1% pvl-positive (pvl<sup>+</sup>) (43/53) and 47.2% tsst1-positive (25/53). Surgery/traumatology represented 23.5% (47/200), with 89.4% pvl-positive (42/47) and 74.5% tsst1-positive (35/47). Critical care comprised 12.0% (24/200), and all isolates in this group were double positive (pvl<sup>+</sup>/tsst1<sup>+</sup>, 24/24).</p>
   </sec>
   <sec id="s3_4">
    <title>3.4. Distribution and Associations of pvl and tsst1 across Clinical Groups</title>
    <p>Isolates were classified into two categories based on the suspected clinical severity of infection at the time of collection, according to the information available on the accompanying sheets (<xref ref-type="table" rid="table3">
      Table 3
     </xref>).</p>
    <p>PVL positivity was higher in severe than in non-severe episodes (90.09% [30/32] vs. 30.77% [64/137]; p = 0.0002). It was also more frequent in adults than in pediatric patients (88.9% [48/54] vs. 40.78% [31/76]; p = 0.002). No significant differences were observed in pvl rates between specimen types (blood vs. other: 71.2% [99/139] vs. 82.0% [50/61]; p = 0.117). pvl co-occurrence with tsst1 did not differ meaningfully (pvl<sup>+</sup> among tsst1<sup>+</sup> vs. tsst1<sup>−</sup>: 76.1% [70/92] vs. 68.2% [30/44]; p = 0.406).</p>
    <p>For tsst1, no significant associations were found with severity (59.1% [19/32] vs. 45.5% [77/168]; p = 0.180), methicillin resistance (71.0% [49/69] vs. 64.2% [43/67]; p = 0.465), ward (adults vs. pediatrics: 64.8% [35/54] vs. 69.5% [57/82]; p = 0.580), or specimen type (67.0% [93/139] vs. 68.9% [42/61]; p = 0.870).</p>
   </sec>
   <sec id="s3_5">
    <title>3.5. Distribution and Associations of pvl and tsst1 by MRSA/MSSA Status</title>
    <p>The pvl gene was detected in 75% of MRSA (75/100) and 69% of MSSA (69/100) cases, with no significant difference between the groups (p = 0.345). The tsst1 gene was found in 64% of MRSA (64/100) and 57% of MSSA (57/100) and was not significant (p = 0.311). Combined pvl/tsst1 profiles are summarized separately for MRSA and MSSA (<xref ref-type="fig" rid="fig2">
      Figure 2
     </xref>).</p>
    <p>Distribution of virulence gene profiles (pvl and tsst1) among Staphylococcus aureus isolates according to methicillin resistance (MRSA vs. MSSA).</p>
    <p>Four profiles were identified: doubly positive (pvl<sup>+</sup>/tsst-1<sup>+</sup>), pvl<sup>+</sup>/tsst-1<sup>−</sup>, pvl<sup>−</sup>/tsst-1<sup>+</sup> and doubly negative (pvl<sup>−</sup>/tsst-1<sup>−</sup>). The pvl<sup>+</sup>/tsst-1<sup>+</sup> profile was prevalent in MRSA (64%) and MSSA (50%) isolates, respectively. The pvl<sup>+</sup>/tsst-1<sup>−</sup> profile was more common in MSSA (23%) than in MRSA (16%), whereas pvl<sup>−</sup>/tsst1<sup>+</sup> accounted for 12% of MRSA and 16% of MSSA. The pvl<sup>−</sup>/tsst-1<sup>−</sup> profile was the least represented, especially in MRSA (8%) compared with MSSA (11%).</p>
    <fig id="fig2" position="float">
     <label>Figure 2</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.145996-"></xref>Figure 2. Distribution of pvl/tsst-1 combination profiles according to methicillin resistance status.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272214-rId16.jpeg?20250930041830" />
    </fig>
   </sec>
  </sec><sec id="s4">
   <title>4. Discussion</title>
   <sec id="s4_1">
    <title>4.1. Distribution of Virulence Genes in Staphylococcus aureus Clinical Isolates in Abidjan</title>
    <p>This study is part of local efforts to molecularly characterize isolates within the Staphylococcus aureus complex, highlighting the distribution of pvl and tsst1 virulence genes in stored strains. We observed a high prevalence (pvl: 72.0%; tsst1: 60.5%), in agreement with several studies from sub-Saharan Africa, where high frequencies of pvl have been reported, for example, in Ghana (75%) <xref ref-type="bibr" rid="scirp.145996-15">
      [15]
     </xref> and The Gambia (77%) <xref ref-type="bibr" rid="scirp.145996-6">
      [6]
     </xref>, while exceeding the values observed in Senegal (47%) and in several countries included in the multicenter study by Breurec et al. We observed high prevalence (pvl: 72.0%; tsst1: 60.5%), in agreement with several studies from sub-Saharan Africa where high frequencies of pvl have been reported, for example in Ghana (75% ) and The Gambia (77% ), while exceeding the values observed in Senegal (47%) and in several countries included in the multicentre study by Breurec &amp; al. (2011) <xref ref-type="bibr" rid="scirp.145996-16">
      [16]
     </xref>. Conversely, in Europe and Asia, pvl frequencies are often lower (≤30%), with marked local variability (Greece: 19% pvl<sup>+</sup> among S. aureus; China: 20%) <xref ref-type="bibr" rid="scirp.145996-17">
      [17]
     </xref> <xref ref-type="bibr" rid="scirp.145996-18">
      [18]
     </xref>). These discrepancies may reflect, on the one hand, the composition of our sample (inpatients and outpatients), which indicates co-circulation of community and nosocomial strains, and, on the other hand, irregular access to care in our setting, which may favour the spread of strains carrying virulence genes. They also fit within heterogeneous epidemiological contexts, as highlighted by Shallcross et al. They also fit within heterogeneous epidemiological contexts, as highlighted by Shallcross et al. (2013) <xref ref-type="bibr" rid="scirp.145996-19">
      [19]
     </xref>. In addition, the circulation of mobile genetic elements (prophages, pathogenicity islands, and plasmids) can facilitate the acquisition and sometimes co-occurrence of virulence determinants <xref ref-type="bibr" rid="scirp.145996-20">
      [20]
     </xref> <xref ref-type="bibr" rid="scirp.145996-21">
      [21]
     </xref>. In fact, 54% of our isolates were pvl<sup>+</sup>/tsst1<sup>+</sup>, an unusual and rare profile internationally but already described in Pakistan <xref ref-type="bibr" rid="scirp.145996-22">
      [22]
     </xref>, suggesting that some local lineages may combine these factors.</p>
    <p>Distribution by clinical ward showed an over-representation of pvl<sup>+</sup>/tsst1<sup>+</sup> profiles in critical care units, where this profile reached 100% of isolates, as well as high rates in surgery/trauma wards (89.3%). This concentration in high-risk areas is consistent with the role of S. aureus toxins in severe forms (deep abscesses, necrotizing pneumonia, complicated infections), while recognizing that clinical virulence results from a set of bacterial and host factors <xref ref-type="bibr" rid="scirp.145996-2">
      [2]
     </xref> <xref ref-type="bibr" rid="scirp.145996-4">
      [4]
     </xref>. In adult medicine, the pvl gene was present in 81.1% of isolates, indicating substantial circulation of virulent strains outside surgical departments, whereas tsst1 was less frequent (47.1%), possibly reflecting greater lineage diversity or lower selective pressure for this gene in that context. In pediatrics and neonatology, which accounted for most samples, the rates were more moderate for PVL (40%) and tsst1 (48.6%); the relatively high prevalence of tsst1 in this young population with fragile immune systems raises questions about superantigen-specific interactions, even without proven toxic shock <xref ref-type="bibr" rid="scirp.145996-5">
      [5]
     </xref>. Overall, the critical care, surgery, and adult medicine departments concentrated pvl<sup>+</sup>/tsst1<sup>+</sup> profiles, reinforcing the hypothesis that particularly virulent strains contribute to severe S. aureus infections <xref ref-type="bibr" rid="scirp.145996-23">
      [23]
     </xref> <xref ref-type="bibr" rid="scirp.145996-24">
      [24]
     </xref>, whereas the more balanced distribution observed in pediatrics suggests greater genetic diversity of strains and variability in pathogenic potential according to department and patient profile.</p>
   </sec>
   <sec id="s4_2">
    <title>4.2. Association between Virulence Genes (pvl, tsst1), Methicillin Resistance, and Clinical Severity</title>
    <p>Our results revealed that a significant proportion of Staphylococcus aureus strains carrying the pvl gene were present among both susceptible (MSSA) and resistant (MRSA) isolates. This contrasts with data reported in Abidjan by Kacou-N’Douba et al. (2011), where, although pvl was present in more than 60% of samples, no MRSA strain carried pvl <xref ref-type="bibr" rid="scirp.145996-3">
      [3]
     </xref>. The current co-circulation of pvl<sup>+</sup> MRSA observed in our study may reflect local epidemiological evolution, possibly related to the introduction and/or selection of more virulent clones. This aligns with patterns documented elsewhere, including the introduction of pvl<sup>+</sup> isolates into hospitals with subsequent local dissemination <xref ref-type="bibr" rid="scirp.145996-25">
      [25]
     </xref>, and the establishment of pvl<sup>+</sup> community lineages in West Africa <xref ref-type="bibr" rid="scirp.145996-26">
      [26]
     </xref>. Recent molecular epidemiology studies from the region support this observation: in Ghana, a multicenter whole-genome sequencing study reported a high pvl prevalence (65% overall, 84% in MRSA), largely dominated by ST152 <xref ref-type="bibr" rid="scirp.145996-27">
      [27]
     </xref>, while in Nigeria, pvl genes were detected in 12.5% of isolates from soft-tissue infections, in both MRSA and MSSA, with recurrent infection independently associated with pvl carriage <xref ref-type="bibr" rid="scirp.145996-28">
      [28]
     </xref>.</p>
    <p>In our cohort, pvl and tsst1 remained common regardless of MSSA/MRSA status; although they were slightly higher in MRSA, the differences were not statistically significant. This lack of a formal association suggests that, in our context, the dissemination of these virulence genes does not directly depend on methicillin resistance. Internationally, the link between pvl and resistance is heterogeneous and varies by region. In Nigeria, pvl is mainly carried by MSSA, although pvl<sup>+</sup> MRSA are also present <xref ref-type="bibr" rid="scirp.145996-29">
      [29]
     </xref>. In Gaza (Palestine), pvl was detected in both groups at comparable frequencies (MRSA, 30.5%; MSSA, 28.2%) <xref ref-type="bibr" rid="scirp.145996-30">
      [30]
     </xref>.</p>
    <p>The differences between studies can be explained, at least in part, by local epidemiological factors and the circulation of lineages combining resistance and virulence. Without typing (spa/MLST) in our study, we remain cautious and do not propose clonal attribution. As a hypothesis supported by African literature, a recent synthesis reported a continent-wide increase in the distribution of ST1, ST22, and ST152 clones <xref ref-type="bibr" rid="scirp.145996-26">
      [26]
     </xref>, the latter of which is frequently pvl<sup>+</sup> <xref ref-type="bibr" rid="scirp.145996-31">
      [31]
     </xref>. This hypothesis is further reinforced by the Ghanaian findings, where ST152 accounted for the majority of pvl-positive MRSA, suggesting the regional expansion of this epidemic lineage <xref ref-type="bibr" rid="scirp.145996-27">
      [27]
     </xref>. The absence of differences across specimen types suggests that pvl functions mainly as a general virulence determinant, acting across multiple infection sites, and is more closely linked to the clonal background than to the site of isolation <xref ref-type="bibr" rid="scirp.145996-19">
      [19]
     </xref>.</p>
    <p>Clinically, we observed a significant association between pvl and disease severity. This finding is consistent with reports linking pvl to deep-seated skin and soft tissue infections (dSSTIs) and necrotizing pneumonia <xref ref-type="bibr" rid="scirp.145996-13">
      [13]
     </xref> <xref ref-type="bibr" rid="scirp.145996-32">
      [32]
     </xref> <xref ref-type="bibr" rid="scirp.145996-33">
      [33]
     </xref>. However, pvl-positive isolates are also found in mild infections, underscoring that severity depends on multiple host- and site-related factors <xref ref-type="bibr" rid="scirp.145996-1">
      [1]
     </xref> <xref ref-type="bibr" rid="scirp.145996-19">
      [19]
     </xref>. The higher pvl frequency in adults than in pediatric patients should be interpreted with caution, since the ward (adults vs. pediatrics) was used as a proxy for age due to missing data. This approach may lead to misclassification, which usually attenuates, rather than generates, associations. Therefore, the observed signal is plausible; however, confirmation using actual age data is required. In contrast, tsst1 was not associated with disease severity in the present study population. This aligns with the notion that tsst1 is mainly a marker of a specific syndrome (toxic shock) rather than a consistent predictor of severity across all S. aureus infections <xref ref-type="bibr" rid="scirp.145996-24">
      [24]
     </xref> <xref ref-type="bibr" rid="scirp.145996-34">
      [34]
     </xref>. Finally, the co-occurrence of pvl and tsst1 alone is not sufficient to establish a systematic link with methicillin resistance or severity outside the targeted syndromes.</p>
   </sec>
   <sec id="s4_3">
    <title>4.3. Limitations and Public Health Implications</title>
    <p>This study had some limitations. First, the isolates were obtained from a single hospital, which limits the generalizability of the findings to the entire country. Second, some clinical data linked to the isolates were incomplete, constraining the assessment of risk factors (prior antibiotic exposure, immune status, and comprehensive resistance profiles). Finally, our analysis focused on two major virulence genes (pvl and tsst1) without in-depth molecular typing namely MLST (multilocus sequence typing of seven housekeeping genes to assign sequence types and clonal complexes), spa typing (sequencing the polymorphic X region of the spa gene to derive t-types), and SCCmec characterization (defining the staphylococcal cassette chromosome mec that carries mecA/mecC and ccr genes) which would have refined the characterization of circulating lineages and their epidemiological potential.</p>
    <p>Despite these constraints, the high prevalence of virulence determinants suggests an elevated risk of invasive disease and severe complications in the future. In settings with limited diagnostic and therapeutic resources, the circulation of virulent and potentially methicillin-resistant strains poses major challenges for patient care and safety.</p>
    <p>From a public health perspective in Côte d’Ivoire, these findings highlight the need for strengthened microbiological surveillance of S. aureus that integrates both resistance and virulence markers. Priorities include reinforcing hospital laboratory capacity (basic molecular biology), establishing a small sentinel network to monitor MRSA and virulence genes with regular reporting, incorporating S. aureus indicators into infection prevention programs, and providing targeted training on early diagnosis, isolation, and antimicrobial stewardship. Finally, a One Health approach should be considered, taking into account community reservoirs and possible zoonotic sources of infection.</p>
   </sec>
  </sec><sec id="s5">
   <title>5. Conclusion</title>
   <p>This study highlights the high prevalence of the virulence genes pvl and tsst1 among clinical isolates of Staphylococcus aureus in Abidjan, with a high proportion of double-positive strains, particularly in departments that manage severe cases of infection. The absence of a significant association with methicillin resistance suggests independent dissemination of resistance, possibly driven by specific lineages. The association between pvl and severe cases supports its involvement in virulence, although its presence alone does not systematically predict clinical severity. These findings underscore the importance of strengthening surveillance by combining virulence-gene detection with molecular typing (spa, MLST, SCCmec) to identify circulating clones, better understand their epidemiological dynamics, and anticipate the risks associated with hypervirulent strains.</p>
  </sec><sec id="s6">
   <title>6. Thanks</title>
   <p>This project did not receive any funding.</p>
   <p>We would like to thank all those who contributed to this study. We thank CHU Angré ( Medical Biology Laboratory, Bacteriology Unit) for their support, equipment, and biological materials. We would like to thank Dr. Pakora Alex, Prof. Koffi Stéphane and Prof. Gonedele Seri from the bacteriology-virology laboratories of the Medical Sciences Department, Central Laboratory (Bacteriology and Molecular Biology Unit of the Treichville University Hospital) and the genetics laboratory of the Biosciences Department of Technology for providing valuable field infrastructure.</p>
  </sec><sec id="s7">
   <title>Authors’ Contributions</title>
   <p>ODNC was involved in all stages of the research (study design, data collection, data analysis, and data interpretation) and wrote the manuscript. BGA and CDYM participated in sample collection and associated data. CGAE contributed to the molecular analysis and manuscript revision. KKAA participated in the statistical analysis and interpretation of the data. KNA and DAJ supervised the conceptualization and study design, critically revised the manuscript, and contributed to the final version of the manuscript.</p>
   <p>All authors have read and approved the final manuscript.</p>
  </sec><sec id="s8">
   <title>Abbreviations</title>
   <p>All abbreviations are defined at their first mention in the text.</p>
  </sec>
 </body><back>
  <ref-list>
   <title>References</title>
   <ref id="scirp.145996-ref1">
    <label>1</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Tong, S.Y.C., Davis, J.S., Eichenberger, E., Holland, T.L. and Fowler, V.G. (2015) Staphylococcus aureus Infections: Epidemiology, Pathophysiology, Clinical Manifestations, and Management. Clinical Microbiology Reviews, 28, 603-661. &gt;https://doi.org/10.1128/cmr.00134-14
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref2">
    <label>2</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     David, M.Z. and Daum, R.S. (2010) Community-Associated Methicillin-Resistant Staphylococcus aureus: Epidemiology and Clinical Consequences of an Emerging Epidemic. Clinical Microbiology Reviews, 23, 616-687. &gt;https://doi.org/10.1128/cmr.00081-09
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref3">
    <label>3</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Kacou N’Douba, A., Koffi, K.S., Ekaza, E., Kouamé-Elogne, C., Anne, B.J.C. and Dosso, M. (2011) Staphylococcus aureus Infection and Virulence Genes in Abidjan (Côte d’Ivoire). European Journal of Scientific Research, 52, 339-344.
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref4">
    <label>4</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Otto, M. (2014) Staphylococcus aureus Toxins. Current Opinion in Microbiology, 17, 32-37. &gt;https://doi.org/10.1016/j.mib.2013.11.004
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref5">
    <label>5</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Fraser, J.D. and Proft, T. (2008) The Bacterial Superantigen and Superantigen‐like Proteins. Immunological Reviews, 225, 226-243. &gt;https://doi.org/10.1111/j.1600-065x.2008.00681.x
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref6">
    <label>6</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Darboe, S., Dobreniecki, S., Jarju, S., Jallow, M., Mohammed, N.I., Wathuo, M., et al. (2019) Prevalence of Panton-Valentine Leukocidin (PVL) and Antimicrobial Resistance in Community-Acquired Clinical Staphylococcus aureus in an Urban Gambian Hospital: A 11-Year Period Retrospective Pilot Study. Frontiers in Cellular and Infection Microbiology, 9, Article 170. &gt;https://doi.org/10.3389/fcimb.2019.00170
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref7">
    <label>7</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Grebe, T., Rudolf, V., Gouleu, C.S., Löffler, B., Adegnika, A.A., Shittu, A.O., et al. (2022) Neutralization of the Staphylococcus aureus Panton-Valentine Leukocidin by African and Caucasian Sera. BMC Microbiology, 22, Article No. 219. &gt;https://doi.org/10.1186/s12866-022-02636-5
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref8">
    <label>8</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Krizo, G.A., Kanga, T., Anné, J., Ouassa, T., Djatchi, R., Cablan, M., et al. (2020) Characterization of Staphylococcus aureus from Pasteur Institute in Côte d’Ivoire: Methicillin Resistance, Reduced Sensitivity to Vancomycin, Panton-Valentine Leukotoxin, and Exfoliatins. West Africa Journal of Medicine, 37, 640-644.
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref9">
    <label>9</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Akoua-Koffi, C., Kacou N’Douba, A., Djaman, J.A., Herrmann, M., Schaumburg, F. and Niemann, S. (2022) Staphylococcus schweitzeri—An Emerging One Health Pathogen? Microorganisms, 10, Article 770. &gt;https://doi.org/10.3390/microorganisms10040770
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref10">
    <label>10</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Brakstad, O.G., Aasbakk, K. and Maeland, J.A. (1992) Detection of Staphylococcus aureus by Polymerase Chain Reaction Amplification of the Nuc Gene. Journal of Clinical Microbiology, 30, 1654-1660. &gt;https://doi.org/10.1128/jcm.30.7.1654-1660.1992
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref11">
    <label>11</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zhang, D., Xia, W., Zhang, W., Wang, G., Shen, M., Zhang, H., et al. (2016) Molecular Typing and Characterization of Staphylococcus aureus Isolates from Cases of Bovine Mastitis in China. Transboundary and Emerging Diseases, 63, 161-168. 
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref12">
    <label>12</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     French Society of Microbiology, Committee for Antibiotic Susceptibility Testing (CA-SFM/EUCAST) (2024) Recommendations 2024—V1.0. SFM. &gt;https://www.sfm-microbiologie.org/wp-content/uploads/2024/06/CASFM2024_V1.0.pdf 
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref13">
    <label>13</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lina, G., Piemont, Y., Godail-Gamot, F., Bes, M., Peter, M., Gauduchon, V., et al. (1999) Involvement of Panton-Valentine Leukocidin—Producing Staphylococcus aureus in Primary Skin Infections and Pneumonia. Clinical Infectious Diseases, 29, 1128-1132. &gt;https://doi.org/10.1086/313461
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref14">
    <label>14</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zarei Koosha, R., Mahmoodzadeh Hosseini, H., Mehdizadeh Aghdam, E., Ghorbani Tajandareh, S. and Imani Fooladi, A.A. (2016) Distribution of Tsst-1 and mecA Genes in Staphylococcus aureus Isolated from Clinical Specimens. Jundishapur Journal of Microbiology, 9, e29057. &gt;https://doi.org/10.5812/jjm.29057
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref15">
    <label>15</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Dekker, D., Wolters, M., Mertens, E., Boahen, K.G., Krumkamp, R., Eibach, D., et al. (2016) Antibiotic Resistance and Clonal Diversity of Invasive Staphylococcus aureus in the Rural Ashanti Region, Ghana. BMC Infectious Diseases, 16, Article No. 720. &gt;https://doi.org/10.1186/s12879-016-2048-3
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref16">
    <label>16</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Breurec, S., Zriouil, S.B., Fall, C., Boisier, P., Brisse, S., Djibo, S., et al. (2011) Epidemiology of Methicillin-Resistant Staphylococcus aureus Lineages in Five Major African Towns: Emergence and Spread of Atypical Clones. Clinical Microbiology and Infection, 17, 160-165. &gt;https://doi.org/10.1111/j.1469-0691.2010.03219.x
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref17">
    <label>17</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Vittorakis, E., Vică, M.L., Zervaki, C.O., Vittorakis, E., Maraki, S., Mavromanolaki, V.E., et al. (2023) Examining the Prevalence and Antibiotic Susceptibility of S. Aureus Strains in Hospitals: An Analysis of the PVL Gene and Its Co-Occurrence with Other Virulence Factors. Microorganisms, 11, Article 841. &gt;https://doi.org/10.3390/microorganisms11040841
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref18">
    <label>18</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Yuan, W., Liu, J., Zhan, Y., Wang, L., Jiang, Y., Zhang, Y., et al. (2019) Molecular Typing Revealed the Emergence of PVL-Positive Sequence Type 22 Methicillin-Susceptible Staphylococcus aureus in Urumqi, Northwestern China. Infection and Drug Resistance, 12, 1719-1728. &gt;https://doi.org/10.2147/idr.s202906
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref19">
    <label>19</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Shallcross, L.J., Fragaszy, E., Johnson, A.M. and Hayward, A.C. (2013) The Role of the Panton-Valentine Leucocidin Toxin in Staphylococcal Disease: A Systematic Review and Meta-Analysis. The Lancet Infectious Diseases, 13, 43-54. &gt;https://doi.org/10.1016/s1473-3099(12)70238-4
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref20">
    <label>20</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Malachowa, N. and DeLeo, F.R. (2010) Mobile Genetic Elements of Staphylococcus aureus. Cellular and Molecular Life Sciences, 67, 3057-3071. &gt;https://doi.org/10.1007/s00018-010-0389-4
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref21">
    <label>21</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Goerke, C. and Wolz, C. (2014) Adaptation of Staphylococcus aureus to the Human Host: Role of Mobile Genetic Elements and Regulation of Virulence Expression. International Journal of Medical Microbiology, 304, 117-122. 
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref22">
    <label>22</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Khan, S., Marasa, B.S., Sung, K. and Nawaz, M. (2021) Genotypic Characterization of Clinical Isolates of Staphylococcus aureus from Pakistan. Pathogens, 10, Article 918. &gt;https://doi.org/10.3390/pathogens10080918
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref23">
    <label>23</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Gillet, Y., Issartel, B., Vanhems, P., Fournet, J., Lina, G., Bes, M., et al. (2002) Association between Staphylococcus aureus Strains Carrying Gene for Panton-Valentine Leukocidin and Highly Lethal Necrotising Pneumonia in Young Immunocompetent Patients. The Lancet, 359, 753-759. &gt;https://doi.org/10.1016/s0140-6736(02)07877-7
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref24">
    <label>24</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Touaitia, R., Ibrahim, N.A., Abdullah Almuqri, E., Basher, N.S., Idres, T. and Touati, A. (2025) Toxic Shock Syndrome Toxin-1 (TSST-1) in Staphylococcus aureus: Prevalence, Molecular Mechanisms, and Public Health Implications. Toxins, 17, Article 323. &gt;https://doi.org/10.3390/toxins17070323
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref25">
    <label>25</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Klein, S., Hannesen, J., Zanger, P., Heeg, K., Boutin, S. and Nurjadi, D. (2020) Entry of Panton-Valentine Leukocidin-Positive Methicillin-Resistant Staphylococcus aureus into the Hospital: Prevalence and Population Structure in Heidelberg, Germany 2015-2018. Scientific Reports, 10, Article No. 13243. &gt;https://doi.org/10.1038/s41598-020-70112-z
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref26">
    <label>26</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lawal, O.U., Ayobami, O., Abouelfetouh, A., Mourabit, N., Kaba, M., Egyir, B., et al. (2022) A 6-Year Update on the Diversity of Methicillin-Resistant Staphylococcus aureus Clones in Africa: A Systematic Review. Frontiers in Microbiology, 13, Article 860436. &gt;https://doi.org/10.3389/fmicb.2022.860436
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref27">
    <label>27</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Egyir, B., Owusu-Nyantakyi, C., Bortey, A., Rabbi Amuasi, G., Owusu, F.A., Boateng, W., et al. (2024) Whole Genome Sequencing Revealed High Proportions of ST152 MRSA among Clinical Staphylococcus aureus Isolates from Ten Hospitals in Ghana. mSphere, 9, e0044624. &gt;https://doi.org/10.1128/msphere.00446-24
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref28">
    <label>28</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ide, C.J., Ogban, G.I., Ekeng, B.E., Emanghe, U.E., Onukak, A.E., Iwuafor, A.A., et al. (2025) Molecular Detection of mecA and lukSF-PV in Patients with Staphylococcus aureus Soft Tissue Infections in a Tertiary Hospital Setting, Calabar, Nigeria: A Cross-Sectional Study. Therapeutic Advances in Infectious Disease, 12, 1-11. &gt;https://doi.org/10.1177/20499361251357394
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref29">
    <label>29</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ayepola, O.O., Olasupo, N.A., Egwari, L.O., Becker, K. and Schaumburg, F. (2015) Molecular Characterization and Antimicrobial Susceptibility of Staphylococcus aureus Isolates from Clinical Infection and Asymptomatic Carriers in Southwest Nigeria. PLOS ONE, 10, e0137531. &gt;https://doi.org/10.1371/journal.pone.0137531
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref30">
    <label>30</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     El Aila, N.A., Al Laham, N.A. and Naas, T. (2023) Prevalence of mecA and Panton-Valentine Leukocidin Genes in Staphylococcus aureus Clinical Isolates from Gaza Strip Hospitals. Microorganisms, 11, Article 1155. &gt;https://doi.org/10.3390/microorganisms11051155
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref31">
    <label>31</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Schaumburg, F., Alabi, A.S., Peters, G. and Becker, K. (2014) New Epidemiology of Staphylococcus aureus Infection in Africa. Clinical Microbiology and Infection, 20, 589-596. &gt;https://doi.org/10.1111/1469-0691.12690
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref32">
    <label>32</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Friesen, J., Neuber, R., Fuhrmann, J., Kietzmann, H., Wenzel, T., Schaumburg, F., et al. (2020) Panton-Valentine Leukocidin-Positive Staphylococcus aureus in Skin and Soft Tissue Infections from Primary Care Patients. Clinical Microbiology and Infection, 26, 1416.e1-1416.e4. &gt;https://doi.org/10.1016/j.cmi.2020.06.029
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref33">
    <label>33</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Duployez, C., Le Guern, R., Tinez, C., Lejeune, A., Robriquet, L., Six, S., et al. (2020) Panton-Valentine Leukocidin-Secreting Staphylococcus aureus Pneumonia Complicating Covid-19. Emerging Infectious Diseases, 26, 1939-1941. &gt;https://doi.org/10.3201/eid2608.201413
    </mixed-citation>
   </ref>
   <ref id="scirp.145996-ref34">
    <label>34</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Durand, G., Bes, M., Meugnier, H., Enright, M.C., Forey, F., Liassine, N., et al. (2006) Detection of New Methicillin-Resistant Staphylococcus aureus Clones Containing the Toxic Shock Syndrome Toxin 1 Gene Responsible for Hospital-and Community-Acquired Infections in France. Journal of Clinical Microbiology, 44, 3053-3053. &gt;https://doi.org/10.1128/jcm.00871-06
    </mixed-citation>
   </ref>
  </ref-list>
 </back>
</article>