<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article">
 <front>
  <journal-meta>
   <journal-id journal-id-type="publisher-id">
    abb
   </journal-id>
   <journal-title-group>
    <journal-title>
     Advances in Bioscience and Biotechnology
    </journal-title>
   </journal-title-group>
   <issn pub-type="epub">
    2156-8456
   </issn>
   <issn publication-format="print">
    2156-8502
   </issn>
   <publisher>
    <publisher-name>
     Scientific Research Publishing
    </publisher-name>
   </publisher>
  </journal-meta>
  <article-meta>
   <article-id pub-id-type="doi">
    10.4236/abb.2025.168019
   </article-id>
   <article-id pub-id-type="publisher-id">
    abb-144696
   </article-id>
   <article-categories>
    <subj-group subj-group-type="heading">
     <subject>
      Articles
     </subject>
    </subj-group>
    <subj-group subj-group-type="Discipline-v2">
     <subject>
      Biomedical 
     </subject>
     <subject>
       Life Sciences
     </subject>
    </subj-group>
   </article-categories>
   <title-group>
    Molecular Detection of Herpesviridae (HSV 1/2, VZV, EBV, CMV, HHV-6) among Patients with Encephalitis in Côte d’Ivoire
   </title-group>
   <contrib-group>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Aboubacar
      </surname>
      <given-names>
       Bamba
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Kouadio Stéphane
      </surname>
      <given-names>
       Koffi
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Eric Essoh
      </surname>
      <given-names>
       Akpa
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Kobina Amandze Adams
      </surname>
      <given-names>
       Kofi
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Edgard Valery
      </surname>
      <given-names>
       Adjogoua
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff3"> 
      <sup>3</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Sodji Emilie Karen
      </surname>
      <given-names>
       N’Goran
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff4"> 
      <sup>4</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Zélica
      </surname>
      <given-names>
       Diallo
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff5"> 
      <sup>5</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Flora
      </surname>
      <given-names>
       Ahonzo
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Arouna
      </surname>
      <given-names>
       Coulibaly
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff5"> 
      <sup>5</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Fiacre Delord
      </surname>
      <given-names>
       Offoumou
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff6"> 
      <sup>6</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Pacôme
      </surname>
      <given-names>
       Monemo
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff7"> 
      <sup>7</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Mbodje Ophélia
      </surname>
      <given-names>
       Gnamon
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff8"> 
      <sup>8</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Kalpy Julien
      </surname>
      <given-names>
       Coulibaly
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff3"> 
      <sup>3</sup>
     </xref>
    </contrib>
   </contrib-group> 
   <aff id="aff1">
    <addr-line>
     aHuman, Animal, and Plant Health Unit, Doctoral School of Biology, Environment and Health, Félix Houphouët Boigny University, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff2">
    <addr-line>
     aMolecular Biology Unit, Bacteriology-Virology Laboratory, University Hospital of Treichville, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff3">
    <addr-line>
     aPasteur Institute, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff4">
    <addr-line>
     aBacteriology Unit, Medical Biology Department, University Hospital of Angré, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff5">
    <addr-line>
     aInfectious and Tropical Diseases Department, University Hospital of Treichville, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff6">
    <addr-line>
     aNeurology Department, University Hospital of Cocody, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff7">
    <addr-line>
     aBacteriology and Virology Unit, University Hospital of Bouaké, Bouaké, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff8">
    <addr-line>
     aIntensive Care Unit, University Hospital of Treichville, Abidjan, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <pub-date pub-type="epub">
    <day>
     11
    </day> 
    <month>
     08
    </month>
    <year>
     2025
    </year>
   </pub-date> 
   <volume>
    16
   </volume> 
   <issue>
    08
   </issue>
   <fpage>
    291
   </fpage>
   <lpage>
    304
   </lpage>
   <history>
    <date date-type="received">
     <day>
      10,
     </day>
     <month>
      July
     </month>
     <year>
      2025
     </year>
    </date>
    <date date-type="published">
     <day>
      8,
     </day>
     <month>
      July
     </month>
     <year>
      2025
     </year> 
    </date> 
    <date date-type="accepted">
     <day>
      8,
     </day>
     <month>
      August
     </month>
     <year>
      2025
     </year> 
    </date>
   </history>
   <permissions>
    <copyright-statement>
     © Copyright 2014 by authors and Scientific Research Publishing Inc. 
    </copyright-statement>
    <copyright-year>
     2014
    </copyright-year>
    <license>
     <license-p>
      This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/
     </license-p>
    </license>
   </permissions>
   <abstract>
    <b>Background</b>: Encephalitis is a serious neurological syndrome that can be caused by various infectious agents, particularly in immunocompromised individuals. Among these agents, viruses from the Herpesviridae family play a major role, although their diagnosis is often underestimated and their involvement remains poorly understood, particularly in developing countries such as those in West Africa. 
    <b>Aim</b>: This cross-sectional, descriptive, multicenter study was conducted in hospitals in two regions of Côte d’Ivoire, namely Abidjan and Bouaké, between March 2024 and April 2025 to assess the prevalence of herpesviruses. 
    <b>Methods</b>: CSF samples were collected from patients aged ≥ 15 years who presented with clinical signs of encephalitis and were subjected to molecular analysis. Viral DNA extraction and PCR tests were used to detect Herpes simplex virus 1 and 2 (HSV 1/2), Varicella-Zoster virus (VZV), Epstein-Barr virus (EBV), Cytomegalovirus (CMV), and Human herpesvirus 6 (HHV6). Clinical data and molecular analysis results were recorded using Excel software, and statistical analysis was performed using RStudio 4.2.1 software. Results are presented as mean and standard deviation for quantitative variables and as percentages for qualitative variables. 
    <b>Results</b>: A total of 388 patients were included in this study (222 women and 166 men; age range 15 - 79 years; mean age 45.36 ± 13.55 years), and 60 (15.46%) were positive for one or more herpesvirus. Epstein-Barr virus was most frequently detected in 33 (55.00%) of positive cases, followed by Cytomegalovirus with 20 (33.33%) and Varicella-Zoster virus and Human herpes virus 6 with respective rates of 20.00% (12) for VZV and 11.67% (07) for HHV6. A single Herpes simplex virus (1.67%) was detected. Among the patients with a positive PCR, 10 (16.67%) were co-infected with herpesviruses. All co-infected patients were HIV seropositive. The chi-square test showed a significant association between HIV infection status and the molecular detection of herpesvirus in patients with encephalitis (OR 3.9; 95% CI: [1.4 - 9.3]; P &lt; 0.0015). 
    <b>Conclusion</b>: Herpesviruses are a significant cause of encephalitis, particularly in immunocompromised and immunocompetent patients. In our study, EBV and CMV were the most common. Therefore, the rapid identification of these viruses in the CSF and the initiation of appropriate antiviral treatment are essential to reduce mortality and improve the management of patients with encephalitis. Furthermore, the development of new antiviral molecules, optimization of therapeutic strategies, and improvement of diagnostic techniques would provide prospects for better control of these infections.
   </abstract>
   <kwd-group> 
    <kwd>
     Viral Encephalitis
    </kwd> 
    <kwd>
      Herpesviridae
    </kwd> 
    <kwd>
      Côte d’Ivoire
    </kwd> 
    <kwd>
      HIV Infection
    </kwd> 
    <kwd>
      PCR
    </kwd>
   </kwd-group>
  </article-meta>
 </front>
 <body>
  <sec id="s1">
   <title>1. Introduction</title>
   <p>
    <xref ref-type="bibr" rid="scirp.144696-"></xref>Encephalitis is a severe neurological syndrome associated with high morbidity and mortality, long-term neurological sequelae, and a significant burden on the healthcare system <xref ref-type="bibr" rid="scirp.144696-1">
     [1]
    </xref>. It is a relatively common disease, with a global incidence of 1.5 - 14 cases per 100,000 people annually <xref ref-type="bibr" rid="scirp.144696-2">
     [2]
    </xref>. In Africa, the annual prevalence of encephalitis is between 10% and 20% <xref ref-type="bibr" rid="scirp.144696-3">
     [3]
    </xref>. Data on the causes of encephalitis in West Africa are sparse, with infectious pathogens of the central nervous system typically identified through isolated case reports <xref ref-type="bibr" rid="scirp.144696-4">
     [4]
    </xref> <xref ref-type="bibr" rid="scirp.144696-5">
     [5]
    </xref>. Information specific to Côte d’Ivoire is particularly lacking. Nonetheless, regional studies suggest a rising incidence of viral encephalitis, especially linked to herpesviruses, with cases documented in various hospitals. Recent studies in urban areas estimate a prevalence of 5 - 8 cases per 100,000 people annually, although this figure can fluctuate depending on the diagnostic capabilities of local laboratories <xref ref-type="bibr" rid="scirp.144696-3">
     [3]
    </xref>.</p>
   <p>Encephalitis can result from a wide range of infectious and non-infectious etiologies. Bacterial, fungal, and parasitic agents, such as Mycobacterium tuberculosis, Listeria monocytogenes, Cryptococcus neoformans, and Toxoplasma gondii, remain important, particularly in individuals with compromised immune systems. Autoimmune encephalitis and paraneoplastic syndromes have been increasingly recognized in clinical practice <xref ref-type="bibr" rid="scirp.144696-6">
     [6]
    </xref>. However, viruses remain the predominant cause worldwide, with herpesviruses responsible for most cases of encephalitis <xref ref-type="bibr" rid="scirp.144696-7">
     [7]
    </xref> <xref ref-type="bibr" rid="scirp.144696-8">
     [8]
    </xref>.</p>
   <p>Among herpesviruses, HSV-1, HSV-2, VZV, EBV, CMV, and HHV-6 are the most frequently implicated, particularly in high-resource settings where their diagnosis is well established <xref ref-type="bibr" rid="scirp.144696-9">
     [9]
    </xref>. In contrast, in low- and middle-income countries, including those in West Africa, the burden is unknown because of limited access to advanced diagnostic tools and treatments.</p>
   <p>Real-time PCR has emerged as a powerful tool for the rapid, sensitive, and simultaneous detection of multiple pathogens directly from cerebrospinal fluid <xref ref-type="bibr" rid="scirp.144696-8">
     [8]
    </xref> <xref ref-type="bibr" rid="scirp.144696-10">
     [10]
    </xref> <xref ref-type="bibr" rid="scirp.144696-11">
     [11]
    </xref>. This technique significantly improves the diagnostic yield, especially in settings where empirical treatment is common and laboratory infrastructure is limited. The implementation of molecular methods in routine diagnostic processes could significantly improve the early detection and management of herpes virus-associated encephalitis in Côte d’Ivoire and other similar settings with limited resources.</p>
   <p>This study aimed to determine the prevalence of Herpesviridae in patients with encephalitis who were hospitalized in tertiary care centers in Côte d’Ivoire. The findings of this study are expected to highlight the role of herpesviruses in encephalitis cases and support the implementation of molecular tests, such as real-time PCR, as routine diagnostic tools in the national surveillance and management of encephalitis.</p>
  </sec><sec id="s2">
   <title>2. Material and Methods</title>
   <sec id="s2_1">
    <title>2.1. Study Design and Participants</title>
    <p>It is a cross-sectional, multicenter study carried out between March 2024 and April 2025 in teaching hospital centers in two regions of Côte d’Ivoire (Bouaké and Abidjan), that receive the majority of patients from different areas in Côte d’Ivoire with signs of encephalitis (fever, convulsions, altered consciousness). Informed consent was obtained from all participants in this study, either directly from the patient when conscious or from a legal representative if the patient was unable to provide consent.</p>
    <p>Socioepidemiological and clinical data were collected from the patients’ medical records using a data collection form. Participants’ sociodemographic data, such as age and sex, were collected using a survey form. The clinical data were extracted from the patient files. The questionnaire included exposure history, symptoms, and clinical signs of encephalitis.</p>
   </sec>
   <sec id="s2_2">
    <title>
     <xref ref-type="bibr" rid="scirp.144696-"></xref>2.2. Inclusion/Exclusion Criteria</title>
    <p>This study focused on patients aged 15 years or older who were admitted to the hospital with clinical signs consistent with encephalitis, such as fever, confusion, convulsions, or neurological deficits, and who provided their informed consent directly or indirectly through a legal representative. Patients with a confirmed non-infectious diagnosis and those with contraindications for lumbar puncture were also excluded from the study.</p>
   </sec>
   <sec id="s2_3">
    <title>2.3. Sample Collection</title>
    <p>A volume of 500 µL of cerebrospinal fluid (CSF) was collected from all patients included in the study under strict sterile conditions by lumbar puncture performed by trained medical staff. Samples were collected in sterile tubes and immediately transported to the Molecular Biology Unit of the CHU Treichville Central Laboratory for further analyses.</p>
    <p>In the laboratory, samples were stored at –20˚C until molecular analysis was performed.</p>
   </sec>
   <sec id="s2_4">
    <title>2.4. Laboratory Analysis</title>
    <p>Cerebrospinal fluid samples were thawed at room temperature and gently homogenized. Viral DNA was extracted from 200 µL of CSF using a commercial extraction kit (PureLink<sup>TM</sup> Genomic DNA Mini Kit, Invitrogen) according to the manufacturer’s protocol. The extracted DNA was immediately used for amplification or stored at –20˚C until analysis.</p>
    <p>The extracted DNA was used as template for PCR reactions targeting 6 viruses of the Herpesviridae family, namely, Cytomegalovirus, Varicella-zoster virus, Herpes simplex type 1 and 2, Epstein Barr virus and Human Herpesvirus type 6. <xref ref-type="table" rid="table1">
      Table 1
     </xref> shows the nucleotide sequences of the primers and probes used for the target genes of each of the viruses.</p>
    <table-wrap id="table1">
     <label>
      <xref ref-type="table" rid="table1">
       Table 1
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.144696-"></xref>Table 1. Probes, primers and target genes for the viruses tested.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="14.12%"><p style="text-align:center">Herpesvirus</p></td> 
       <td class="custom-bottom-td acenter" width="10.30%"><p style="text-align:center">Target</p></td> 
       <td class="custom-bottom-td acenter" width="49.99%"><p style="text-align:center">Primers and hydrolysis probe TaqMan (5’→3’)</p></td> 
       <td class="custom-bottom-td acenter" width="11.76%"><p style="text-align:center">Reference</p></td> 
      </tr> 
      <tr> 
       <td rowspan="3" class="custom-top-td acenter" width="14.12%"><p style="text-align:center">HSV 1/2</p></td> 
       <td rowspan="3" class="custom-top-td acenter" width="10.30%"><p style="text-align:center">gB</p></td> 
       <td class="custom-top-td acenter" width="49.99%"><p style="text-align:center">F CCGTCAGCACCTTCATCGA</p></td> 
       <td rowspan="3" class="custom-top-td acenter" width="11.76%"><p style="text-align:center">
         <xref ref-type="bibr" rid="scirp.144696-12">
          [12]
         </xref></p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="49.99%"><p style="text-align:center">R CGCTGGACCTCCGTGTAGTC</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td acenter" width="49.99%"><p style="text-align:center">P (FAM) CCACGAGATCAAGGACAGCGGCC (TAMRA)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="3" class="custom-top-td acenter" width="14.12%"><p style="text-align:center">CMV</p></td> 
       <td rowspan="3" class="custom-top-td acenter" width="10.30%"><p style="text-align:center">US8</p></td> 
       <td class="custom-top-td acenter" width="49.99%"><p style="text-align:center">F ACCAACATAAGGACTTTTCACACTTTT</p></td> 
       <td rowspan="3" class="custom-top-td acenter" width="11.76%"><p style="text-align:center"></p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="49.99%"><p style="text-align:center">R GAATACAGACACTTAGAGCTCGGGGT</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td acenter" width="49.99%"><p style="text-align:center">P (FAM) CTGGCCAGCACGTATCCCAACAGCA (TAMRA)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="3" class="custom-top-td acenter" width="14.12%"><p style="text-align:center">EBV</p></td> 
       <td rowspan="3" class="custom-top-td acenter" width="10.30%"><p style="text-align:center">BXLF1</p></td> 
       <td class="custom-top-td acenter" width="49.99%"><p style="text-align:center">F GGGGCAAAATACTGTGTTAG</p></td> 
       <td rowspan="3" class="custom-top-td acenter" width="11.76%"><p style="text-align:center"></p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="49.99%"><p style="text-align:center">R CGGGGGACACCATAGT</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td acenter" width="49.99%"><p style="text-align:center">P (FAM) CGGCGCATGTTCTCCTCCAC (TAMRA)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="3" class="custom-top-td acenter" width="14.12%"><p style="text-align:center">HHV6</p></td> 
       <td rowspan="3" class="custom-top-td acenter" width="10.30%"><p style="text-align:center">U65_U66</p></td> 
       <td class="custom-top-td acenter" width="49.99%"><p style="text-align:center">F GACAATCACATGCCTGGATAATG</p></td> 
       <td rowspan="3" class="custom-top-td acenter" width="11.76%"><p style="text-align:center"></p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="49.99%"><p style="text-align:center">R TGTAAGCGTGTGGTAATGGACTAA</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td acenter" width="49.99%"><p style="text-align:center">P (FAM) AGCAGCTGGCGAAAAGTGCTGTGC (TAMRA)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="3" class="custom-top-td acenter" width="14.12%"><p style="text-align:center">VZV</p></td> 
       <td rowspan="3" class="custom-top-td acenter" width="10.30%"><p style="text-align:center">ORF63</p></td> 
       <td class="custom-top-td acenter" width="49.99%"><p style="text-align:center">F CGCGTTTTGTACTCCGGG</p></td> 
       <td rowspan="3" class="custom-top-td acenter" width="11.76%"><p style="text-align:center"></p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="49.99%"><p style="text-align:center">R ACGGTTGATGTCCTCAACGAG</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="49.99%"><p style="text-align:center">P (FAM) TGGGAGATCCACCCGGCCAG (TAMRA)</p></td> 
      </tr> 
     </table>
    </table-wrap>
    <p>F = forward; R = reverse; P = probe.</p>
    <p>PCR was performed in a total volume of 20 µL, consisting of 15 µL of reaction mixture (4 μL of HOT FIREPol <sup>®</sup> Plus qPCR master mix (without ROX), 0.5 μl of primers and probe corresponding to each virus target gene, and 9.5 µL of sterile nuclease-free water) and 5 µL of extracted DNA.</p>
    <p>The cycling conditions for the reaction were as follows: initial denaturation at 95˚C for 15 min, followed by a cyclic phase repeated 40 times, including a denaturation step at 95˚C for 15 s and a hybridization-elongation step at 60˚C for 1 min. The Bio-Rad CFX96 C1000 thermal cycler (Bio-Rad Laboratories Inc., USA) was used for cycling and analysis of PCR results. Negative and positive samples for the different targets of interest were included in the tests as negative and positive controls, respectively, to validate the results. Samples with cycle threshold (Ct) values lower than 38 were considered positive. Samples with a clear amplification curve but Ct values greater than 38 were considered negative.</p>
   </sec>
   <sec id="s2_5">
    <title>
     <xref ref-type="bibr" rid="scirp.144696-"></xref>2.5. Data Management and Statistical Analysis</title>
    <p>Data collected from the form were recorded using Excel version 2019 (Microsoft Corporation, Washington, USA), and analysed with statistical software R version 4.2.1 (The R Foundation, Auckland, United States). Statistical analysis was used to assess the distribution of demographic and clinical characteristics and the associations between the various parameters.</p>
    <p>A descriptive analysis was performed to summarize the data collected. Summary frequencies and proportions were used to describe all nominal characteristics, including sex and patient symptoms. The mean and standard deviation were used to describe quantitative variables. Comparisons between groups were made using the Chi2 test (or Fisher’s exact test when numbers were small) for categorical variables. For all analyses, a value (P &lt; 0.05) was considered statistically significant.</p>
   </sec>
   <sec id="s2_6">
    <title>2.6. Ethics</title>
    <p>This study was conducted after administrative authorization was granted by the management of the various participating teaching hospitals, and approval was obtained from the Comité National d’Éthique des Sciences de la Vie et de la Santé (CNESVS), which examined and approved the study protocol with reference number 00211 24/MSHPCMU/CNESVS-km. Written informed consent was obtained from all the patients. For patients under the age of 18 years and those with altered consciousness, consent was obtained from their parents or legal representatives.</p>
    <p>In addition, the study was conducted in accordance with the principles governing the conduct of research involving human subjects as set out in the Declaration of Helsinki <xref ref-type="bibr" rid="scirp.144696-17">
      [17]
     </xref>.</p>
   </sec>
  </sec><sec id="s3">
   <title>3. Results</title>
   <sec id="s3_1">
    <title>3.1. Demographic and Clinical Characteristics of Included Patients</title>
    <p>This study included 388 participants in total. The majority (76.03%, n = 295) of the participants were from Treichville Teaching Hospital, followed by 15.46% (n = 60) from Angré teaching hospital, 7.22% (n = 28) from Bouaké teaching hospital, and 1.29% (n = 5) from Cocody teaching hospital. The participants comprised 222 (57.22%) women and 166 men (42.78%), with a sex ratio (M/F) of 1.34. The age of the participants ranged from 15 to 79 years, with a mean age of 45.36 ± 13.56 years. With regard to symptoms, the principal clinical manifestations observed in patients suspected of suffering from herpesvirus encephalitis were altered consciousness (confusion), fever, and convulsions. Fever was the most common symptom, observed independently in 13 patients (3.35%), or in association with altered consciousness (AC) in 185 patients (47.68%), with convulsions in 23 patients (5.93%), or with both manifestations in 26 patients (6.70%). Other symptoms were observed in 141 (36.34 %) patients. In addition, 282 patients (72.68%) included in this study were HIV-infected. The demographic and clinical characteristics of the patients are shown in <xref ref-type="table" rid="table2">
      Table 2
     </xref>.</p>
    <table-wrap id="table2">
     <label>
      <xref ref-type="table" rid="table2">
       Table 2
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.144696-"></xref>Table 2. Summary of demographic and clinical characteristics of the patients.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="31.38%"><p style="text-align:center">Variable</p></td> 
       <td class="custom-bottom-td acenter" width="40.42%"><p style="text-align:center">Category</p></td> 
       <td class="custom-bottom-td acenter" width="28.20%"><p style="text-align:center">N (%)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="4" class="custom-top-td acenter" width="31.38%"><p style="text-align:center">Age</p></td> 
       <td class="custom-top-td acenter" width="40.42%"><p style="text-align:center">[15 - 29[</p></td> 
       <td class="custom-top-td acenter" width="28.20%"><p style="text-align:center">53 (13.66%)</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.42%"><p style="text-align:center">[30 - 44[</p></td> 
       <td class="acenter" width="28.20%"><p style="text-align:center">150 (38.66%)</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.42%"><p style="text-align:center">[45 - 59[</p></td> 
       <td class="acenter" width="28.20%"><p style="text-align:center">111 (28.61%)</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td acenter" width="40.42%"><p style="text-align:center">≥60</p></td> 
       <td class="custom-bottom-td acenter" width="28.20%"><p style="text-align:center">74 (19.07%)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="custom-top-td acenter" width="31.38%"><p style="text-align:center">Gender</p></td> 
       <td class="custom-top-td acenter" width="40.42%"><p style="text-align:center">Men</p></td> 
       <td class="custom-top-td acenter" width="28.20%"><p style="text-align:center">166 (42.78%)</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td acenter" width="40.42%"><p style="text-align:center">Women</p></td> 
       <td class="custom-bottom-td acenter" width="28.20%"><p style="text-align:center">222 (57.22%)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="4" class="custom-top-td acenter" width="31.38%"><p style="text-align:center">Provenance</p></td> 
       <td class="custom-top-td acenter" width="40.42%"><p style="text-align:center">Treichville</p></td> 
       <td class="custom-top-td acenter" width="28.20%"><p style="text-align:center">295 (76.03%)</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.42%"><p style="text-align:center">Angré</p></td> 
       <td class="acenter" width="28.20%"><p style="text-align:center">60 (15.46%)</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.42%"><p style="text-align:center">Cocody</p></td> 
       <td class="acenter" width="28.20%"><p style="text-align:center">5 (1.29%)</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td acenter" width="40.42%"><p style="text-align:center">Bouaké</p></td> 
       <td class="custom-bottom-td acenter" width="28.20%"><p style="text-align:center">28 (7.22%)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="5" class="custom-top-td acenter" width="31.38%"><p style="text-align:center">Symptoms</p></td> 
       <td class="custom-top-td acenter" width="40.42%"><p style="text-align:center">Fever</p></td> 
       <td class="custom-top-td acenter" width="28.20%"><p style="text-align:center">23 (5.93%)</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.42%"><p style="text-align:center">Fever + AC*</p></td> 
       <td class="acenter" width="28.20%"><p style="text-align:center">185 (47.68%)</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.42%"><p style="text-align:center">Fever + AC* + Seizures</p></td> 
       <td class="acenter" width="28.20%"><p style="text-align:center">13 (3.35%)</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.42%"><p style="text-align:center">Fever + Seizures</p></td> 
       <td class="acenter" width="28.20%"><p style="text-align:center">26 (6.70%)</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.42%"><p style="text-align:center">Other symptoms</p></td> 
       <td class="acenter" width="28.20%"><p style="text-align:center">141 (36.34%)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="3" class="custom-top-td acenter" width="31.38%"><p style="text-align:center">HIV Status</p></td> 
       <td class="custom-top-td acenter" width="40.42%"><p style="text-align:center">HIV+</p></td> 
       <td class="custom-top-td acenter" width="28.20%"><p style="text-align:center">282 (72.68%)</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.42%"><p style="text-align:center">HIV−</p></td> 
       <td class="acenter" width="28.20%"><p style="text-align:center">11 (2.84%)</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.42%"><p style="text-align:center">Not available</p></td> 
       <td class="acenter" width="28.20%"><p style="text-align:center">95 (24.48%)</p></td> 
      </tr> 
     </table>
    </table-wrap>
    <p>*AC = altered consciousness.</p>
   </sec>
   <sec id="s3_2">
    <title>3.2. Viral Etiologies</title>
    <p>PCR test results revealed the presence of viruses in sixty (60) patients, corresponding to a prevalence of 15.46%. The Epstein-Barr virus (EBV) was the most frequently detected virus. Among the patients with a positive PCR for Herpesviridae, 10 (16.67%) were co-infected with at least two Herpesviridae viruses. The co-infection associations were varied and mostly included CMV, EBV and VZV. In 70% of cases, the most frequent associations were CMV + EBV, EBV + HHV6, VZV + HHV6 and CMV + VZV. Only 30% of cases showed triple associations of CMV + HSV + VZV, CMV + EBV + HHV6 and CMV + VZV + HHV6. <xref ref-type="table" rid="table3">
      Table 3
     </xref> shows the detection frequency of each targeted herpesvirus in the study population.</p>
    <table-wrap id="table3">
     <label>
      <xref ref-type="table" rid="table3">
       Table 3
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.144696-"></xref>Table 3. Prevalence of viruses detected.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="30.18%" colspan="2"><p style="text-align:center"></p></td> 
       <td class="custom-bottom-td acenter" width="15.08%"><p style="text-align:center">PCR+</p></td> 
       <td class="custom-bottom-td acenter" width="34.48%"><p style="text-align:center">Prevalence of positivity (n = 60)</p></td> 
       <td class="custom-bottom-td acenter" width="32.32%"><p style="text-align:center">Overall prevalence (n = 388)</p></td> 
      </tr> 
      <tr> 
       <td rowspan="5" class="custom-top-td acenter" width="14.23%"><p style="text-align:center">Virus</p></td> 
       <td class="custom-top-td acenter" width="15.95%"><p style="text-align:center">EBV</p></td> 
       <td class="custom-top-td acenter" width="15.08%"><p style="text-align:center">33</p></td> 
       <td class="custom-top-td acenter" width="34.48%"><p style="text-align:center">55.00%</p></td> 
       <td class="custom-top-td acenter" width="32.32%"><p style="text-align:center">8.50%</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.95%"><p style="text-align:center">CMV</p></td> 
       <td class="acenter" width="15.08%"><p style="text-align:center">20</p></td> 
       <td class="acenter" width="34.48%"><p style="text-align:center">33.33%</p></td> 
       <td class="acenter" width="32.32%"><p style="text-align:center">5.15%</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.95%"><p style="text-align:center">VZV</p></td> 
       <td class="acenter" width="15.08%"><p style="text-align:center">12</p></td> 
       <td class="acenter" width="34.48%"><p style="text-align:center">20.00%</p></td> 
       <td class="acenter" width="32.32%"><p style="text-align:center">3.09%</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.95%"><p style="text-align:center">HHV6</p></td> 
       <td class="acenter" width="15.08%"><p style="text-align:center">7</p></td> 
       <td class="acenter" width="34.48%"><p style="text-align:center">11.67%</p></td> 
       <td class="acenter" width="32.32%"><p style="text-align:center">1.80%</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.95%"><p style="text-align:center">HSV1/2</p></td> 
       <td class="acenter" width="15.08%"><p style="text-align:center">1</p></td> 
       <td class="acenter" width="34.48%"><p style="text-align:center">1.67%</p></td> 
       <td class="acenter" width="32.32%"><p style="text-align:center">0.26%</p></td> 
      </tr> 
     </table>
    </table-wrap>
   </sec>
   <sec id="s3_3">
    <title>3.3. Factors Associated with Viral Infection</title>
    <p>Analysis of demographic variables revealed no statistically significant association between age (P = 0.09) or sex (P = 0.54) and PCR positivity for Herpesviridae. Comparison between hospital centers revealed variable detection rates: 25% at Bouaké teaching hospital (7/28), 16.61% at Treichville teaching hospital (49/295), 6.7% at Angré teaching hospital (4/60), and 0% at Cocody teaching hospital. However, these differences were not statistically significant (P = 0.08).</p>
    <p>From a clinical aspect, a significant association was observed between the detection of Herpesviridae and the concomitant presentation of fever and disorders of consciousness (P = 0.005). In addition, HIV infection appeared to be a risk factor strongly associated with PCR positivity in this study. HIV-positive patients represented 91.67% (55/60) of herpesvirus PCR-positive patients, compared with 1.67% (1/60) of HIV-negative patients and 6.67% (4/60) of patients with unknown status. This correlation was statistically significant (OR = 3.9; 95% CI: [1.4 - 9.3]; P &lt; 0.001). All associations between clinical and epidemiological characteristics and PCR results are presented in <xref ref-type="table" rid="table4">
      Table 4
     </xref>.</p>
   </sec>
  </sec><sec id="s4">
   <title>4. Discussion</title>
   <p>The introduction of virological diagnostic techniques in the laboratory reduces the burden on both patients and health services. Indeed, some encephalitis etiologies have specific treatments, such as herpesviruses, for which there are well-established antiviral treatments <xref ref-type="bibr" rid="scirp.144696-18">
     [18]
    </xref>-<xref ref-type="bibr" rid="scirp.144696-20">
     [20]
    </xref>. Rapid identification of the etiology is essential, as these neurological infections are fatal and therefore require rapid and effective laboratory tests to diagnose the etiological agents. Once the etiology is established, therapeutic interventions are less difficult.</p>
   <table-wrap id="table4">
    <label>
     <xref ref-type="table" rid="table4">
      Table 4
     </xref></label>
    <caption>
     <title>
      <xref ref-type="bibr" rid="scirp.144696-"></xref>Table 4. Summary of factors associated with PCR status.</title>
    </caption>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td class="custom-bottom-td acenter" width="15.10%"><p style="text-align:center">Variable</p></td> 
      <td class="custom-bottom-td acenter" width="28.01%"><p style="text-align:center">Category</p></td> 
      <td class="custom-bottom-td acenter" width="21.89%"><p style="text-align:center">PCR+ (n = 60)</p></td> 
      <td class="custom-bottom-td acenter" width="22.02%"><p style="text-align:center">PCR− (n = 328)</p></td> 
      <td class="custom-bottom-td acenter" width="12.98%"><p style="text-align:center">P-value</p></td> 
     </tr> 
     <tr> 
      <td rowspan="4" class="custom-top-td acenter" width="15.10%"><p style="text-align:center">Age</p></td> 
      <td class="custom-top-td acenter" width="28.01%"><p style="text-align:center">[15 - 29[</p></td> 
      <td class="custom-top-td acenter" width="21.89%"><p style="text-align:center">8 (15.09%)</p></td> 
      <td class="custom-top-td acenter" width="22.02%"><p style="text-align:center">45 (84.91%)</p></td> 
      <td rowspan="4" class="custom-top-td acenter" width="12.98%"><p style="text-align:center">0.09</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="28.01%"><p style="text-align:center">[30 - 44[</p></td> 
      <td class="acenter" width="21.89%"><p style="text-align:center">17 (11.33%)</p></td> 
      <td class="acenter" width="22.02%"><p style="text-align:center">133 (88.67%)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="28.01%"><p style="text-align:center">[45 - 59[</p></td> 
      <td class="acenter" width="21.89%"><p style="text-align:center">25 (22.52%)</p></td> 
      <td class="acenter" width="22.02%"><p style="text-align:center">86 (77.48%)</p></td> 
     </tr> 
     <tr> 
      <td class="custom-bottom-td acenter" width="28.01%"><p style="text-align:center">≥60</p></td> 
      <td class="custom-bottom-td acenter" width="21.89%"><p style="text-align:center">10 (13.51%)</p></td> 
      <td class="custom-bottom-td acenter" width="22.02%"><p style="text-align:center">64 (86.51%)</p></td> 
     </tr> 
     <tr> 
      <td rowspan="2" class="custom-top-td acenter" width="15.10%"><p style="text-align:center">Gender</p></td> 
      <td class="custom-top-td acenter" width="28.01%"><p style="text-align:center">Men</p></td> 
      <td class="custom-top-td acenter" width="21.89%"><p style="text-align:center">23 (13.86%)</p></td> 
      <td class="custom-top-td acenter" width="22.02%"><p style="text-align:center">143 (86.14%)</p></td> 
      <td rowspan="2" class="custom-top-td acenter" width="12.98%"><p style="text-align:center">0.54</p></td> 
     </tr> 
     <tr> 
      <td class="custom-bottom-td acenter" width="28.01%"><p style="text-align:center">Women</p></td> 
      <td class="custom-bottom-td acenter" width="21.89%"><p style="text-align:center">37 (16.67)</p></td> 
      <td class="custom-bottom-td acenter" width="22.02%"><p style="text-align:center">185 (83.33%)</p></td> 
     </tr> 
     <tr> 
      <td rowspan="4" class="custom-top-td acenter" width="15.10%"><p style="text-align:center">Provenance</p></td> 
      <td class="custom-top-td acenter" width="28.01%"><p style="text-align:center">Treichville</p></td> 
      <td class="custom-top-td acenter" width="21.89%"><p style="text-align:center">49 (16.61%)</p></td> 
      <td class="custom-top-td acenter" width="22.02%"><p style="text-align:center">246 (83.39%)</p></td> 
      <td rowspan="4" class="custom-top-td acenter" width="12.98%"><p style="text-align:center">0.08</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="28.01%"><p style="text-align:center">Angré</p></td> 
      <td class="acenter" width="21.89%"><p style="text-align:center">4 (6.67%)</p></td> 
      <td class="acenter" width="22.02%"><p style="text-align:center">56 (93.33%)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="28.01%"><p style="text-align:center">Cocody</p></td> 
      <td class="acenter" width="21.89%"><p style="text-align:center">0 (0.0%)</p></td> 
      <td class="acenter" width="22.02%"><p style="text-align:center">5 (100.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="custom-bottom-td acenter" width="28.01%"><p style="text-align:center">Bouaké</p></td> 
      <td class="custom-bottom-td acenter" width="21.89%"><p style="text-align:center">7 (25.0%)</p></td> 
      <td class="custom-bottom-td acenter" width="22.02%"><p style="text-align:center">21 (75.0%)</p></td> 
     </tr> 
     <tr> 
      <td rowspan="5" class="custom-top-td acenter" width="15.10%"><p style="text-align:center">Symptoms</p></td> 
      <td class="custom-top-td acenter" width="28.01%"><p style="text-align:center">Fever</p></td> 
      <td class="custom-top-td acenter" width="21.89%"><p style="text-align:center">2 (8.70%)</p></td> 
      <td class="custom-top-td acenter" width="22.02%"><p style="text-align:center">21 (91.30%)</p></td> 
      <td rowspan="5" class="custom-top-td acenter" width="12.98%"><p style="text-align:center">0.005</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="28.01%"><p style="text-align:center">Fever + AC</p></td> 
      <td class="acenter" width="21.89%"><p style="text-align:center">42 (22.70%)</p></td> 
      <td class="acenter" width="22.02%"><p style="text-align:center">143 (77.30%)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="28.01%"><p style="text-align:center">Fever + AC + Seizures</p></td> 
      <td class="acenter" width="21.89%"><p style="text-align:center">0 (0.00%)</p></td> 
      <td class="acenter" width="22.02%"><p style="text-align:center">13 (100.00%)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="28.01%"><p style="text-align:center">Fever + Seizures</p></td> 
      <td class="acenter" width="21.89%"><p style="text-align:center">7 (26.92%)</p></td> 
      <td class="acenter" width="22.02%"><p style="text-align:center">19 (73.08%)</p></td> 
     </tr> 
     <tr> 
      <td class="custom-bottom-td acenter" width="28.01%"><p style="text-align:center">Other symptoms</p></td> 
      <td class="custom-bottom-td acenter" width="21.89%"><p style="text-align:center">9 (6.38%)</p></td> 
      <td class="custom-bottom-td acenter" width="22.02%"><p style="text-align:center">132 (93.62%)</p></td> 
     </tr> 
     <tr> 
      <td rowspan="3" class="custom-top-td acenter" width="15.10%"><p style="text-align:center">HIV Status</p></td> 
      <td class="custom-top-td acenter" width="28.01%"><p style="text-align:center">HIV+</p></td> 
      <td class="custom-top-td acenter" width="21.89%"><p style="text-align:center">55 (19.50%)</p></td> 
      <td class="custom-top-td acenter" width="22.02%"><p style="text-align:center">227 (80.50%)</p></td> 
      <td rowspan="3" class="custom-top-td acenter" width="12.98%"><p style="text-align:center">&lt; 0.0015</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="28.01%"><p style="text-align:center">HIV−</p></td> 
      <td class="acenter" width="21.89%"><p style="text-align:center">1 (9.1%)</p></td> 
      <td class="acenter" width="22.02%"><p style="text-align:center">10 (90.90%)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="28.01%"><p style="text-align:center">Not available</p></td> 
      <td class="acenter" width="21.89%"><p style="text-align:center">4 (4.2%)</p></td> 
      <td class="acenter" width="22.02%"><p style="text-align:center">91 (95.79%)</p></td> 
     </tr> 
    </table>
   </table-wrap>
   <p>In our study, encephalitis predominantly occurred in adult patients. This observation differs from those of studies conducted in other countries, such as Brazil <xref ref-type="bibr" rid="scirp.144696-21">
     [21]
    </xref>, Australia <xref ref-type="bibr" rid="scirp.144696-22">
     [22]
    </xref> or Sweden <xref ref-type="bibr" rid="scirp.144696-23">
     [23]
    </xref>. In these studies, encephalitis was more frequent in the juvenile population. The mean age of the patients in the present study was 45.36 ± 13.57 years, and the predominance of females (57.22%) suggests a trend that diverges slightly from the global data. Indeed, viral encephalitis most often affects children and the elderly, in contrast to the results of the present study, which predominantly involved young adults. This difference could be explained by the medical history of the patients included in this study. Indeed, 91.67% of those infected with Herpesvirus were also HIV-positive, highlighting an interaction between these pathogens. By weakening the immune system, HIV promotes the reactivation of latent herpesviruses, which can lead to serious complications, such as encephalitis <xref ref-type="bibr" rid="scirp.144696-24">
     [24]
    </xref>. This observation is consistent with the literature, where it is well documented that HIV patients have an increased risk of herpesvirus encephalitis, particularly EBV, CMV, and HHV6 <xref ref-type="bibr" rid="scirp.144696-25">
     [25]
    </xref>. Young adults are more affected by HIV and are more vulnerable to opportunistic infections, including viral encephalitis. The hypothesis of co-infection favoring viral reactivation could explain this difference <xref ref-type="bibr" rid="scirp.144696-26">
     [26]
    </xref>.</p>
   <p>In terms of clinical signs, fever, disturbances of consciousness, and convulsions are characteristic of herpesvirus encephalitis, as described in other studies <xref ref-type="bibr" rid="scirp.144696-27">
     [27]
    </xref>. The frequencies observed in the present study were consistent with the results of other studies on viral encephalitis <xref ref-type="bibr" rid="scirp.144696-28">
     [28]
    </xref> <xref ref-type="bibr" rid="scirp.144696-29">
     [29]
    </xref>. PCR revealed that 15.46% of patients were positive for at least one herpesvirus. This rate is consistent with the expected figures for opportunistic infections in immunocompromised patients <xref ref-type="bibr" rid="scirp.144696-30">
     [30]
    </xref> <xref ref-type="bibr" rid="scirp.144696-31">
     [31]
    </xref>. However, the viral etiologies observed differed from those in other parts of the world. In this study, Epstein-Barr virus (EBV) was the most frequent pathogen, accounting for 55.00% of positive cases, followed by Cytomegalovirus (CMV), Varicella zoster virus and Human Herpesvirus type 6 (HHV6), and Herpes simplex virus 1 and 2, with 20.00%, 11.67%, and 1.67%, respectively.</p>
   <p>This distribution is unusual in the literature. Indeed, Herpes Simplex virus (HSV) has been described in numerous studies as the most frequent cause of herpetic encephalitis, particularly in high-income countries <xref ref-type="bibr" rid="scirp.144696-32">
     [32]
    </xref>. However, this virus had the lowest rate in the present study. This low rate of HSV could be explained by local factors (vaccination, local viral prevalence, and influence of co-infections) or epidemiological factors specific to Côte d’Ivoire. Indeed, the high frequency of EBV in the present study could also be linked to the prevalence of HIV in the patients tested, since this virus is strongly associated with complications such as lymphoma in immunocompromised individuals <xref ref-type="bibr" rid="scirp.144696-33">
     [33]
    </xref>.</p>
   <p>The results of this study also highlight several significant associations between clinical and demographic factors, and the detection of Herpesviridae by PCR, with important clinical and epidemiological implications. The significant association between HIV infection and Herpesviridae detection (OR = 3.9; IC 95%: [1.4 - 9.3]; P &lt; 0.0015) confirms the key role of immune status in Herpesviridae infections. This result corroborates global data highlighting the role of immunosuppression in the reactivation of latent herpesviruses, notably CMV and EBV <xref ref-type="bibr" rid="scirp.144696-34">
     [34]
    </xref> <xref ref-type="bibr" rid="scirp.144696-35">
     [35]
    </xref>. Previous studies have reported a higher prevalence of Herpesviridae infections in immunocompromised patients, sometimes reaching up to 20% - 30% in patients hospitalized for encephalitis <xref ref-type="bibr" rid="scirp.144696-36">
     [36]
    </xref>. The prevalence observed in this 55/282 study (19.50%) is therefore consistent with these data, underlining the importance of systematic screening for Herpesviridae in HIV + patients with neurological signs. In the sub-Saharan context, where HIV remains endemic, this association reinforces the need for systematic screening for Herpesviridae in HIV-positive patients, in line with WHO recommendations <xref ref-type="bibr" rid="scirp.144696-3">
     [3]
    </xref>.</p>
   <p>In this study, the rate of PCR positivity varied significantly between university hospitals. In Abidjan, the highest rate was observed at Treichville University Hospital (16.61%), compared to Angré (6.67%) and Cocody (0%). These disparities could reflect differences in the influx of patients or the severity of cases admitted. Treichville University Hospital, being a national referral center, probably receives more severe patients or cases referred from other establishments, which would explain the high rate of positive PCRs results <xref ref-type="bibr" rid="scirp.144696-37">
     [37]
    </xref>. However, the absence of PCR-positive cases at the CHU de Cocody could be due to low recruitment rates. Bouaké University Hospital (7 PCR + /28 patients) had a small number of patients (n = 28), which could limit statistical analysis, and is a frequent challenge in multicenter African studies <xref ref-type="bibr" rid="scirp.144696-38">
     [38]
    </xref>. The high rate of positive cases observed at Bouaké University Hospital (25%, 7/28) calls for particular attention. Bouaké, being located in a central area of Côte d’Ivoire, could reflect a higher prevalence in rural populations where access to early care is limited, or a higher concentration of untreated HIV + patients.</p>
   <p>No statistically significant association was found between patient age (P = 0.09), sex (P = 0.54), and Herpesviridae detection. These results are consistent with previous studies, which indicate that Herpesviridae infections are not strictly linked to age groups or sex differences, although some studies report a slight male predominance for certain viral encephalitides, probably due to behavioral or exposure factors <xref ref-type="bibr" rid="scirp.144696-39">
     [39]
    </xref>. Clinically, the complete absence of PCR + in patients presenting with fever, altered consciousness, and convulsions is an intriguing finding. This result contrasts with Asian studies, where HSV-1 is often associated with convulsions <xref ref-type="bibr" rid="scirp.144696-40">
     [40]
    </xref>. This triad could be linked to bacterial, parasitic, or autoimmune causes, which are dominant in this subgroup <xref ref-type="bibr" rid="scirp.144696-41">
     [41]
    </xref>. The classic triad usually associated with herpetic encephalitis was absent in all PCR-positive patients. This suggests that Herpesviridae infections may present with varied or atypical clinical manifestations, particularly in immunocompromised patients. Studies have shown that fever alone, or associated with disturbances of consciousness without convulsions, can represent a significant proportion of clinical presentations <xref ref-type="bibr" rid="scirp.144696-6">
     [6]
    </xref> <xref ref-type="bibr" rid="scirp.144696-42">
     [42]
    </xref>.</p>
   <p>Bivariate analysis confirmed that HIV infection was an independent risk factor for PCR positivity (OR 3.9; IC 95%: [1.4 - 9.3]; P = 0.0015). This highlights the importance of integrating Herpesviridae screening into the management of HIV + patients, particularly those with neurological symptoms.</p>
   <p>These results highlight the importance of tailored care for patients with neurological disorders, depending on their HIV status and their place of origin. Disparities between university hospital centers highlight the need to strengthen diagnostic capabilities and access to care in the country’s underserved areas. A longitudinal evaluation of Herpesviridae encephalitis cases and their associated factors is essential for improving prevention and management strategies.</p>
  </sec><sec id="s5">
   <title>5. Conclusion</title>
   <p>This study highlights the high burden of herpesvirus encephalitis in immunocompromised patients in Ivorian hospitals. The high proportion of EBV and CMV viruses and the low rate of HSV suggest local epidemiological specificities or are probably linked to HIV infection. These results underline the importance of rapid detection, notably by PCR, for the appropriate management of herpesvirus encephalitis to reduce the morbidity and mortality associated with these infections.</p>
  </sec><sec id="s6">
   <title>Acknowledgements</title>
   <p>We would like to express our deep gratitude to all the structures and institutions that contributed to this study. In particular, we would like to thank the following:</p>
  </sec><sec id="s7">
   <title>Authors’ Contributions</title>
   <p>Aboubacar Bamba, designed the study, drafted the protocol and the manuscript.</p>
   <p>Aboubacar Bamba and Kobina Amandze Adams Kofi carried out the laboratory analyses.</p>
   <p>Flora Ahonzo, Arouna Coulibaly, Sodji Emilie K N’Goran, Pacôme Monemo, Mbodje Ophélia Gnamon for collecting the samples.</p>
   <p>Kalpy Julien Coulibaly, Eric Essoh Akpa, for reading the document.</p>
   <p>Edgard Valery Adjogoua, Zélica Diallo, Pacôme Monemo, for coordinating activities on their behalf.</p>
   <p>Kouadio Stephane Koffi validated the protocol and revised the document.</p>
   <p>All authors have read and approved the manuscript.</p>
  </sec>
 </body><back>
  <ref-list>
   <title>References</title>
   <ref id="scirp.144696-ref1">
    <label>1</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Jmor, F., Emsley, H.C., Fischer, M., Solomon, T. and Lewthwaite, P. (2008) The Incidence of Acute Encephalitis Syndrome in Western Industrialised and Tropical Countries. Virology Journal, 5, Article No. 134. &gt;https://doi.org/10.1186/1743-422x-5-134 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref2">
    <label>2</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Wang, H., Zhao, S., Wang, S., Zheng, Y., Wang, S., Chen, H., et al. (2022) Global Magnitude of Encephalitis Burden and Its Evolving Pattern over the Past 30 Years. Journal of Infection, 84, 777-787. &gt;https://doi.org/10.1016/j.jinf.2022.04.026 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref3">
    <label>3</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     OMS Afrique (2022) Atlas des statistiques sanitaires africaines 2022. Analyse de la situation sanitaire de la Région africaine. &gt;https://iris.who.int/bitstream/handle/10665/364853/9789290313755-fre.pdf?sequence=1&amp;isAllowed=y 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref4">
    <label>4</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Brown, J.R., Bharucha, T. and Breuer, J. (2018) Encephalitis Diagnosis Using Metagenomics: Application of Next Generation Sequencing for Undiagnosed Cases. Journal of Infection, 76, 225-240. &gt;https://doi.org/10.1016/j.jinf.2017.12.014 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref5">
    <label>5</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rezaei, S.J. and Mateen, F.J. (2021) Encephalitis and Meningitis in Western Africa: A Scoping Review of Pathogens. Tropical Medicine&amp;International Health, 26, 388-396. &gt;https://doi.org/10.1111/tmi.13539 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref6">
    <label>6</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Graus, F., Titulaer, M.J., Balu, R., et al. (2016) A Clinical Approach to Diagnosis of Autoimmune Encephalitis. The Lancet Neurology, 15, 391-404.
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref7">
    <label>7</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     de Ory, F., Avellón, A., Echevarría, J.E., Sánchez-Seco, M.P., Trallero, G., Cabrerizo, M., et al. (2013) Viral Infections of the Central Nervous System in Spain: A Prospective Study. Journal of Medical Virology, 85, 554-562. &gt;https://doi.org/10.1002/jmv.23470 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref8">
    <label>8</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mailles, A. and Stahl, J. (2009) Infectious Encephalitis in France in 2007: A National Prospective Study. Clinical Infectious Diseases, 49, 1838-1847. &gt;https://doi.org/10.1086/648419 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref9">
    <label>9</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     DeBiasi, R.L. and Tyler, K.L. (2004) Molecular Methods for Diagnosis of Viral Encephalitis. Clinical Microbiology Reviews, 17, 903-925. &gt;https://doi.org/10.1128/cmr.17.4.903-925.2004
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref10">
    <label>10</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rki (2018) Epidemiologisches Bulletin des Robert Koch-Instituts Ausgabe 48/2019.
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref11">
    <label>11</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Chiu, C.Y., Coffey, L.L., Murkey, J., Symmes, K., Sample, H.A., Wilson, M.R., et al. (2017) Diagnosis of Fatal Human Case of St. Louis Encephalitis Virus Infection by Metagenomic Sequencing, California, 2016. Emerging Infectious Diseases, 23, 1964-1968. &gt;https://doi.org/10.3201/eid2310.161986 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref12">
    <label>12</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Berrington, W.R., Jerome, K.R., Cook, L., Wald, A., Corey, L. and Casper, C. (2009) Clinical Correlates of Herpes Simplex Virus Viremia among Hospitalized Adults. Clinical Infectious Diseases, 49, 1295-1301. &gt;https://doi.org/10.1086/606053 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref13">
    <label>13</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Smith, C.A., Conroy, L.T., Pollock, M., Ruddy, J., Binning, A. and McCruden, E.A.B. (2010) Detection of Herpes Viruses in Respiratory Secretions of Patients Undergoing Artificial Ventilation. Journal of Medical Virology, 82, 1406-1409. &gt;https://doi.org/10.1002/jmv.21794 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref14">
    <label>14</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Magurano, F., Baggieri, M., Marchi, A., Bucci, P., Rezza, G. and Nicoletti, L. (2018) Mumps Clinical Diagnostic Uncertainty. European Journal of Public Health, 28, 119-123. &gt;https://doi.org/10.1093/eurpub/ckx067 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref15">
    <label>15</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Sugita, S., Shimizu, N., Watanabe, K., Ogawa, M., Maruyama, K., Usui, N., et al. (2012) Virological Analysis in Patients with Human Herpes Virus 6–Associated Ocular Inflammatory Disorders. Investigative Opthalmology&amp;Visual Science, 53, 4692-4698. &gt;https://doi.org/10.1167/iovs.12-10095 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref16">
    <label>16</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bienes, K.M., Mao, L., Selekon, B., Gonofio, E., Nakoune, E., Wong, G., et al. (2022) Rapid Detection of the Varicella-Zoster Virus Using a Recombinase-Aided Amplification-Lateral Flow System. Diagnostics, 12, Article 2957. &gt;https://doi.org/10.3390/diagnostics12122957 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref17">
    <label>17</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     World Medical Association Declaration of Helsinki (2013) World Medical Association Declaration of Helsinki: Ethical Principles for Medical Research Involving Human Subjects. American Medical Association. 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref18">
    <label>18</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Binger, T., Annan, A., Drexler, J.F., Müller, M.A., Kallies, R., Adankwah, E., et al. (2015) A Novel Rhabdovirus Isolated from the Straw-Colored Fruit Bat Eidolon Helvum, with Signs of Antibodies in Swine and Humans. Journal of Virology, 89, 4588-4597. &gt;https://doi.org/10.1128/jvi.02932-14
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref19">
    <label>19</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Li, L.-L., Xu, Y.L., Lu, X.X., et al. (2022) Isolation of a Novel Bat Rhabdovirus with Evidence of Human Exposure in China. mBio Journal, 13, e0287521.
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref20">
    <label>20</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Piquet, A.L. and Cho, T.A. (2016) The Clinical Approach to Encephalitis. Current Neurology and Neuroscience Reports, 16, Article No. 45. &gt;https://doi.org/10.1007/s11910-016-0650-9
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref21">
    <label>21</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Do Valle, D.A., Santos, M.L.S.F., Giamberardino, H.I.G., Raboni, S.M. and Scola, R.H. (2020) Acute Childhood Viral Encephalitis in Southern Brazil. Pediatric Infectious Disease Journal, 39, 894-898. &gt;https://doi.org/10.1097/inf.0000000000002709
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref22">
    <label>22</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Britton, P.N., Khoury, L., Booy, R., Wood, N. and Jones, C.A. (2016) Encephalitis in Australian Children: Contemporary Trends in Hospitalisation. Archives of Disease in Childhood, 101, 51-56.
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref23">
    <label>23</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Fowler, Å., Stödberg, T., Eriksson, M. and Wickström, R. (2008) Childhood Encephalitis in Sweden: Etiology, Clinical Presentation and Outcome. European Journal of Paediatric Neurology, 12, 484-490. &gt;https://doi.org/10.1016/j.ejpn.2007.12.009 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref24">
    <label>24</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lindegger, D.J., Rossi, D.C. and Guex-Crosier, Y. (2020) Concurrent Varicella and Herpes Simplex Virus Reactivation in the Same Trigeminal Dermatome in a Person Living with HIV. International Journal of STD&amp;AIDS, 31, 1145-1148. &gt;https://doi.org/10.1177/0956462419899003 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref25">
    <label>25</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Velagapudi, M., Onaiwu, C. and Gupta, V. (2016) Cytomegalovirus (CMV) Encephalitis in HIV Patients. Journal of Neurological Disorders, 4, No. 8. &gt;https://doi.org/10.4172/2329-6895.1000314
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref26">
    <label>26</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mascitti, H. (2020) Infections du système nerveux Infections of the nervous system. 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref27">
    <label>27</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Li, S., Nguyen, I.P. and Urbanczyk, K. (2020) Common Infectious Diseases of the Central Nervous System—Clinical Features and Imaging Characteristics. Quantitative Imaging in Medicine and Surgery, 10, 2227-2259. &gt;https://doi.org/10.21037/qims-20-886 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref28">
    <label>28</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Sili, U., Kaya, A. and Mert, A. (2014) Herpes Simplex Virus Encephalitis: Clinical Manifestations, Diagnosis and Outcome in 106 Adult Patients. Journal of Clinical Virology, 60, 112-118. &gt;https://doi.org/10.1016/j.jcv.2014.03.010 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref29">
    <label>29</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Platz, I.L., Tetens, M.M., Dessau, R., Ellermann-Eriksen, S., Andersen, N.S., Jensen, V.V.S., et al. (2024) Characteristics and Long-Term Prognosis of Danish Residents with a Positive Intrathecal Antibody Index Test for Herpes Simplex Virus or Varicella-Zoster Virus Compared with Individuals with a Positive Cerebrospinal Fluid PCR: A Nationwide Cohort Study. Clinical Microbiology and Infection, 30, 240-246. &gt;https://doi.org/10.1016/j.cmi.2023.11.004 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref30">
    <label>30</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mohamed, W.S., Aldabbagh, H.A., Aldughmani, H.A., et al. (2022) Prevalence of Human Herpesviruses (HHV1-7), and Its Clinical Significance in Middle Eastern Pediatric Leukemia Patients Using 2 Independent PCR Assays. Journal of Applied Microbiological Research, 5, 1-9.
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref31">
    <label>31</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Marjani, A., Hesamizadeh, K., Bokharaei-Salim, F., Khanaliha, K., Karbalaie Niya, M.H., Habib, Z., et al. (2022) Distribution of Epstein-Barr Virus and Human Herpesvirus 8 Co-Infections among Human Immunodeficiency Virus-1 Positive Patients. International Journal of Medical Laboratory, 9, 187-197. &gt;https://doi.org/10.18502/ijml.v9i3.10904 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref32">
    <label>32</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Whitley, R.J. and Kimberlin, D.W. (2005) Herpes Simplex: Encephalitis Children and Adolescents. Seminars in Pediatric Infectious Diseases, 16, 17-23. &gt;https://doi.org/10.1053/j.spid.2004.09.007 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref33">
    <label>33</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Peuchmaur, M., Voisin, J., Vaillant, M., Truffot, A., Lupo, J., Morand, P., et al. (2023) Epstein-Barr Virus Encephalitis: A Review of Case Reports from the Last 25 Years. Microorganisms, 11, Article 2825. &gt;https://doi.org/10.3390/microorganisms11122825 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref34">
    <label>34</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Campbell, J.L., Fay, M.P., Lanning, L.L. and Hewitt, J.A. (2020) Effect of Delaying Treatment on Efficacy of Ciprofloxacin and Levofloxacin in the African Green Monkey Model of Pneumonic Plague. Clinical Infectious Diseases, 70, S60-S65. &gt;https://doi.org/10.1093/cid/ciz1234 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref35">
    <label>35</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Simmons, A. (2002) Clinical Manifestations and Treatment Considerations of Herpes Simplex Virus Infection. The Journal of Infectious Diseases, 186, S71-S77. &gt;https://doi.org/10.1086/342967 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref36">
    <label>36</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Whitley, R.J. and Roizman, B. (2001) Herpes Simplex Virus Infections. The Lancet, 357, 1513-1518. &gt;https://doi.org/10.1016/s0140-6736(00)04638-9 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref37">
    <label>37</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     OMS (2021) Neurological Disorders: Public Health Challenges. World Health Organization.
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref38">
    <label>38</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Granerod, J., Ambrose, H.E., Davies, N.W., Clewley, J.P., Walsh, A.L., Morgan, D., et al. (2010) Causes of Encephalitis and Differences in Their Clinical Presentations in England: A Multicentre, Population-Based Prospective Study. The Lancet Infectious Diseases, 10, 835-844. &gt;https://doi.org/10.1016/s1473-3099(10)70222-x 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref39">
    <label>39</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ondo, W.G. (2020) Current and Emerging Treatments of Essential Tremor. Neurologic Clinics, 38, 309-323. &gt;https://doi.org/10.1016/j.ncl.2020.01.002 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref40">
    <label>40</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Perez, S., Johnson, A., Xiang, S., Li, J., Foley, B.T., Doyle-Meyers, L., et al. (2017) Persistence of SIV in the Brain of Siv-Infected Chinese Rhesus Macaques with or without Antiretroviral Therapy. Journal of NeuroVirology, 24, 62-74. &gt;https://doi.org/10.1007/s13365-017-0594-0 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref41">
    <label>41</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Petit-Pedrol, M., Armangue, T., Peng, X., Bataller, L., Cellucci, T., Davis, R., et al. (2014) Encephalitis with Refractory Seizures, Status Epilepticus, and Antibodies to the GABAA Receptor: A Case Series, Characterisation of the Antigen, and Analysis of the Effects of Antibodies. The Lancet Neurology, 13, 276-286. &gt;https://doi.org/10.1016/s1474-4422(13)70299-0 
    </mixed-citation>
   </ref>
   <ref id="scirp.144696-ref42">
    <label>42</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Echt, D.S., Liebson, P.R., Brent Mitchell, L., et al. (1991) Mortality and Morbidity in Patients Receiving Encainide, Flecainide, or Placebo—The Cardiac Arrtytmia Suppression Trial. The New Journal of Medicine, 324, 781-788.
    </mixed-citation>
   </ref>
  </ref-list>
 </back>
</article>