<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article">
 <front>
  <journal-meta>
   <journal-id journal-id-type="publisher-id">
    ajps
   </journal-id>
   <journal-title-group>
    <journal-title>
     American Journal of Plant Sciences
    </journal-title>
   </journal-title-group>
   <issn pub-type="epub">
    2158-2742
   </issn>
   <issn publication-format="print">
    2158-2750
   </issn>
   <publisher>
    <publisher-name>
     Scientific Research Publishing
    </publisher-name>
   </publisher>
  </journal-meta>
  <article-meta>
   <article-id pub-id-type="doi">
    10.4236/ajps.2025.167064
   </article-id>
   <article-id pub-id-type="publisher-id">
    ajps-144493
   </article-id>
   <article-categories>
    <subj-group subj-group-type="heading">
     <subject>
      Articles
     </subject>
    </subj-group>
    <subj-group subj-group-type="Discipline-v2">
     <subject>
      Biomedical 
     </subject>
     <subject>
       Life Sciences
     </subject>
    </subj-group>
   </article-categories>
   <title-group>
    In Vitro Effect of Indigenous Antagonistic Microorganisms of Dibombari Oil Palm Plantation on in Ganoderma sp., Principal Agent of Basal Stem Rot of Oil Palm (Elaeis guineensis jacq)
   </title-group>
   <contrib-group>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Alphonse
      </surname>
      <given-names>
       Siama
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Armand Deuheula
      </surname>
      <given-names>
       Ngueuleu
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Denis Saah
      </surname>
      <given-names>
       Tassong
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Ledoux Giresse Djomo
      </surname>
      <given-names>
       Nanda
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Emmanuel Lobe
      </surname>
      <given-names>
       Ebongo
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Carnot Charles
      </surname>
      <given-names>
       Asseng
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
   </contrib-group> 
   <aff id="aff1">
    <addr-line>
     aDepartment of Plant Biology, Faculty of Science, University of Douala, Douala, Cameroon
    </addr-line> 
   </aff> 
   <aff id="aff2">
    <addr-line>
     aHigher Institute of Agriculture, Wood, Water and Environment, University of Bertoua, Bélabo, Cameroon
    </addr-line> 
   </aff> 
   <pub-date pub-type="epub">
    <day>
     28
    </day> 
    <month>
     07
    </month>
    <year>
     2025
    </year>
   </pub-date> 
   <volume>
    16
   </volume> 
   <issue>
    07
   </issue>
   <fpage>
    951
   </fpage>
   <lpage>
    966
   </lpage>
   <history>
    <date date-type="received">
     <day>
      21,
     </day>
     <month>
      February
     </month>
     <year>
      2025
     </year>
    </date>
    <date date-type="published">
     <day>
      26,
     </day>
     <month>
      February
     </month>
     <year>
      2025
     </year> 
    </date> 
    <date date-type="accepted">
     <day>
      26,
     </day>
     <month>
      July
     </month>
     <year>
      2025
     </year> 
    </date>
   </history>
   <permissions>
    <copyright-statement>
     © Copyright 2014 by authors and Scientific Research Publishing Inc. 
    </copyright-statement>
    <copyright-year>
     2014
    </copyright-year>
    <license>
     <license-p>
      This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/
     </license-p>
    </license>
   </permissions>
   <abstract>
    Ganoderma sp. is the main fungus that affects the oil palm, causing the basal stem rot. This fungus can lead to a significant economic loss of 43% in an oil palm plantation. To address this challenge, the management strategy focuses on developing a cost-effective and environmentally friendly integrated control method. Special emphasis has been placed on the use of indigenous antagonistic microorganisms. To achieve this, the microbial biodiversity in oil palm has been explored. Fungi and bacteria have been isolated from soil beneath their roots. Additionally, Ganoderma sp. has been isolated from fruiting bodies located at the base of infected oil palms. The antagonistic effect of these microorganisms on Ganoderma sp. has been assessed in vitro. The results showed that in dual culture test with Ganoderma sp., two microorganisms, the fungus (CS1) and the bacterium (IBS6) showed fungicidal effects with PIRG value of 66% and 72% respectively. Furthermore, the molecular identification revealed that fungus (CS1) exhibits a 99.79% similarity with Trichoderma virens, while the bacterium (IBS
    <sub>6</sub>) shows 100% similarity with Bacillus subtilis.
   </abstract>
   <kwd-group> 
    <kwd>
     Antagonistic
    </kwd> 
    <kwd>
      Bacillus subtilis
    </kwd> 
    <kwd>
      Ganoderma sp.
    </kwd> 
    <kwd>
      Microorganisms
    </kwd> 
    <kwd>
      Trichoderma Vierns
    </kwd>
   </kwd-group>
  </article-meta>
 </front>
 <body>
  <sec id="s1">
   <title>1. Introduction</title>
   <p>Oil palm (Elaeis guineensis jacq) is a monocotyledon from the family of Arecaceae. it grows in the tropical areas, mainly in gulf guinea. It is an economically important cash crop, grown primarily for its oil, and has become one of the main crops in the world. To date, oil palm is the world’s highest-yielding oil-producing crop. Unfortunately, one of the major constraints faced by oil palm farmers is the devastating disease known as Ganoderma disease, caused by Ganoderma sp. The fungus was reported before on older palms, but now it has been detected on younger palms aged 1 - 2 years old <xref ref-type="bibr" rid="scirp.144493-1">
     [1]
    </xref>. Ganoderma disease not only causes reduction in total oil yield but also results in direct loss of stands due to palm death and economic losses.</p>
   <p>Despite the effectiveness of synthetic chemicals in plant disease management, their continuous utilization has resulted in the development of new streams of fungi with multiple resistances, which further complicates the management of plant diseases <xref ref-type="bibr" rid="scirp.144493-2">
     [2]
    </xref>. Furthermore, the use of these chemicals in plant protection is also being restricted because of thier residual toxicity, long degradation period, environmental contamination, chemical residues in food materials <xref ref-type="bibr" rid="scirp.144493-3">
     [3]
    </xref>.</p>
   <p>Therefore, there is an increasing concern and effort to develop a better plant disease management approach that is not only safe and ecological friendly but also economically feasible for farmers. The use of indigenous antagonistic microorganisms agents could provide better compliance with these guidelines. These indigenous microorganisms are successful colonizers of their habitats due to their efficient utilization of available substrates and production of antibiotics and enzymes <xref ref-type="bibr" rid="scirp.144493-4">
     [4]
    </xref>.</p>
   <p>The aim of this study is to select the antagonistic indigenous microorganisms isolates from rhizospheric soil and roots of oil palm and evaluate their potential biological control against Ganoderma sp. in vitro.</p>
  </sec><sec id="s2">
   <title>2. Materials and Methods</title>
   <sec id="s2_1">
    <title>2.1. Sampling and Isolation of Ganoderma sp.</title>
    <p>The fruiting body of Ganoderma sp. located at the base of the oil palm stem was collected using a sterile knife, then transported to the Plant Biology Laboratory of the University of Douala.</p>
    <p>These fruiting body samples were cleaned with the tap water using a brush, the external part was removed, and the internal structures were cut into cubes. Theses fragments surface were sreilised with 70% alcohol for 30 seconds, then rinsed twice with sterile distilled water. The samples pieces were inoculated into petri dishes (9 cm diameter) containing 15 ml of PDA medium <xref ref-type="bibr" rid="scirp.144493-5">
      [5]
     </xref>. Incubation was carried out in darkness at 27˚C. Data were recorded every daily over a 4-weeks period. Fungal samples were subjected to successive subcultures until pure mycelum was obtained.</p>
   </sec>
   <sec id="s2_2">
    <title>2.2. Sampling of Soil and Roots of Oil Palm</title>
    <p>Soil samples were collected from 4 different blocks (A3/06; B4/74; D4/74; G7/75) of socapalm Dibombari (Littoral-Cameroon) Plantation where the disease incidence is high. Within each block, 4 asymptomactic plants located near disease foci were selected. An 800 g soil samples was collected within 1 meter of the root system of each plant in the 4 cardinal directions. Before each sampling, the soil surface was cleaned of leaves and other organic debris. The soil samples were collected from the 30 - 40 cm soil layer <xref ref-type="bibr" rid="scirp.144493-6">
      [6]
     </xref>, carrefully mixed, and sent to the laboratory.</p>
    <p>Roots sampling was conducted in 4 differents blocks (Rao. 2018) of socapalm dibombari with high disease incidence. For each block, one asymptomatic oil palm located in the disease foci was selected. Roots were collected aseptically at a depth of 0.2 - 20 cm <xref ref-type="bibr" rid="scirp.144493-7">
      [7]
     </xref>. The roots were stored with rhizospheric soil in bags at 4˚C until use to prevent druying out and preserve the integrity of microoganisms associeted with the root.</p>
   </sec>
   <sec id="s2_3">
    <title>2.3. Isolation of Microorganisms from Soil and Roots</title>
    <p>The collected soil samples were crushed and sieved, the microorganisms were isolated according to the method of <xref ref-type="bibr" rid="scirp.144493-6">
      [6]
     </xref>, which consisted of taking 10 g of crushed sample and transferring it to 90 ml of sterile distilled water, then shaking for 30 minutes, which constituted a 10<sup>−</sup><sup>1</sup> dilutions. From that solution, other solutions were prepared by transferring 1 ml of solution into 9 ml of sterile distilled water up to 10<sup>−</sup><sup>8</sup> <xref ref-type="bibr" rid="scirp.144493-8">
      [8]
     </xref>. Only dilutions 10<sup>−</sup><sup>4</sup>, 10<sup>−</sup><sup>5</sup>, 10<sup>−</sup><sup>6</sup> and 10<sup>−</sup><sup>7</sup> were used for inoculation of the solid medium <xref ref-type="bibr" rid="scirp.144493-9">
      [9]
     </xref>.</p>
    <p>Inoculation consisted of taking 0.1 ml of each dilution using a pipette and depositing it into a petri dish containaing the culture medium; three replicates were performed for each dilution.</p>
    <p>Roots samples were washed with tap water, cut into 2 cm pieces, disinfected with 70% ethanol for 30 seconds, and rinsed three times with distilled water to remove any residual disinfectant. The pieces xere then cultured on PDA medium in petri dishes and incubated in the dark for 7 days for fungal growth <xref ref-type="bibr" rid="scirp.144493-6">
      [6]
     </xref> and 2 days for bacterial growth.</p>
   </sec>
   <sec id="s2_4">
    <title>2.4. Microorganisms Purification</title>
    <p>Bacteria that grew in the petri dishes were subcultured and purified several times by streaking on PCA medium. The method used was the quadrant technique <xref ref-type="bibr" rid="scirp.144493-10">
      [10]
     </xref>.</p>
    <p>Colonies showing fine filaments (hyphae) in the incubated petri dishes were identified as fungi and were isolated and subcultured using a sterilized platinum loop on the PDA medium. Incubation was performed at 28˚C for 4 to 6 days. This process was repeated until pure strains were obtained <xref ref-type="bibr" rid="scirp.144493-11">
      [11]
     </xref>.</p>
   </sec>
   <sec id="s2_5">
    <title>2.5. Screening of Isolated Microorganisms</title>
    <p>All isolated microorganisms underwent a direct confrontation test to assess their competiviness against the pathogen responsible for the disease <xref ref-type="bibr" rid="scirp.144493-12">
      [12]
     </xref>. This test identifies the most competitive microorganism showing potential for use in biological control.</p>
    <p>1) Fungi</p>
    <p>This technique consists of placing a Ganoderma sp. mycelium disk and an antagonistic disk to be tested in a diamtrically opposite position in the same 90 mm diameter petri dish containaing PDA medium. The two 6 mm mycelium disks of the same age (4 days old) were placed about 30 mm apart from each other relative to the center of petri disk <xref ref-type="bibr" rid="scirp.144493-12">
      [12]
     </xref>. The control consisted of placing a 6mm diameter of Ganoderma sp. (4 days old) alone at the center of the petri dish containaing PDA culture medium.</p>
    <p>Incubation was performed at 27˚C for 7 days with daily observations. After 3 days of incubation, the percentage of inhibition of diameter growth (PIDG) of the pathogen was assessed using the method of <xref ref-type="bibr" rid="scirp.144493-13">
      [13]
     </xref>. Three repititions were made per microorganisms.</p>
    <p>
     <xref ref-type="bibr" rid="scirp.144493-"></xref>PIDG (%) = (1 − C<sub>n</sub>/C<sub>o</sub>) × 100</p>
    <p>C<sub>o</sub> = control fungi diameter</p>
    <p>C<sub>n</sub> = fungal diameter confronted by the antagonistic microorganism</p>
    <p>2) Bacteria</p>
    <p>The direct confrontation assay was conducted in Petri dishes containing PDA medium. A 6 mm diameter mycelial disk of Ganoderma sp. (4 days old) was placed at the center of the petri dish surrounded by two streaks of bacterial (2 days old) culture spaced 2 cm apart. Three replicates were performed for each confrontation. The dishes were incubated at 27˚C in dackness for 7 days and observed daily. The control consisted of monoculture of Ganoderma sp. Inoculated at the center of the petri dish. The results were evaluated by measuring the distance of mycelial growth of Ganoderma sp. towards the bacterial antagonist, and the percentage of inhibition was calculated using the equation reported by <xref ref-type="bibr" rid="scirp.144493-14">
      [14]
     </xref>.</p>
    <p>(%) Inhibition = (1 − D<sub>n</sub>/D<sub>o</sub>) × 100</p>
    <p>D<sub>o</sub> = control fungi diameter</p>
    <p>D<sub>n</sub> = fungal diameter affected by the bacteria</p>
   </sec>
   <sec id="s2_6">
    <title>2.6. Characterization and Identification of Antagonistic Microorganisms</title>
    <p>1) Morphological description</p>
    <p>The macroscopic appearance of fungi was evaluated from cultures on PDA medium, and the following characteristics were examined:</p>
    <p>2) Microscopic description</p>
    <p>
     <xref ref-type="bibr" rid="scirp.144493-"></xref>The method consisted of cutting a small piece of scoth tape and applying it with its adhesive side to the colony using tweeters, then placing it on a clean slide. Observations were made at 40× magnification, and the following critteria observe:</p>
    <p>1) Macroscopic observations of colonies</p>
    <p>The initial step in bacterial strain identification is the macroscopic examination of islated colonies. The main characteristic evaluated are: shape, color, elevation, contour, size, surface, and opacity <xref ref-type="bibr" rid="scirp.144493-15">
      [15]
     </xref>.</p>
    <p>2) Microscopic description</p>
    <p>a) Biochemical characterization</p>
    <p>i) Catalase test</p>
    <p>It involves the search for catalase, an important enzyme for the elimination of hydrogen peroxide according to the following rection:</p>
    <p>In bacteriology, the catalase test is used to identify and chacterize bacteria, particlarity Gram-poisitive bacteria. The test consisted of transferring a bacterial colony from a solid agar plate to a sterile slide, followed by the addition of a drop of hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>). The presence of catalase is demonstrated by the immediate evolution of gas bubbles <xref ref-type="bibr" rid="scirp.144493-16">
      [16]
     </xref>.</p>
    <p>ii) Oxydase test</p>
    <p>The oxydase test is a diagnostic tool used to detect the presence of oxydase enzyme in bacteria <xref ref-type="bibr" rid="scirp.144493-17">
      [17]
     </xref>. This test is crucial for identifying Gram-negative bacteria, as it helps to differentiate oxidase-positive bacteria, such as Pseudomonas species, and oxidase-negative bacteria <xref ref-type="bibr" rid="scirp.144493-18">
      [18]
     </xref>.</p>
    <p>The oxydase test involves adding a reagent typically tetramethyl-P-Phenylenediamine, to a bacterial colony <xref ref-type="bibr" rid="scirp.144493-18">
      [18]
     </xref>. If the bacteria possess the oxydase enzyme, the reagent will be oxydized and change color. The oxydase test results are interpreted as follow:</p>
    <p>Positive result: bacterium is oxydase positive, indicating the presence of the oxydase enzyme, and the reagent changes color.</p>
    <p>Negative result: the bacterium is oxidase-negative indicating the absence of oxydase enzyme, and the reagent does not change the color.</p>
    <p>Genomic DNA was extracted from the samples received using the Quick-DNA<sup>TM</sup> Fungal/Bacterial kit (Zymo Research, Catalogue No. D6005). The ITS target region was amplified using OneTaq<sup>®</sup> Quick-Load<sup>®</sup> 2X Master Mix (NEB, Catalogue No. M0486) with the primers presented in <xref ref-type="table" rid="table1">
      Table 1
     </xref> for fungi and <xref ref-type="table" rid="table2">
      Table 2
     </xref> for bacteria. The PCR products were run on a gel and cleaned up enzymatically using the EXOSAP method. The extracted fragments were sequenced in the forward and reverse direction (Nimagen, BrilliantDye<sup>TM</sup> Terminator Cycle Sequencing Kit V3.1, BRD3-100/1000) and purified (Zymo Research, ZR-96 DNA Sequencing Clean-up Kit<sup>TM</sup>, Catalogue No. D4050). The purified fragments were analyzed on the ABI 3500xl Genetic Analyzer (Applied Biosystems, ThermoFisher Scientific) for each reaction for every sample, as listed in Section 1. DNASTAR was used Genomic DNA was extracted from the samples received using the Quick-DNA<sup>TM</sup> Fungal/Bacterial kit (Zymo Research, Catalogue No. D6005). The ITS target region was amplified using OneTaq<sup>®</sup> Quick-to analyse the ab1 files generated by the ABI 3500XL Genetic Analyzer and results were obtained by a BLAST search (NCBI).</p>
    <table-wrap id="table1">
     <label>
      <xref ref-type="table" rid="table1">
       Table 1
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.144493-"></xref>Table 1. ITS Primers sequences.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="40.44%"><p style="text-align:center">Name of primer</p></td> 
       <td class="custom-bottom-td acenter" width="36.64%"><p style="text-align:center">Target</p></td> 
       <td class="custom-bottom-td acenter" width="62.98%"><p style="text-align:center">Sequence 5’ to 3’</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td acenter" width="40.44%"><p style="text-align:center">ITS-1</p></td> 
       <td class="custom-top-td acenter" width="36.64%"><p style="text-align:center">rDNA sequences</p></td> 
       <td class="custom-top-td acenter" width="62.98%"><p style="text-align:center">TCCGTAGGTGAACCTGCG</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="40.44%"><p style="text-align:center">ITS-4</p></td> 
       <td class="acenter" width="36.64%"><p style="text-align:center">rDNAsquences</p></td> 
       <td class="acenter" width="62.98%"><p style="text-align:center">TCCTCCGCTTATTGATATGC</p></td> 
      </tr> 
     </table>
    </table-wrap>
    <table-wrap id="table2">
     <label>
      <xref ref-type="table" rid="table2">
       Table 2
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.144493-"></xref>Table 2. ITS Primers sequences.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="33.98%"><p style="text-align:center">Name of primer</p></td> 
       <td class="custom-bottom-td acenter" width="38.79%"><p style="text-align:center">Target</p></td> 
       <td class="custom-bottom-td acenter" width="67.30%"><p style="text-align:center">Sequence 5’ to 3’</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td acenter" width="33.98%"><p style="text-align:center">ITS 16S-27F</p></td> 
       <td class="custom-top-td acenter" width="38.79%"><p style="text-align:center">16S rDNA sequence</p></td> 
       <td class="custom-top-td acenter" width="67.30%"><p style="text-align:center">AGAGTTTGATCMTGGCTCAG</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="33.98%"><p style="text-align:center">ITS 16S-1492R</p></td> 
       <td class="acenter" width="38.79%"><p style="text-align:center">16S rDNA sequence</p></td> 
       <td class="acenter" width="67.30%"><p style="text-align:center">CGGTTACCTTGTTACGACTT</p></td> 
      </tr> 
     </table>
    </table-wrap>
   </sec>
   <sec id="s2_7">
    <title>2.7. Statical Analysis</title>
    <p>Data analysis was performed using SAS (Statistical Analysis System) software for statistical analyses. The result of qualitative and quantitative variables were expressed as percentages and illustrated using bar/ graphs generated with microsoft Excel. For the isolated microorganisms, analysis of variance (ANOVA) was conducted. To compare average values of groups student’s t-test, Newman and Keuls tests were performed at a significance level of 5%.</p>
   </sec>
  </sec><sec id="s3">
   <title>3. Results</title>
   <sec id="s3_1">
    <title>3.1. Sampling, Isolation and Purification of Ganoderma sp.</title>
    <p>The fruiting body of Ganoderma sp. located at the base of the oil palm tree stem (<xref ref-type="fig" rid="fig1">
      Figure 1
     </xref>) has a semi-circular shape, with a shiny color ranging from orange to reddish-brown coloration, and its fresh is colored and woody (<xref ref-type="fig" rid="fig2">
      Figure 2
     </xref>).</p>
    <p>A 14-day-old purified mycelium of Ganoderma sp. exhibits a development of dense, white, cottony filaments with a thin texture. The aerial filaments are abundant and slightly orange at the edge (<xref ref-type="fig" rid="fig3">
      Figure 3
     </xref>). This mycelium has a moderate average growth. After 6 days, the filament reaches the edge of the 9 cm diameter pedri dish.</p>
    <fig id="fig1" position="float">
     <label>Figure 1</label>
     <caption>
      <title>Figure 1. Fruiting body located at the base.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId13.jpeg?20250731095839" />
    </fig>
    <fig id="fig2" position="float">
     <label>Figure 2</label>
     <caption>
      <title>Figure 2. Fruiting body havested.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId14.jpeg?20250731095840" />
    </fig>
    <fig id="fig3" position="float">
     <label>Figure 3</label>
     <caption>
      <title>Figure 3. Ganoderma sp. mycelium.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId15.jpeg?20250731095840" />
    </fig>
    <p>Microscopic examination reveals that the hyphae of isolated Ganoderma sp. are branched, forming a dense and complex network with secondary and tertiary branches. The hyphae are septate and narrow, measuring 5 - 15 µm in width, and display clamp connections (<xref ref-type="fig" rid="fig4">
      Figure 4
     </xref>).</p>
    <p>Spoores are spherical</p>
    <fig id="fig4" position="float">
     <label>Figure 4</label>
     <caption>
      <title>Figure 4. Ganoderma sp hypha.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId16.jpeg?20250731095840" />
    </fig>
   </sec>
   <sec id="s3_2">
    <title>3.2. Isolation and Purification of Microorganisms</title>
    <p>The search for microorganisms from the rhizospheric soil of the palm grove and oil palm roots resulted in the isolation of 2 types of microorganisms: 14 fungal isolates (CR<sub>1</sub>, CR<sub>2</sub>, CR<sub>3</sub>, CR<sub>4</sub>, CR<sub>5</sub>, CR<sub>6</sub>, CR<sub>8</sub>, CS<sub>1</sub>, CS<sub>2</sub>CS<sub>4</sub>, CR<sub>10</sub>, CR<sub>9</sub>, CS<sub>11</sub>, CS<sub>12</sub>) and 16 bacterial isolates (IBS<sub>1</sub>, IBS<sub>2</sub>, IBS<sub>3</sub>, IBS<sub>4</sub>, IBS<sub>5</sub>, IBS<sub>6</sub>, IBS<sub>7</sub>, IBS<sub>8</sub>, IBS<sub>9</sub>, IBS<sub>10</sub>, IBS<sub>11</sub>, IBS<sub>12</sub>, IBR1, IBR2, IBS13, IBR4). CR refers to root-associted fungi, CS to soil-associeted fungi, IBS to soil-associeted bacteria and IBR to root-associeted bacteria. Fungi dominate root isolates for 64% compared to 36% for bacteria. However, these proportions are reversed in soil where bacteria account 75% and fungi 25% (<xref ref-type="fig" rid="fig5">
      Figure 5
     </xref>).</p>
    <fig id="fig5" position="float">
     <label>Figure 5</label>
     <caption>
      <title>Figure 5. Diversity and distribution of microorganisms in the oil palm ecosystem.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId17.jpeg?20250731095840" />
    </fig>
    <p>1) Direct confrontation</p>
    <p>The various microorganisms isolated were screened for their antififungal activity. Two microorganisms gave a PIRG value more than 50%. The fungus (CS<sub>1</sub>) and the bacterium (IBS<sub>6</sub>) showed significant antifungal activity, inhibiting pathogen growth by 66% and 72%, respectively (<xref ref-type="fig" rid="fig6">
      Figure 6
     </xref>, <xref ref-type="fig" rid="fig7">
      Figure 7
     </xref>). On control plates, colony of Ganoderma sp. covered the 9 cm diameter of petri dish in 6 days.</p>
    <p>In direct dual culture with fungus (CS<sub>1</sub>), Ganoderma sp. exhibits growth similar to the negative control during the first 3 days. However, starting from the 3<sup>rd</sup> day, its growth slows down, reaching a maximum diameter of 40 mm on the 4th, followed by a reduction to 30 mm (<xref ref-type="fig" rid="fig8">
      Figure 8
     </xref>). The hyphae of the phyopathogen swelled up, and the spores of the antagonistic fungus (CS1) were observed on it, followed by its rupture (<xref ref-type="fig" rid="fig9">
      Figure 9
     </xref>).</p>
    <p>In direct confrontation with the IBS6 bacterium, Ganoderma sp. growth is slow from the early days compared to the control. It reaches its maximum on the 5th day with a radial growth diameter of 25 mm and then stabilizes. No physical contact was oberved between the bacterium IBS6 and the pathogen Ganoderma sp. (<xref ref-type="fig" rid="fig10">
      Figure 10
     </xref>).</p>
    <fig id="fig6" position="float">
     <label>Figure 6</label>
     <caption>
      <title>Figure 6. Percentage of inhibition of Ganoderma sp. induced by isolated fungi.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId18.jpeg?20250731095841" />
    </fig>
    <fig id="fig7" position="float">
     <label>Figure 7</label>
     <caption>
      <title>Figure 7. Percentage of inhibition of Ganoderma sp. induced by isolated bacteria.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId19.jpeg?20250731095841" />
    </fig>
    <fig id="fig8" position="float">
     <label>Figure 8</label>
     <caption>
      <title>Figure 8. Effect of CS1 and IBS6 on the radical growth of Ganoderma sp.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId20.jpeg?20250731095841" />
    </fig>
    <fig id="fig9" position="float">
     <label>Figure 9</label>
     <caption>
      <title>Figure 9. Interaction between Ganoderma sp. and CS<sub>1</sub>.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId21.jpeg?20250731095841" />
    </fig>
    <fig id="fig10" position="float">
     <label>Figure 10</label>
     <caption>
      <title>Figure 10. Interaction between IBS<sub>6</sub> and Ganoderma sp.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId22.jpeg?20250731095841" />
    </fig>
   </sec>
   <sec id="s3_3">
    <title>3.3. Microorganisms Identification</title>
    <p>1) Macroscopic description</p>
    <p>The macroscopic characterization of the fungus (CS1) was conducted on 7-day-old cultures. This fungus has aerial hyphae forming a dense network. The colonies are initially whitish and then turn green after sporulation, which starts on the 4th day with the first concentric circle. The texture is cottony, and the mycelium is composed of branched filaments. Fungus (CS1) shows fast growth in culture medium and the development of conidia with green-yellow color (<xref ref-type="fig" rid="fig11">
      Figure 11
     </xref>).</p>
    <fig id="fig11" position="float">
     <label>Figure 11</label>
     <caption>
      <title>Figure 11. Fungus (CS<sub>1</sub>).</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId23.jpeg?20250731095842" />
    </fig>
    <p>
     <xref ref-type="bibr" rid="scirp.144493-"></xref></p>
    <p>2) Microscopic description</p>
    <p>Under the microscope, the fungus (CS1) has phialides, specialized cells that produce bottle-shaped conidia. The conidia are green and spherical, characteristic of asexual spores borne on branched conidiophores (<xref ref-type="fig" rid="fig12">
      Figure 12
     </xref>).</p>
    <fig id="fig12" position="float">
     <label>Figure 12</label>
     <caption>
      <title>Figure 12. Microscopic structure.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId24.jpeg?20250731095842" />
    </fig>
    <p>1) Macroscopic characteristics</p>
    <p>After inoculation on PCA medium and incubation for 48 hours at 27˚C, the macroscopic characteristic of IBS6 Bacterium are summarized in table below (<xref ref-type="fig" rid="fig13">
      Figure 13
     </xref>).</p>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td class="custom-bottom-td acenter" width="13.53%"><p style="text-align:center">Code</p></td> 
      <td class="custom-bottom-td acenter" width="13.53%"><p style="text-align:center">shape</p></td> 
      <td class="custom-bottom-td acenter" width="13.53%"><p style="text-align:center">Color</p></td> 
      <td class="custom-bottom-td acenter" width="13.53%"><p style="text-align:center">Elevation</p></td> 
      <td class="custom-bottom-td acenter" width="13.54%"><p style="text-align:center">size</p></td> 
      <td class="custom-bottom-td acenter" width="13.54%"><p style="text-align:center">Surface</p></td> 
      <td class="custom-bottom-td acenter" width="13.54%"><p style="text-align:center">opacity</p></td> 
      <td class="custom-bottom-td acenter" width="13.54%"><p style="text-align:center">edge</p></td> 
     </tr> 
     <tr> 
      <td class="custom-top-td acenter" width="13.53%"><p style="text-align:center">IBS6</p></td> 
      <td class="custom-top-td acenter" width="13.53%"><p style="text-align:center">Irregular</p></td> 
      <td class="custom-top-td acenter" width="13.53%"><p style="text-align:center">yellow</p></td> 
      <td class="custom-top-td acenter" width="13.53%"><p style="text-align:center">bomb</p></td> 
      <td class="custom-top-td acenter" width="13.54%"><p style="text-align:center">punctiform</p></td> 
      <td class="custom-top-td acenter" width="13.54%"><p style="text-align:center">smoth</p></td> 
      <td class="custom-top-td acenter" width="13.54%"><p style="text-align:center">translucent</p></td> 
      <td class="custom-top-td acenter" width="13.54%"><p style="text-align:center">serrated</p></td> 
     </tr> 
    </table>
    <fig id="fig13" position="float">
     <label>Figure 13</label>
     <caption>
      <title>Figure 13. Bacterium (IBS<sub>6</sub>).</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2606145-rId25.jpeg?20250731095842" />
    </fig>
    <p>2) Microscopic characteristics</p>
    <p>Gram staining performed on colonies of bacterium (IBS6) reveals that this bacterium is Gram-positive and appears as violet rods.</p>
    <p>a) Biochemical test</p>
    <p>The biochemical test revealed that bacterium IBS<sub>6</sub> is catalase-positive and oxydase -negative.</p>
    <p>The BLAST results correspond to the similarity between the queried sequences and biologiacal sequence in the NCBI databse. Two significant matches were obtained: for code IBS6, a similatity of 99.79% was observed with Bacillus subtilis (GenBank accesssion MT571500.1) and CS1, a perfect match of 100% identity was found with Trichoderma vierens Genank (accessionMN102106.1).</p>
   </sec>
  </sec><sec id="s4">
   <title>4. Discussion</title>
   <sec id="s4_1">
    <title>4.1. Sampling and Isolation of Ganoderma sp.</title>
    <p>This study aimed firstly to highlight the microbial biodiversity within the palm grove ecosystem. The results showed a significant qualitative and quantitative diversity in the two studied components, soil and root endophytes. The isolation of potential biological control agents of phytopathogens requires sampling from the rhizosphere of plants to be protected that are growing in soil infested with the target pathogens <xref ref-type="bibr" rid="scirp.144493-19">
      [19]
     </xref>. Furthermore, it is important to select roots of vigorous and healthy plants located in the area where the disease is present, in order to identify microorganisms that have developed effective defense strategies against phytopathogens.</p>
    <p>Isolation from healthy oil palm roots revealed a predominance of fungi (64%) compared to bacteria (36%). These results are similar to those that obtained by <xref ref-type="bibr" rid="scirp.144493-20">
      [20]
     </xref> who reported a proportion of 66.31% of fungi against 33.04% of bacteria during their search for indigenous microorganisms of caccao antagonistic to Phytophthora palmivora.</p>
   </sec>
   <sec id="s4_2">
    <title>4.2. Isolation and Purification of Microorganisms</title>
    <p>In the soil, a high proliferation of the two cathegories was observed, with bacteria being the dominant group (75%). <xref ref-type="bibr" rid="scirp.144493-21">
      [21]
     </xref> reported that bacteria are numerically abundant organisms in the soil, especially in rhizosphere. It is the preferential site for indigenous microorganisms with potential antagonistic activity against Ganoderma sp. because they occupy the same ecologique niche <xref ref-type="bibr" rid="scirp.144493-20">
      [20]
     </xref> <xref ref-type="bibr" rid="scirp.144493-21">
      [21]
     </xref>.</p>
    <p>Secondly this study aimed to identify indigenous microoganisms with antagponistic activity against Ganoderma sp. To achieve this study, in vitro screening was conducted on microbial isolates to select those showing promising efficacy agaisnt this pathogen.</p>
    <p>Mycelium isolated from the carpophore of Ganoderma sp. exhibited morphological characteristics consistent with those reported for Ganoderma sp. by <xref ref-type="bibr" rid="scirp.144493-22">
      [22]
     </xref> and <xref ref-type="bibr" rid="scirp.144493-23">
      [23]
     </xref>.</p>
   </sec>
   <sec id="s4_3">
    <title>4.3. Microorganisms Identification</title>
    <p>The result of the in vitro dual culture test showed that the bacterium Bacillus subtilis (IBS<sub>6</sub>) and the fungus (CS<sub>1</sub>) were able to inhibit the radial growth of Ganoderma sp. with PIRG value of 72% and 66% respectively. The selection of the two microorganisms as biological agents depends largely on their effectiveness in vitro result against Ganoderma sp. Some studies have also revealed that Ganoderma sp. has been inhibited to some extent by some biocontol agents, namely Actinomycetes, arbuscular mycorrhizal fungi, Bacillus spp., Diaporthe spp, mycoparasite, Penicillium, Streptomycetes spp., and Trichoderma spp. <xref ref-type="bibr" rid="scirp.144493-24">
      [24]
     </xref>; <xref ref-type="bibr" rid="scirp.144493-12">
      [12]
     </xref> tested 3 different species of Trichoderma namely T. asparellum, T. virens, T. harzianum reporting that all the Trichoderma spp. tested significantly inhibited the growth of Ganoderma sp. with PIRG of more than 70% for all the species tested. The inhibition of Ganoderma sp. observed in direct confrontations suggests that the significant growth of antagonistic agents allow them to develop more rapidly, colonize the culture medium, and mobilize nutriments to their advantage <xref ref-type="bibr" rid="scirp.144493-25">
      [25]
     </xref>. This effect could be most likely due to the production of antibiotic, secondary metabolite compounds, or lytic enzymes which could contribute to the direct antagonistic effect degrading Ganoderma sp. cell wall and mycoparasitic activities <xref ref-type="bibr" rid="scirp.144493-12">
      [12]
     </xref> <xref ref-type="bibr" rid="scirp.144493-24">
      [24]
     </xref>. Moreover, antagonism could be also be caused by production of volatile and non volatile antibiotic acting synergistically with enzymes to contreract the pathogen. The main lytic enzymes produced by the biological control agents are chitinase, glucanase, cellulase and protease. The production of these cell wall degrading enzymes could be responsible for the inhibition of Ganoderma sp. in vitro. During direct confrontation between the Trichoderma virens (CS<sub>1</sub>) and Ganoderma sp. significant differences were observed in antagonistic activity. The radical growth diameter of Ganoderma sp. control and the confronted were similar until 3rd day, suggesting a delayed antagonistic activity. However after the 3rd day, a significant difference between Control and the treatment diameters was noticed. By the 4th day, Ganodema sp. growth (40 mm) stopped, likely due to space occupation or nutrient depletion. On the 5th day, the diameter of Ganoderma sp. reduced to 30 mm, which could correspond to the destruction of a portion of Ganoderma mycelium by the antagonistic agent (<xref ref-type="fig" rid="fig10">
      Figure 10
     </xref>).</p>
    <p>For the treatment by Bacillus subtilis (IBS<sub>6</sub>) the Ganoderma sp. growth was slowed from the first day compared to the contol, indicating early antagonistic activity. <xref ref-type="bibr" rid="scirp.144493-26">
      [26]
     </xref> reported that antibiotic production by Bacillus subtilis is a process that begins early in the growth of the bacterium, but it is during the stationary phase or in aged cultures that the bacterium releases the largest amount of antibiotic into the culture medium, maximizing its antimicrobial potential. The early antagonistic activity of the bacterium IBS<sub>6</sub> could be attributed to its rapid growth, allowing it to effectively colonize the environment and exert its inhibitory effect <xref ref-type="bibr" rid="scirp.144493-27">
      [27]
     </xref>. The diameter reached its peak on the 5th day and remainded stable until 7th (<xref ref-type="fig" rid="fig10">
      Figure 10
     </xref>). The lack of physical contact between IBS<sub>6</sub> and Ganoderma sp. suggest a potential inhibitory action at a distance, likely due to the production of antibiotics and other secondary metabolites.</p>
   </sec>
  </sec><sec id="s5">
   <title>5. Conclusion</title>
   <p>This study demonstrates that it is possible to isolate indigenous microorganisms from the oil palm ecosystem. Among isolates, a fungus (CS1) and a bacterium (IBS<sub>6</sub>) showed significant antagonistic effects against Ganoderma sp. in laboratory conditions. Molecular identification of selected microorganisms revealed that the fungus (CS<sub>1</sub>) is affiliated with Trichoderma virens and the bacterium IBS<sub>6</sub> with Bacillus subtilis. This in vitro efficacy can serve as research leads for developing biological control against basal stem rot in oil palms. However, the potential of this approach can only be realized if its efficacy is confirmed through in vivo testing and subsequently validated under real-world conditions in oil palms plantations.</p>
  </sec>
 </body><back>
  <ref-list>
   <title>References</title>
   <ref id="scirp.144493-ref1">
    <label>1</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Naher, L., Yusuf, U.M.I.K., Ismail, A. and Hossain, K. (2014) Trichoderma spp.: A Biocontrol Agent for Sustainable Management for Plant Diseases. Journal of Eco-nomics and Sustainable Development, 46, 1489-1493.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref2">
    <label>2</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Boubaker, H., Saadi, B., Boudyach, E.H. and Benaoumar, A.A. (2009) Sensitivity of Penicillium digitatum and P. italicum to Imazalil and Thiabendazole in Morocco. Plant Pathology Journal, 8, 152-158. &gt;https://doi.org/10.3923/ppj.2009.152.158
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref3">
    <label>3</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Palou, L., Smilanick, J.L. and Droby, S. (2008) Alternatives to Conventional Fungicides for the Control of Citrus Postharvest Green and Blue Moulds. Stewart Postharvest Review, 2, 1-16.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref4">
    <label>4</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Schmoll, M., Seibel, C., Tisch, D., Dorrer, M. and Kubicek, C.P. (2010) A Novel Class of Peptide Pheromone Precursors in Ascomycetous Fungi. Molecular Microbiology, 77, 1483-1501. &gt;https://doi.org/10.1111/j.1365-2958.2010.07295.x
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref5">
    <label>5</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lecoeur, E.M. (2013) Echantillonnage et caractérisation moléculaire de la biodiversité fongique des champignons du Ganoderma associés aux phénomènes de dépérissement des palmiers à huile au cameroun: UM2, Mémoire de master 2: Biologie, Géosciences, Agroressources et Environnement. Spécialité Biologie et Evolution des plantes. Master’s Thesis, Université Monpellier. 
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref6">
    <label>6</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Davet, P. and Rouxel, F. (1997) Détection et isolement des champignons du sol. Institut National de Recherche Agronomique, Editions Quae, 197.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref7">
    <label>7</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Amkraz, N., Boudyack, H., Bouker, A. and Aoumar, A.B. (2006) Sélection des Pseudomonas fluorescents antagonistes de Clavibacter michiganensis subsp.michiganensis agent causal du chancre bactérien de la tomate. Congrès International de Biochimie, Agadir, 9-12 Mai 2006, 351.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref8">
    <label>8</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Botton, B., Breton, A., Fevre, M., Gauthier, S., Guy P.H., Larpen, J.P., Reymond, P., Sanglier, J.J., Vayssier, Y. and Veau, P. (1990) Moisissures utiles et nuisibles: Importance industrielle. 2ème Édition, Masson, 34-428.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref9">
    <label>9</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Waksman, S.A. and Reilly, H.C. (1945) Agar-Streak Method for Assaying Antibiotic Substances. Industrial&amp;Engineering Chemistry Analytical Edition, 17, 556-558. &gt;https://doi.org/10.1021/i560145a007
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref10">
    <label>10</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rullier, J. and Parodi, A. (1968) Identification par isolement et culture. Laboratoire et diagnosticen médecine vétérinaire, 712.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref11">
    <label>11</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Guiraud, J.P. (2003) Microbiologie Alimentaires. Dunod, 651.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref12">
    <label>12</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Musa, H., Hassan, M.A., Isyaku, M.S., Halidu, J. and Suleiman, A.S. (2018) Antagonistic Potential of Trichoderma Species against Ganoderma Disease of Oil Palm. Nigerian Journal of Agriculture, Food and Environment, 13, 60-67.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref13">
    <label>13</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Hmouni, A., Hajlaoui, M.R. and Mlaiki, A. (1996) Résistance de Botrytis cinerea aux benzimidazoles et aux dicarboximides dans les cultures abritées de tomate en Tunisie. EPPO Bulletin, 26, 697-705. &gt;https://doi.org/10.1111/j.1365-2338.1996.tb01513.x
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref14">
    <label>14</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ajijah, N., Fiodor, A., Dziurzynski, M., Stasiuk, R., Pawlowska, J., Dziewit, L., et al. (2023) Biocontrol Potential of Pseudomonas protegens ML15 against Botrytis cinerea Causing Gray Mold on Postharvest Tomato (Solanum lycopersicum var. Cerasiforme). Frontiers in Plant Science, 14, Article 1288408. &gt;https://doi.org/10.3389/fpls.2023.1288408
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref15">
    <label>15</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Thomas, W.E., Trintchina, E., Forero, M., Vogel, V. and Sokurenko, E.V. (2002) Bacterial Adhesion to Target Cells Enhanced by Shear Force. Cell, 109, 913-923. &gt;https://doi.org/10.1016/s0092-8674(02)00796-1
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref16">
    <label>16</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Graham, P.H. (1964) Studies on the Utilisation of Carbohydrates and Krebs Cycle Intermediates by Rhizobia, Using an Agar Plate Method. Antonie van Leeuwenhoek, 30, 68-72. &gt;https://doi.org/10.1007/bf02046703
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref17">
    <label>17</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     KOVACS, N. (1956) Identification of Pseudomonas pyocyanea by the Oxidase Reaction. Nature, 178, 703-703. &gt;https://doi.org/10.1038/178703a0
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref18">
    <label>18</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Steel, K.J. (1961) The Oxidase Reaction as a Taxonomic Tool. Journal of General Microbiology, 25, 297-306. &gt;https://doi.org/10.1099/00221287-25-2-297
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref19">
    <label>19</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zaim, S., Belabid, L., Bayaa, B. and Bekkar, A.A. (2016) Biological Control of Chickpea Fusarium Wilts Using Rhizobacteria “PGPR”. In: Choudhary, D.K. and Varma, A., Eds., Microbial-Mediated Induced Systemic Resistance in Plants, Springer, 147-162. &gt;https://doi.org/10.1007/978-981-10-0388-2_10
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref20">
    <label>20</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Kebe, I., Mpika, J., N’guessa, K., Hebbar, P., Samuels, G. and Ake, S. (2009) Isolement et identification de microorganismes indigènes de cacaoyères en côte d’ivoire et mise en évidence de leurs effets antagonistes vis-àvis de Phytophthora palmivora, agent de la pourriture brune des cabosses. Sciences&amp;Nature, 6, 71-82. &gt;https://doi.org/10.4314/scinat.v6i1.48581
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref21">
    <label>21</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ngueuleu, D.A., Muyang, R.F., Wamba, F.O., Ngotta, B.B., Tefouet, V.D., Nyemene, K.P.J., et al. (2021) Evaluation of Soils Fertility, Growth, Nutrient Uptake and Yield Traits of Peanut under Indigenous and Effective Microorganism Fertilizers in Sandy Ferralitic Soils in Douala, Cameroon. African Journal of Agricultural Research, 17, 432-441. &gt;https://doi.org/10.5897/ajar2020.15075
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref22">
    <label>22</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zaremski, A., De Franqueville, A. and Breton, F. (2011) Caractérisation moléculaire de la biodiversité fongique et identification précoce des champignons associés au phénomène de déperissement des palmiers à huile en particulier Ganoderma boninense. Rapport du projet GANODIV, 24.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref23">
    <label>23</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Diabaté, S., Alliou, D., Claude, G., Kablan, K.A. and Wossio Kei, E. (2022) Mise au point de méthodes de lutte contre la pourriture basale du stipe du palmier à huile due au Ganoderma sp. Quatrième rapport d’étape d’avril à octobre 2022. CNRA EPPO Bulletin, 26, 697-705.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref24">
    <label>24</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Sujarit, K., Mori, M., Dobashi, K., Shiomi, K., Pathom-aree, W. and Lumyong, S. (2020) New Antimicrobial Phenyl Alkenoic Acids Isolated from an Oil Palm Rhizosphere-Associated Actinomycete, Streptomyces palmae CMU-AB204T. Microorganisms, 8, Article 350. &gt;https://doi.org/10.3390/microorganisms8030350
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref25">
    <label>25</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Alabouvette, C., Couteaudier, Y. and Louvet, J. (1983) Importance des phénomènes de compétition nutritive dans l’antagonisme entre microoganismes. Agronomie, 3, 727-733.
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref26">
    <label>26</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Sharga, B.M. and Lyon, G.D. (1998) Bacillus subtilis BS 107 as an Antagonist of Potato Blackleg and Soft Rot Bacteria. Canadian Journal of Microbiology, 44, 777-783. &gt;https://doi.org/10.1139/w98-064
    </mixed-citation>
   </ref>
   <ref id="scirp.144493-ref27">
    <label>27</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Koch, A.L. (2001) Bacterial Growth and Form. 2nd Edition, Springer, 21. &gt;https://doi.org/10.1007/978-94-017-0827-2
    </mixed-citation>
   </ref>
  </ref-list>
 </back>
</article>