<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article">
 <front>
  <journal-meta>
   <journal-id journal-id-type="publisher-id">
    aim
   </journal-id>
   <journal-title-group>
    <journal-title>
     Advances in Microbiology
    </journal-title>
   </journal-title-group>
   <issn pub-type="epub">
    2165-3402
   </issn>
   <issn publication-format="print">
    2165-3410
   </issn>
   <publisher>
    <publisher-name>
     Scientific Research Publishing
    </publisher-name>
   </publisher>
  </journal-meta>
  <article-meta>
   <article-id pub-id-type="doi">
    10.4236/aim.2025.156026
   </article-id>
   <article-id pub-id-type="publisher-id">
    aim-143597
   </article-id>
   <article-categories>
    <subj-group subj-group-type="heading">
     <subject>
      Articles
     </subject>
    </subj-group>
    <subj-group subj-group-type="Discipline-v2">
     <subject>
      Biomedical 
     </subject>
     <subject>
       Life Sciences
     </subject>
    </subj-group>
   </article-categories>
   <title-group>
    Epidemiology and Molecular Characterization of Staphylococcus aureus Enterotoxins A and B Isolated from Clarias gariepinus from Wild and Pond in the FCT Abuja, Nigeria
   </title-group>
   <contrib-group>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Enid
      </surname>
      <given-names>
       Godwin
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Chinwe Elizabeth
      </surname>
      <given-names>
       Okoli
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Simon Ikechukwu
      </surname>
      <given-names>
       Enem
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Gabriel Kehinde
      </surname>
      <given-names>
       Omeiza
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Bridget Maria Jessica
      </surname>
      <given-names>
       Adah
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Martha Echioda
      </surname>
      <given-names>
       Ogbole
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
   </contrib-group> 
   <aff id="aff1">
    <addr-line>
     aDepartment of Veterinary Public Health and Preventive Medicine, University of Abuja, Abuja, Nigeria
    </addr-line> 
   </aff> 
   <aff id="aff2">
    <addr-line>
     aDepartment of Veterinary Microbiology, Faculty of Veterinary Medicine, University of Abuja, Abuja, Nigeria
    </addr-line> 
   </aff> 
   <pub-date pub-type="epub">
    <day>
     23
    </day> 
    <month>
     06
    </month>
    <year>
     2025
    </year>
   </pub-date> 
   <volume>
    15
   </volume> 
   <issue>
    06
   </issue>
   <fpage>
    386
   </fpage>
   <lpage>
    397
   </lpage>
   <history>
    <date date-type="received">
     <day>
      13,
     </day>
     <month>
      March
     </month>
     <year>
      2025
     </year>
    </date>
    <date date-type="published">
     <day>
      24,
     </day>
     <month>
      March
     </month>
     <year>
      2025
     </year> 
    </date> 
    <date date-type="accepted">
     <day>
      24,
     </day>
     <month>
      June
     </month>
     <year>
      2025
     </year> 
    </date>
   </history>
   <permissions>
    <copyright-statement>
     © Copyright 2014 by authors and Scientific Research Publishing Inc. 
    </copyright-statement>
    <copyright-year>
     2014
    </copyright-year>
    <license>
     <license-p>
      This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/
     </license-p>
    </license>
   </permissions>
   <abstract>
    Staphylococcus aureus is an important foodborne pathogen associated with food poisoning and other multiple infections in human being. Its presence in fish is of public health concern. Clarias gariepinus organs collected from the pond/wild include serious issue due to the fact that they were collected from organs from the pond/wild organs namely intestine, Staphylococcus aureus is not a normal flora of fish. The risk of zoonotic transmission to humans highlights the need to evaluate Staphylococcus aureus enterotoxin A and B from African catfish (Clarias gariepinus) in Federal Capital Territory, Abuja. Four hundred samples of Clarias gariepinus organs were collected with two hundred (200) samples each from the ponds/wild and 66 samples from both Gwagwalada and Abuja Municipal Area council and 68 from Bwari respectively and examined for the presences of Staphylococcus aureus from the intestines, gills and skin using standard procedures on Baird Parker (BPA) agar plates supplemented with egg yolk emulsion and tellurite solution. Isolates were further identified using conventional biochemical tests: Gram’s staining, catalase, production of coagulase, Dnase, Oxidase test, hemolytic zone on 5% sheep blood agar and fermentation of mannose, mannitol, xlylose, maltose, trehalose, lactose, fructose, sucrose and glucose. Isolates were further characterized using Microgen TM STAPH-12S KIT. Antimicrobial sensitivity test was carried out by disc diffusion method on Mueller Hinton agar and was interpreted in line with the Clinical and Laboratory Standard Institute. An overall isolation rate of from the ponds was 5.0% while from the wild was 6.0% recorded for Staphylococcus aureus. Antibiogram of Staphylococcus aureus isolates revealed high sensitivity to some of the antibiotics, doxycycline 10 (71.4%), gentamycin 9 (64.2%), clindamycin 7 (50.0%) and ampicillin 6 (42.8%). Similarly, Staphylococcus aureus isolates also showed resistance to vancomycin 11 (78.5%), oxacillin, oxtetracycline and trimethoprim-sulfamethoxazole 10 (71.4%) while erythromycin, tetracycline and streptomycin showed 7 (50.0%) respectively. Staphylococcus aureus isolates indicated a high percentage of isolates having MARI characteristics of 0.92%. A total 2/6 (33.3%) of the samples were found positive for the presence SEA and 1/6 (16.7%) for SEB. It was concluded that the study confirmed the presence of enterotoxins in African catfish which is a major concern to public health. Preventive and control measures are necessary to tackle this serious food safety concern.
   </abstract>
   <kwd-group> 
    <kwd>
     Staphylococcus aureus
    </kwd> 
    <kwd>
      Antimicrobials
    </kwd> 
    <kwd>
      Foodborne Diseases
    </kwd> 
    <kwd>
      Public Health Pathogens
    </kwd>
   </kwd-group>
  </article-meta>
 </front>
 <body>
  <sec id="s1">
   <title>1. Introduction</title>
   <p>Seafood including fish meat is the chief source of animal protein in the diet. Consumption of seafoods specifically fish is increasing due to its health advantages over red meat and other food products <xref ref-type="bibr" rid="scirp.143597-1">
     [1]
    </xref>. Food-borne infections are common and constitute an important health and economic burden globally <xref ref-type="bibr" rid="scirp.143597-2">
     [2]
    </xref>.</p>
   <p>Staphylococcus aureus is an opportunistic pathogen that causes several diseases such as skin and soft tissue infections <xref ref-type="bibr" rid="scirp.143597-3">
     [3]
    </xref>, food poisoning, and life-threatening complications, such as pneumonia, endocarditis osteomyelitis, and toxic shock syndrome, due to its large arsenal of exotoxins, including enterotoxins, as well as invasion, immune evasion, and antibiotic resistance mechanisms <xref ref-type="bibr" rid="scirp.143597-4">
     [4]
    </xref>. Several foodborne pathogens have been reportedly associated with fish contamination <xref ref-type="bibr" rid="scirp.143597-5">
     [5]
    </xref>. Staphylococcus aureus is amongst one of the leading causes of food contamination, which can spoil the food by producing lethal enterotoxin <xref ref-type="bibr" rid="scirp.143597-6">
     [6]
    </xref>. Food borne diseases are identified by presenting various symptoms in the gastrointestinal system, such as: nausea, vomiting, diarrhoea, abdominal pain and fever <xref ref-type="bibr" rid="scirp.143597-7">
     [7]
    </xref>.</p>
   <p>Staphylococcal enterotoxin (SEs) are exoproteins which when ingested by humans give rise to symptoms of acute gastroenteritis. SEA is frequently associated with food poisoning outbreaks and accounts for about 75% of the outbreaks in developed countries <xref ref-type="bibr" rid="scirp.143597-8">
     [8]
    </xref>. SED is the second most prevalent toxin causing food poisoning outbreaks followed by the SECs and SEB <xref ref-type="bibr" rid="scirp.143597-8">
     [8]
    </xref>. The best measures to prevent enterotoxin associated food poisoning in S. aureus rely on preventing the bacteria from contaminating food and discourage continue replication. This is because Staphylococcal enterotoxins are stable to heat treatment and stomach acid <xref ref-type="bibr" rid="scirp.143597-9">
     [9]
    </xref>. Fish have a microbiota that is dependent on what it exists in the waters where they live, meaning that polluted waters can provide a variety of pathogens; the microorganisms in the skin and gastrointestinal content of the fish in life do not invade the sterile muscle package due to the protection of its natural defences. When the animal dies, these microorganisms penetrate the fish, causing deterioration and loss of safety. The presence of Staphylococcus aureus in fish and fish products can mainly indicate contamination from the skin, mouth and nostrils of infected handlers or healthy carriers, during stages of capture, transport, storage, processing and preparation processes <xref ref-type="bibr" rid="scirp.143597-10">
     [10]
    </xref> <xref ref-type="bibr" rid="scirp.143597-11">
     [11]
    </xref>. Contamination of seafood with drug resistance and virulent species of S. aureus can create serious food safety and public health issues. Enterotoxin producing MRSA can be more fatal and problematic compared to its drug sensitive counterpart <xref ref-type="bibr" rid="scirp.143597-12">
     [12]
    </xref>. Staphylococcus aureus has been isolated from fish by some previous researchers like Arslan and Ozdemir, <xref ref-type="bibr" rid="scirp.143597-13">
     [13]
    </xref> who reported 24% of Staphylococcus aureus from fish. Similarly, Haifaa et al., <xref ref-type="bibr" rid="scirp.143597-14">
     [14]
    </xref> recorded the percentage of 35.5% Staphylococcus aureus from the skin, 21% from intestine and 25.8% from the liver respectively. Staphylococcus aureus detection from fish, Oreochromis niloticus, and wastewater samples from Qarun Lake with a prevalence of 81.5%, suggests that this pathogen may be abundant in lakes <xref ref-type="bibr" rid="scirp.143597-15">
     [15]
    </xref>. Many species of staphylococci are capable of releasing enterotoxin that can cause gastroenteritis in humans when foods contaminated by these species are consumed <xref ref-type="bibr" rid="scirp.143597-16">
     [16]
    </xref>. Obaidat et al. <xref ref-type="bibr" rid="scirp.143597-17">
     [17]
    </xref> reported 88.5 prevalence of Staphylococcus aureus in imported fish and correlations between antibiotic resistance and enterotoxigenicity. Preventive measures such as practicing hand hygiene measures are important to avoid or reduce contamination of food by S. aureus. These procedures must include control of raw materials, proper handling, cleaning and disinfection of equipment from farm to fork. The aim of the present study was to detect Staphylococcal enterotoxins A and B from the organs of African catfish from the wild and ponds from selected area councils in the FCT, Abuja.</p>
  </sec><sec id="s2">
   <title>2. Material and Method</title>
   <sec id="s2_1">
    <title>2.1. Study Area and Design</title>
    <p>A cross-sectional study was employed and primary sources (fish ponds/wild) included three randomly selected area councils of Gwagwalada, Kubwa and Amac in the FCT Abuja, which was formed in 1976, from parts of Nasarawa, Niger and Kogi States. The territory is located just north of the confluence of Niger and Benue rivers. It is bordered by Niger State to the West and North, Kaduna to the Northwest, Nassarawa to the East and South and Kogi to the Southwest. Abuja has an estimated human population of 2,690,000 according to Federal Capital Territory Administration <xref ref-type="bibr" rid="scirp.143597-18">
      [18]
     </xref>. It lies between latitude 8.25 and 9.20 North of the equator, and longitude 6.45 and 7.39 East of Greenwich Meridian. Abuja is geographically located in the centre of the country. The Federal Capital Territory has a land mass of approximately 7315 km<sup>2</sup> of which the actual city occupies 275.3 km<sup>2</sup>. It is situated within the Savannah region with moderate climatic conditions.</p>
   </sec>
   <sec id="s2_2">
    <title>2.2. Ethical Approval</title>
    <p>
     <xref ref-type="bibr" rid="scirp.143597-"></xref>Ethical approval was sought from Committee on animal use and care ABU Zaria.</p>
   </sec>
   <sec id="s2_3">
    <title>2.3. Study Design/Sample Collection</title>
    <p>A cross sectional epidemiological study was conducted and freshly caught African catfish (Clarias gariepinus) were purchased from the wild/ponds in the three selected Area Councils namely, Gwagwalada 66 each from the wild/ponds, Abuja Municipal Area council 66 each from the wild/ponds and Bwari 68 each from the wild/ponds by using purposive sampling method in the FCT, Abuja totalling 400 samples and transported to bacterial Zoonoses Laboratory Department of Veterinary Public Health and Preventive Medicine Ahmadu Bello University Zaria for analyses.</p>
   </sec>
   <sec id="s2_4">
    <title>2.4. Enumeration and Isolation of Staphylococcus aureus</title>
    <p>This was conducted according to the procedure described by <xref ref-type="bibr" rid="scirp.143597-19">
      [19]
     </xref>. Ten grams portion each of the intestine and gills were aseptically weighed using a weighing balance and placed in a sterile polythene bag and homogenized in 90 ml of sterile peptone water in a stomacher for two minutes. Using a sterile pipette, one ml from the homogenized sample was inoculated onto Tryptic soy broth containing 6.5% NaCl and incubated at 37˚C for 24 h. The skin swab stick was dropped into 90 ml of peptone water and thereafter one ml was inoculated onto 9 ml of tryptic soy broth (TSB) containing 6.5% NaCl and incubated at 37˚C for 24 h. A loopful of the homogenate was picked using a sterile inoculating wire loop and streaked on Baird-Parker agar supplemented with egg yolk tellurite and incubated at 37˚C for 24 h. Tiny shiny black colonies on BPA are suggestive of Staphylococcus aureus, were picked and streaked on nutrient agar slant and incubated for 24 h and subsequently stored at 4˚C in the refrigerator for further identification by standard methods.</p>
   </sec>
   <sec id="s2_5">
    <title>2.5. Biochemical Characterization of Isolates</title>
    <p>Presumptive Staphylococcus species that were gram positive cocci in clusters were subjected to biochemical tests as described by <xref ref-type="bibr" rid="scirp.143597-20">
      [20]
     </xref> which were; coagulase test, catalase test, Oxidase test, Haemolysin test, DNase test and fermentation of maltose, mannose, lactose, fructose, sucrose trehalose, xylose and D-glulose. These isolates were further confirmed using MicrogenTM STAPH-identification system (Microgen Bioproducts, United Kingdom).</p>
   </sec>
   <sec id="s2_6">
    <title>2.6. Antibiotic Sensitivity</title>
    <p>Antibiotic susceptibility tests for isolates of Staphylococcus aureus were performed according to the Kirby-Bauer method as described by <xref ref-type="bibr" rid="scirp.143597-21">
      [21]
     </xref> and the evaluation methods of the Clinical and Laboratory standards Institutes <xref ref-type="bibr" rid="scirp.143597-22">
      [22]
     </xref>. Isolates grown on nutrient agar overnight were suspended in 2 ml sterile normal saline (0.9% sodium chloride solution). A turbidity equivalent was prepared by comparing with a 0.5 MacFarland standards. Bacterial suspensions of 0.1 ml were spread on plates of sterile Mueller-Hinton agar with the help of a sterile cotton swab to form a smooth bacterial lawn. Antimicrobial discs were placed on the plates with disc dispenser and gently pressed down to ensure contact. The plates were allowed to stand for 30 minutes for diffusion of active substances of the agents. Plates were carefully inverted and incubated at 35˚C - 37˚C for 24 hr. The inhibition zone diameter around the disc were measured and compared with the interpretation standards provided by <xref ref-type="bibr" rid="scirp.143597-22">
      [22]
     </xref>. Multiple antibiotic resistance (MARI) for this study is defined as resistance of isolate to three or more antibiotics <xref ref-type="bibr" rid="scirp.143597-23">
      [23]
     </xref>. Multiple antibiotic resistance index (MARI) was calculated according to Furtula et al. <xref ref-type="bibr" rid="scirp.143597-24">
      [24]
     </xref> as the ratio of number of antibiotics to which an organism is resistant, to the total number of antibiotics to which an organism is exposed to.</p>
   </sec>
   <sec id="s2_7">
    <title>
     <xref ref-type="bibr" rid="scirp.143597-"></xref>2.7. PCR Detection of Staphylococcal Enterotoxin A and B Genes</title>
    <p>DNA extraction was performed using suspension of isolated colonies prepared in sterile distilled water following protocol of bacterial DNA extraction kit (DNAzol<sup>®</sup> BD, USA). Two to three well isolated colonies of suspected Staphlococcus aureus isolates were suspended in 0.5 ml autoclaved distilled water. One ml of DNAzol was added in bacterial suspension. The mixture was vortexed vigorously for 15 - 20 seconds and stored at room temperature for 5 minutes then centrifuged for 1 minute at 8000 g. A volume of 0.4 ml of isopropanol was added to the lysate for precipitation of DNA. The precipitated DNA was sedimented by centrifugation at 6000 g for 5 minutes, supernatant was removed and 0.5 ml of DNAzol was added to the DNA pellet. The DNA pellet was vortexed until it was completely dispersed. Then it was centrifuged at 6000 g for 5 minutes. The supernatant was removed and washed, the DNA pellet was mixed with 1 ml of 75% chilled ethanol. Again, it was centrifuged at 7000 g for 5 minutes. The ethanol wash was decanted and stored in the eppendrof tube vertically for 15 minutes to evaporate any residual ethanol. The DNA pellet was then dissolved in 20 ul molecular grade water.</p>
    <p>A multiplex PCR assay was performed to detect Staphylococcal enterotoxin A and B. The multiplex PCR assay was carried out with the CLASSIC K960 (UK) thermocycler. The PCR amplification was performed using PCR PreMix kit (iNtRON, Korea) and specific primers listed in <xref ref-type="table" rid="table1">
      Table 1
     </xref>, in a total volume of 20  μL of mixture containing 0.5  μL of each of the toxin gene-specific primers, 2  μL of template DNA, and 15  μL of double distilled water. The amplification conditions included three steps: initial denaturation at 94˚C for 5  min, 35 cycles of denaturation at 94˚C for 45  sec, primer annealing at 50˚C for 45 seconds, and extension at 72˚C for 45  seconds followed by the final extension at 72˚C for 7  min. The amplified products were then resolved by electrophoresis in 2% agarose gel at 100 V for 60 minutes. Gels were stained with ethidium bromide solution and documentation was done using the Gel Doc system.</p>
    <table-wrap id="table1">
     <label>
      <xref ref-type="table" rid="table1">
       Table 1
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.143597-"></xref>Table 1. Primer sequences multiplex PCR and predicted product size for Staphylococcal Enterotoxins.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="10.78%"><p style="text-align:center">Gene</p></td> 
       <td class="custom-bottom-td acenter" width="56.04%"><p style="text-align:center">Primer Sequence</p></td> 
       <td class="custom-bottom-td acenter" width="8.62%"><p style="text-align:center"></p></td> 
       <td class="custom-bottom-td acenter" width="24.56%"><p style="text-align:center">Reference</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td acenter" width="10.78%"><p style="text-align:center">SEA</p></td> 
       <td class="custom-top-td acenter" width="56.04%"><p style="text-align:center">F-5ATGGTTATCAATGTGCGGGTG3</p><p style="text-align:center">R-3TGAATACTGTCCTTGAGCACCA5</p></td> 
       <td class="custom-top-td acenter" width="8.62%"><p style="text-align:center">344</p></td> 
       <td class="custom-top-td acenter" width="24.56%"><p style="text-align:center">Peacock et al. <xref ref-type="bibr" rid="scirp.143597-37">
          [37]
         </xref></p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="10.78%"><p style="text-align:center">SEB</p></td> 
       <td class="acenter" width="56.04%"><p style="text-align:center">F-5TGGTATGACATGATGCCTGCAC3</p><p style="text-align:center">R-3AGGTACTCTATAAGTGCCTGCCT5</p></td> 
       <td class="acenter" width="8.62%"><p style="text-align:center">196</p></td> 
       <td class="acenter" width="24.56%"><p style="text-align:center"></p></td> 
      </tr> 
     </table>
    </table-wrap>
   </sec>
  </sec><sec id="s3">
   <title>3. Data Analysis</title>
   <p>Statistical Packages for Social Sciences (SPSS Version 23.0) data obtained was presented using descriptive statistics in percentages, tables, figures and charts. Chi-square was used to test for association and 95% confidence interval was used where appropriate to test for association between levels of contamination in different markets. P-value ≤ 0.05 was considered as significant.</p>
  </sec><sec id="s4">
   <title>4. Results</title>
   <p>In this study, a total of 400 samples were collected from the three area councils of the FCT, Abuja, namely Gwagwalada, Bwari and Abuja municipal area council and subjected to analysis for the presence of S. aureus revealed 10 (5.0%) of the samples collected from the ponds and 12 (6.0%) from the wild were positive for S. aureus (<xref ref-type="table" rid="table2">
     Table 2
    </xref>).</p>
   <table-wrap id="table2">
    <label>
     <xref ref-type="table" rid="table2">
      Table 2
     </xref></label>
    <caption>
     <title>
      <xref ref-type="bibr" rid="scirp.143597-"></xref>Table 2. Prevalence of Staphylococcus aureus from African catfish (Clarias gariepinus) from ponds and Wild from selected area councils in the FCT Abuja.</title>
    </caption>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td rowspan="2" class="acenter" width="20.00%"><p style="text-align:center">Type</p></td> 
      <td rowspan="2" class="acenter" width="23.29%"><p style="text-align:center">No. of Samples pond</p></td> 
      <td class="custom-bottom-td acenter" width="19.37%"><p style="text-align:center">No. Positive (%)</p></td> 
      <td class="custom-bottom-td acenter" width="20.89%"><p style="text-align:center">No. of Samples Wild</p></td> 
      <td class="custom-bottom-td acenter" width="16.45%"><p style="text-align:center">No. Positive (%)</p></td> 
     </tr> 
     <tr> 
      <td class="custom-bottom-td custom-top-td acenter" width="19.37%"><p style="text-align:center">Skin</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="20.89%"><p style="text-align:center">Gills</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="16.45%"><p style="text-align:center">Intestine</p></td> 
     </tr> 
     <tr> 
      <td class="custom-top-td acenter" width="20.00%"><p style="text-align:center">AMAC</p></td> 
      <td class="custom-top-td acenter" width="23.29%"><p style="text-align:center">66</p></td> 
      <td class="custom-top-td acenter" width="19.37%"><p style="text-align:center">3 (4.5)</p></td> 
      <td class="custom-top-td acenter" width="20.89%"><p style="text-align:center">66</p></td> 
      <td class="custom-top-td acenter" width="16.45%"><p style="text-align:center">5 (7.5)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="20.00%"><p style="text-align:center">Gwagwalada</p></td> 
      <td class="acenter" width="23.29%"><p style="text-align:center">66</p></td> 
      <td class="acenter" width="19.37%"><p style="text-align:center">5 (7.5)</p></td> 
      <td class="acenter" width="20.89%"><p style="text-align:center">66</p></td> 
      <td class="acenter" width="16.45%"><p style="text-align:center">6 (9.0)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="20.00%"><p style="text-align:center">Bwari</p></td> 
      <td class="acenter" width="23.29%"><p style="text-align:center">68</p></td> 
      <td class="acenter" width="19.37%"><p style="text-align:center">2 (2.9)</p></td> 
      <td class="acenter" width="20.89%"><p style="text-align:center">68</p></td> 
      <td class="acenter" width="16.45%"><p style="text-align:center">1 (1.4)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="20.00%"><p style="text-align:center">Total</p></td> 
      <td class="acenter" width="23.29%"><p style="text-align:center">200</p></td> 
      <td class="acenter" width="19.37%"><p style="text-align:center">10 (5.0)</p></td> 
      <td class="acenter" width="20.89%"><p style="text-align:center">200</p></td> 
      <td class="acenter" width="16.45%"><p style="text-align:center">12 (6.0)</p></td> 
     </tr> 
    </table>
   </table-wrap>
   <p>S. aureus isolates subjected to antibiogram revealed 11/14 78.5% resistance to vancomycin, whereas oxytretacycline, Trimethoprim-Sulfamethaxazole and Oxacillin revealed 10/14 (71.4). Cefazolin 9/14 (64.2) with Doxycline and clindamycin showing the least resistance 2/14 (14.2%). S. aureus isolates showed susceptibility to doxycycline 10/14 (71.4%) and gentamycin 9/14 (64.2%) and clindamycin 7/14 (50.0%) respectively (<xref ref-type="table" rid="table3">
     Table 3
    </xref>).</p>
   <p>Two isolates showed resistance to thirteen antibiotics and one to eleven antibiotics used in the study whereas four isolates showed resistance to nine and one to six to four isolates respectively (<xref ref-type="table" rid="table4">
     Table 4
    </xref>).</p>
   <p>Pathogenicity of S. aureus isolates was molecularly determined by using two different genes SEA and SEB. The enterotoxins A is more frequently associated to this organism responsible for food poisoning. It was found in this study that 2/6 (33%) isolates are positive for SEA and 1 (16.7%) are positive for SEB gene (<xref ref-type="fig" rid="fig1">
     Figure 1
    </xref>). It was also confirmed that none of the isolates are having both SEA and SEB genes.</p>
   <table-wrap id="table3">
    <label>
     <xref ref-type="table" rid="table3">
      Table 3
     </xref></label>
    <caption>
     <title>
      <xref ref-type="bibr" rid="scirp.143597-"></xref>Table 3. Antibiotic susceptibility of S. aureus from African catfish.</title>
    </caption>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td class="custom-bottom-td acenter" width="32.36%"><p style="text-align:center">Antibacterial Agent</p></td> 
      <td class="custom-bottom-td acenter" width="17.65%"><p style="text-align:center">Disk potency (µg)</p></td> 
      <td class="custom-bottom-td acenter" width="16.17%"><p style="text-align:center">No susceptible (%)</p></td> 
      <td class="custom-bottom-td acenter" width="19.12%"><p style="text-align:center">No intermediate (%)</p></td> 
      <td class="custom-bottom-td acenter" width="14.70%"><p style="text-align:center">No resistant (%)</p></td> 
     </tr> 
     <tr> 
      <td class="custom-top-td acenter" width="32.36%"><p style="text-align:center">Doxycycline (Dxy)</p></td> 
      <td class="custom-top-td acenter" width="17.65%"><p style="text-align:center">30</p></td> 
      <td class="custom-top-td acenter" width="16.17%"><p style="text-align:center">10 (71.4)</p></td> 
      <td class="custom-top-td acenter" width="19.12%"><p style="text-align:center">00 (0%)</p></td> 
      <td class="custom-top-td acenter" width="14.70%"><p style="text-align:center">2 (14.2)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Cloxacillin</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">30</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">6 (22.2)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">00 (0%)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">6 (22.2%)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Gentamicin (GN)</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">10</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">9 (64.2)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">00 (0%)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">3 (21.4)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Clindamycin (CLI)</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">2</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">7 (50.0)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">3 (21.4)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">2 (14.2)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Cefazolin</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">30</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">3 (21.4)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">00 (0%)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">9 (64.2)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Oxacillin (OXA)</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">30</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">2 (14.2)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">00 (0%)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">10 (71.4)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Erythromycin (E)</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">15</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">3 (21.4)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">2 (14.2)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">7 (50.0)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Streptomycin (S)</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">25</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">4(28.5)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">1 (7.1)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">7 (50.0)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Ciprofloxacin (CIP)</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">5</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">3 (21.4)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">1 (7.1)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">8 (57.1)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Ampicilin</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">10</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">6 (42.8)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">2 (14.2)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">4 (28.5)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Vancomycin (VA)</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">30</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">1 (7.1)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">00 (0%)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">11 (78.5)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Tetracycline (TE)</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">30</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">5 (35.7)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">00 (0%)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">7 (50.0)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Oxytetracycline (OXY)</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">30</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">2 (14.2)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">00 (0%)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">10 (71.4)</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="32.36%"><p style="text-align:center">Trimethoprim-Sulfamethaxazole (SXT)</p></td> 
      <td class="acenter" width="17.65%"><p style="text-align:center">1.23/23.75</p></td> 
      <td class="acenter" width="16.17%"><p style="text-align:center">2 (7.4)</p></td> 
      <td class="acenter" width="19.12%"><p style="text-align:center">00 (0%)</p></td> 
      <td class="acenter" width="14.70%"><p style="text-align:center">10 (71.4)</p></td> 
     </tr> 
    </table>
   </table-wrap>
   <table-wrap id="table4">
    <label>
     <xref ref-type="table" rid="table4">
      Table 4
     </xref></label>
    <caption>
     <title>
      <xref ref-type="bibr" rid="scirp.143597-"></xref>Table 4. Antibiotic resistance pattern of S. aureus from African catfish.</title>
    </caption>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td class="custom-bottom-td acenter" width="10.23%"><p style="text-align:center">No.</p></td> 
      <td class="custom-bottom-td acenter" width="19.32%"><p style="text-align:center">Isolates</p></td> 
      <td class="custom-bottom-td acenter" width="104.17%"><p style="text-align:center">Resistance pattern</p></td> 
      <td class="custom-bottom-td acenter" width="26.67%"><p style="text-align:center">MARI</p></td> 
     </tr> 
     <tr> 
      <td class="custom-top-td acenter" width="10.23%"><p style="text-align:center">1.</p></td> 
      <td class="custom-top-td acenter" width="19.32%"><p style="text-align:center">A G2</p></td> 
      <td class="custom-top-td acenter" width="104.17%"><p style="text-align:center">OXA, OXY, SXT, CIP, DOX, CLI, CFZ, CX, VA, TE, GN, S, E</p></td> 
      <td class="custom-top-td acenter" width="26.67%"><p style="text-align:center">0.92</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="10.23%"><p style="text-align:center">2.</p></td> 
      <td class="acenter" width="19.32%"><p style="text-align:center">G S6</p></td> 
      <td class="acenter" width="104.17%"><p style="text-align:center">OXA, OXY, SXT, CIP, DOX, CLI, CFZ, CX, VA, TE, GN, S, E,</p></td> 
      <td class="acenter" width="26.67%"><p style="text-align:center">0.92</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="10.23%"><p style="text-align:center">3.</p></td> 
      <td class="acenter" width="19.32%"><p style="text-align:center">A G3</p></td> 
      <td class="acenter" width="104.17%"><p style="text-align:center">OXA, OXY, SXT, CIP, CFZ, CX, VA, TE, GN, S, E</p></td> 
      <td class="acenter" width="26.67%"><p style="text-align:center">0.78</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="10.23%"><p style="text-align:center">4.</p></td> 
      <td class="acenter" width="19.32%"><p style="text-align:center">B I3</p></td> 
      <td class="acenter" width="104.17%"><p style="text-align:center">OXA, OXY, SXT, CIP, CFZ, CX, VA, TE, S</p></td> 
      <td class="acenter" width="26.67%"><p style="text-align:center">0.64</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="10.23%"><p style="text-align:center">5.</p></td> 
      <td class="acenter" width="19.32%"><p style="text-align:center">B G5</p></td> 
      <td class="acenter" width="104.17%"><p style="text-align:center">OXA, OXY, SXT, CIP, CFZ, CX, VA, TE, S</p></td> 
      <td class="acenter" width="26.67%"><p style="text-align:center">0.64</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="10.23%"><p style="text-align:center">6.</p></td> 
      <td class="acenter" width="19.32%"><p style="text-align:center">A S4</p></td> 
      <td class="acenter" width="104.17%"><p style="text-align:center">OXA, OXY, SXT, CIP, CFZ, CX, VA, TE, S</p></td> 
      <td class="acenter" width="26.67%"><p style="text-align:center">0.64</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="10.23%"><p style="text-align:center">7.</p></td> 
      <td class="acenter" width="19.32%"><p style="text-align:center">G S2</p></td> 
      <td class="acenter" width="104.17%"><p style="text-align:center">OXA, OXY, SXT, CIP, CFZ, VA, TE, S, E,</p></td> 
      <td class="acenter" width="26.67%"><p style="text-align:center">0.64</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="10.23%"><p style="text-align:center">8.</p></td> 
      <td class="acenter" width="19.32%"><p style="text-align:center">B I7</p></td> 
      <td class="acenter" width="104.17%"><p style="text-align:center">OXA, OXY, SXT, CIP, CFZ, VA</p></td> 
      <td class="acenter" width="26.67%"><p style="text-align:center">0.42</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="10.23%"><p style="text-align:center">9.</p></td> 
      <td class="acenter" width="19.32%"><p style="text-align:center">B S2</p></td> 
      <td class="acenter" width="104.17%"><p style="text-align:center">OXA, OXY, SXT, CFZ, VA</p></td> 
      <td class="acenter" width="26.67%"><p style="text-align:center">0.35</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="10.23%"><p style="text-align:center">10.</p></td> 
      <td class="acenter" width="19.32%"><p style="text-align:center">A G6</p></td> 
      <td class="acenter" width="104.17%"><p style="text-align:center">OXA, OXY, SXT, VA</p></td> 
      <td class="acenter" width="26.67%"><p style="text-align:center">0.28</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="10.23%"><p style="text-align:center">11.</p></td> 
      <td class="acenter" width="19.32%"><p style="text-align:center">A I5</p></td> 
      <td class="acenter" width="104.17%"><p style="text-align:center">VA</p></td> 
      <td class="acenter" width="26.67%"><p style="text-align:center">0.07</p></td> 
     </tr> 
    </table>
   </table-wrap>
   <fig id="fig1" position="float">
    <label>Figure 1</label>
    <caption>
     <title>
      <xref ref-type="bibr" rid="scirp.143597-"></xref>Figure 1. Agarose gel picture of the product of electrophoresis of multiplex PCR amplification of Sea (344 bp) and Seb (196 bp) genes. Legend Lane M is the molecular weight marker and lanes 1 and 3 positive S. aureus isolates for Sea and 2 positive S. aureus isolates for Seb lane 6-ve control.</title>
    </caption>
    <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272157-rId19.jpeg?20250627104855" />
   </fig>
  </sec><sec id="s5">
   <title>5. Discussion</title>
   <p>Staphylococcus aureus is an important foodborne pathogen, most frequently associated with enterotoxins associated intoxication <xref ref-type="bibr" rid="scirp.143597-25">
     [25]
    </xref>. Food-borne infections are common and constitute an important health and economic burden globally <xref ref-type="bibr" rid="scirp.143597-2">
     [2]
    </xref>. Food handlers contribute to food safety, being potential sources of bacteria that cause foodborne diseases due to the introduction of pathogens during its processing, distribution and manipulation <xref ref-type="bibr" rid="scirp.143597-26">
     [26]
    </xref>. S. aureus is not the normal flora of fish species and its presence in seafood and fish cannot be ignored <xref ref-type="bibr" rid="scirp.143597-27">
     [27]
    </xref>. In this study we found 5.0% prevalence of S. aureus from the pond and 6.0% from the wild which are in line with the report of 26% by <xref ref-type="bibr" rid="scirp.143597-13">
     [13]
    </xref>. Similarly, Bujjamma and Padmavathi <xref ref-type="bibr" rid="scirp.143597-28">
     [28]
    </xref> reported 24.5% of Staphylococcus auerus from fish. Mohammed et al. <xref ref-type="bibr" rid="scirp.143597-29">
     [29]
    </xref> reported 31% S. aureus contamination in fish from Nigeria. Furthermore, Rashid et al. <xref ref-type="bibr" rid="scirp.143597-30">
     [30]
    </xref> reported enterotoxigenic methicillin resistant Staphylococcus aureus contamination in salted fish from Gwadar Balochistan. Also, Matouke and Nour <xref ref-type="bibr" rid="scirp.143597-31">
     [31]
    </xref> reported 53% from gills and 57% from the intestines of Clarias gariepinus from the characterization of antibiotic-resistant Staphylococcus aureus from gills and gastro-intestinal tracts of catfish (Clarias gariepinus), and water samples from Jabi Lake, Abuja, Nigeria. The variation may be due to the method of isolation and the sample size as well as the locations and the deeper organs sampled in the present study. Isolation of Staphylococcus aureus and its toxins calls for concern. Because the most common way of contamination of fish is by contact with fish handlers hands, especially in the cases where the fish is handled before or after cooking. Prolonged storage without refrigeration allows the bacteria to grow and form toxins. Since some toxins are heat-stable, the incriminated fish may cause food poisoning even when subjected to further heat treatment <xref ref-type="bibr" rid="scirp.143597-32">
     [32]
    </xref>.</p>
   <p>Antibiotic resistance patterns of S. aureus isolated from this study showed resistance to multiple antibiotics. The pattern of resistance of Staphylococcus aureus isolates showed that vancomycin, oxacillin, oxytretecycline, and Trimethoprim-Sulfamethaxazole heard the highest resistant which agrees with the report of <xref ref-type="bibr" rid="scirp.143597-33">
     [33]
    </xref> who reported resistance to Tetracycline 18 (64.3%). Vancomycin 17 (60.7%), Erythromycin 17 (60.7), Trimethoprim-Sulfamethaxazole 7 (25) from the isolates of Staphylococcus aureus from milk in Zaria Kaduna state Nigeria. However, resistance to vancomycin from this study is not in conformity with the report of Godwin et al. <xref ref-type="bibr" rid="scirp.143597-34">
     [34]
    </xref> who reported 100% susceptibility to vancomycin. Impact of antibiotic resistance may result in severe illness, disability, long hospital stays, increase healthcare cost, treatment failure and even death, Susceptibility of Staphylococcus aureus from this study to doxycycline, gentamycin, clindamycin and ciprofloxacin agrees with the reports of Grema et al., <xref ref-type="bibr" rid="scirp.143597-35">
     [35]
    </xref> who reported considerably level of susceptibility to gentamicin, clindamycin, doxycycline and ciprofloxacin respectively.</p>
   <p>MARI of 0.92 recorded from this study may be an indication of high and indiscriminate usage of antibiotics <xref ref-type="bibr" rid="scirp.143597-24">
     [24]
    </xref>. The high percentage occurrence of multiple antibiotics resistance (MAR) index among the bacterial isolates in this study might have arisen due to common practices such as self-medication and over the counter usage of antibiotics.</p>
   <p>Pathogenicity of S. aureus isolates was molecularly determined by using two different genes primer representing SEA and SEB. The enterotoxins A is more frequently associated to this organism responsible for food poisoning. It was found in this study that 2/6 (33.3%) isolates are positive for SEA gene while 1/6 (16.7%) of the isolates are positive for SEB genes. The enterotoxin A and B found in this study have also been reported in other works by previous researchers Mohammed et al. <xref ref-type="bibr" rid="scirp.143597-29">
     [29]
    </xref> reported high level of SEA (38%) compared to SEB (35.7%) genes from salted fish in Khartoum states Sudan. Study by Rashid et al. <xref ref-type="bibr" rid="scirp.143597-36">
     [36]
    </xref> revealed 38% SEA and 23% SEB gene presence in the isolates, which shows higher frequency of SEA compared to SEB which agrees with this present study. The detection of staphylococcal enterotoxins in fish is of public health concern as it can lead to food poisoning through the consumption of contaminated fish particularly in retailed outlets. However, further research is needed to check for the distribution of these toxins in fish globally.</p>
  </sec><sec id="s6">
   <title>6. Conclusion/Recommendations</title>
   <p>A significant number of S. aureus were isolated from the gills, skin and intestine of fish, which showed resistance to thirteen different antibiotics and were detected carrying enterotoxins genes SEA and SEB. Proper hygiene practices such as the washing of hands, utensils, and surface with hot, soapy water before and after handling raw fish and also avoid touching the face or other food items while handling raw fish to prevent the transfer of Staphylococcus aureus as well as advise to fish farmers on indiscriminate use of antibiotics and discourage the use of antibiotics as growth promoters during feed formulation.</p>
  </sec>
 </body><back>
  <ref-list>
   <title>References</title>
   <ref id="scirp.143597-ref1">
    <label>1</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Laskowski, W., Górska-Warsewicz, H. and Kulykovets, O. (2018) Meat, Meat Products and Seafood as Sources of Energy and Nutrients in the Average Polish Diet. Nutrients, 10, Article No. 1412. &gt;https://doi.org/10.3390/nu10101412
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref2">
    <label>2</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Nazzal, Z., Said, H., Al-Hajiri, M. and Tamim, O. (2012) Salmonella Food Poisoning Associated with Macaroni Salad in a Labourers CAMP-State of Qatar, 2010. Journal of Community Medicine&amp;Health Education, 2, Article No. 145. &gt;https://doi.org/10.4172/2161-0711.1000145
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref3">
    <label>3</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lacey, K., Geoghegan, J. and McLoughlin, R. (2016) The Role of Staphylococcus aureus Virulence Factors in Skin Infection and Their Potential as Vaccine Antigens. Pathogens, 5, Article No. 22. &gt;https://doi.org/10.3390/pathogens5010022
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref4">
    <label>4</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Chieffi, D., Fanelli, F., Cho, G., Schubert, J., Blaiotta, G., Franz, C.M.A.P., et al. (2020) Novel Insights into the Enterotoxigenic Potential and Genomic Background of Staphylococcus aureus Isolated from Raw Milk. Food Microbiology, 90, Article ID: 103482. &gt;https://doi.org/10.1016/j.fm.2020.103482
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref5">
    <label>5</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Akbar, A. and Anal, A.K. (2011) Food Safety Concerns and Food-Borne Pathogens, Salmonella, Escherichia coli and Campylobacter. FUUAST Journal of Biology, 1, 5-17.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref6">
    <label>6</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Akbar, A. and Anal, A.K. (2013) Occurrence of Staphylococcus aureus and Evaluation of Anti-Staphylococcal Activity of Lactococcus lactis Subsp. Lactis in Ready-to-Eat Poultry Meat. Annals of Microbiology, 64, 131-138. &gt;https://doi.org/10.1007/s13213-013-0641-x
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref7">
    <label>7</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Soto Varela, Z., Pérez Lavalle, L. and Estrada Alvarado, D. (2016) Bacteria Causing of Foodborne Diseases: An Overview at Colombia. Salud Uninorte, 32, 105-122. &gt;https://doi.org/10.14482/sun.32.1.8598
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref8">
    <label>8</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Normanno, G., Firinu, A., Virgilio, S., Mula, G., Dambrosio, A., Poggiu, A., et al. (2005) Coagulase-Positive Staphylococci and in Food Products Marketed in Italy. International Journal of Food Microbiology, 98, 73-79. &gt;https://doi.org/10.1016/j.ijfoodmicro.2004.05.008
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref9">
    <label>9</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Schelin, J., Wallin-Carlquist, N., Thorup Cohn, M., Lindqvist, R. and Barker, G.C. (2011) The Formation of Staphylococcus aureus Enterotoxin in Food Environments and Advances in Risk Assessment. Virulence, 2, 580-592. &gt;https://doi.org/10.4161/viru.2.6.18122
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref10">
    <label>10</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Huss, H.H. (1997) Aseguramiento de la calidad de los productos pesqueros. FAO Documento Técnico de Pesca. No. 334. Organización de las Naciones Unidas para la Agricultura y la Alimentación (FAO) Roma (Italia).
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref11">
    <label>11</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Romero-Jarero, J.M. and Negrete-Redondo, M.d.P. (2011) Presencia de bacterias Gram positivas en músculo de pescado con importancia comercial en la zona del Caribe mexicano. Revista Mexicana de Biodiversidad, 82, 599-606. &gt;https://doi.org/10.22201/ib.20078706e.2011.2.465
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref12">
    <label>12</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mirani, Z.A., Aqeel, A. and Naz, S. (2017) Prevalence of Staphylococci in Commercially Processed Food Products in Karachi-Pakistan. Journal of Microbiology and Infectious Diseases, 7, 83-87.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref13">
    <label>13</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Arslan, S. and Özdemir, F. (2017) Molecular Characterization and Detection of Enterotoxins, Methicillin Resistance Genes and Antimicrobial Resistance of Staphylococcus aureus from Fish and Ground Beef. Polish Journal of Veterinary Sciences, 20, 85-94. &gt;https://doi.org/10.1515/pjvs-2017-0012
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref14">
    <label>14</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Hussein Ali, H. (2014) Isolation and Identification of Staphylococcus Bacteria from Fish of Fresh Water and Its Antibiotics Sensitivity in Mosul City. Basrah Journal of Veterinary Research, 13, 33-42. &gt;https://doi.org/10.33762/bvetr.2014.88123
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref15">
    <label>15</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Abdel-Gawad, F., Emeda, W.E., El-Taweel, G. and Shehata, S. (2015) Detection of Staphylococcus aureus from Fish and Waste Water Sample Collected from Qarun Lake, Turkey. International Journal of Scientific Engineering and Research, 6, 366-372.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref16">
    <label>16</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Argudín, M.Á., Mendoza, M.C. and Rodicio, M.R. (2010) Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins, 2, 1751-1773. &gt;https://doi.org/10.3390/toxins2071751
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref17">
    <label>17</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Obaidat, M.M., Bani Salman, A.E. and Lafi, S.Q. (2015) Prevalence of Staphylococcus aureus in Imported Fish and Correlations between Antibiotic Resistance and Enterotoxigenicity. Journal of Food Protection, 78, 1999-2005. &gt;https://doi.org/10.4315/0362-028x.jfp-15-104
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref18">
    <label>18</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     FCTA (2024) National Population Commission of Nigeria. National Bureau of Statistics. &gt;https://nationalpopulation.gov.ng &gt;https://nigerianstat.gov.ng 
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref19">
    <label>19</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Cowan, S.T. and Steel, K.J. (2003) Cowan and Steel’s Manual for the Identification of Medical Bacteria. 3rd Edition, G.I. Barrow.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref20">
    <label>20</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Cheesbrough, M. (2009) District Laboratory Practice in Tropical Countries, Part 2 Cambridge Low-Price Edition.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref21">
    <label>21</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bauer, A.W., Kirby, W.M.M., Sherris, J.C. and Turck, M. (1966) Antibiotic Susceptibility Testing by a Standardized Single Disk Method. American Journal of Clinical Pathology, 45, 493-496. &gt;https://doi.org/10.1093/ajcp/45.4_ts.493
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref22">
    <label>22</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Clinical and Laboratory Standards Institute (2020) Preference Standard for Anti-Microbial Susceptibility Testing. CLSI Supplement M100, 30th Edition, Clinical and Laboratory Standards Institute.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref23">
    <label>23</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lambert, L.H., Cox, T., Mitchell, K., Rossello-Mora, R.A., Del Cueto, C., Dodge, D.E., et al. (1998) Staphylococcus succinus Sp. Nov., Isolated from Dominican Amber. International Journal of Systematic Bacteriology, 48, 511-518. &gt;https://doi.org/10.1099/00207713-48-2-511
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref24">
    <label>24</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Furtula, V., Jackson, C., Farrell, E., Barrett, J., Hiott, L. and Chambers, P. (2013) Antimicrobial Resistance in Enterococcus Spp. Isolated from Environmental Samples in an Area of Intensive Poultry Production. International Journal of Environmental Research and Public Health, 10, 1020-1036. &gt;https://doi.org/10.3390/ijerph10031020
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref25">
    <label>25</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Akbar, A., Sadiq, M.B., Ali, I., Muhammad, N., Rehman, Z., Khan, M.N., et al. (2019) Synthesis and Antimicrobial Activity of Zinc Oxide Nanoparticles against Foodborne Pathogens Salmonella Typhimurium and Staphylococcus aureus. Biocatalysis and Agricultural Biotechnology, 17, 36-42. &gt;https://doi.org/10.1016/j.bcab.2018.11.005
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref26">
    <label>26</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Angelillo, I.F., Viggiani, N.M.A., Rizzo, L. and Bianco, A. (2000) Food Handlers and Foodborne Diseases: Knowledge, Attitudes, and Reported Behavior in Italy. Journal of Food Protection, 63, 381-385. &gt;https://doi.org/10.4315/0362-028x-63.3.381
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref27">
    <label>27</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Tavakoli, H., Soltani, M. and Bahonar, A. (2012) Isolation of Some Human Pathogens from Fresh and Smoked Shad. Iranian Journal of Fisheries Science, 11, 424-429.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref28">
    <label>28</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bujjamma, P. and Padmavathi, P. (2015) Prevalence of Staphylococcus aureus in Fish Samples of Local Domestic Fish Market. International Journal of Microbiology and Applied Sciences, 4, 427-433.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref29">
    <label>29</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mohammed, U.H., Bala, A.M. and Bako, M. (2020) Phenotypic and Molecular Detection of Methicillin-Resistant Staphylococcus aureus (MRSA) Isolated from Clarias gariepinus (Burchfiel, 1822) and Oreochromis niloticus (Linneaus, 1758) in Maiduguri. International Journal of Fisheries and Aquatic Studies, 8, 365-372.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref30">
    <label>30</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rashid, N., Shafee, M., Iqbal, S., Samad, A., Khan, S.A., Hasni, M.S., et al. (2023) Enterotoxigenic Methicillin Resistant Staphylococcus aureus Contamination in Salted Fish from Gwadar Balochistan. Brazilian Journal of Biology, 83, e247701. &gt;https://doi.org/10.1590/1519-6984.247701
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref31">
    <label>31</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Matouke, M.M. and Nour, K. (2019) Characterization of Antibiotic-Resistant Staphylococcus aureus from Gills and Gastro-Intestinal Tracts of Catfish (Clarias gariepinus), and Water Samples from Jabi Lake, Abuja, Nigeria. African Journal of Clinical and Experimental Microbiology, 20, 231-236. &gt;https://doi.org/10.4314/ajcem.v20i3.8
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref32">
    <label>32</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Agu, K.C., Ukponmwa, I.O., Orji, M.U., Awah, N.S., Anaso, C.I. and Udemezue, O.I. (2013) Prevalence of Pathogenic Bacteria in Smoked Fish Sold in Major Retailed Market in Benin. International Journal of Applied Science and Engineering, 1, 1-4.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref33">
    <label>33</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Okpo, N.O. (2017) Molecular Characterization and Antibiogram of Staphylococcus aureus and Salmonella spp. Isolated from Milk and Milk Products in Parts o Kaduna State, Nigeria. Ph.D. Thesis, Ahmadu Bello University Zaria.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref34">
    <label>34</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Godwin, E., Okolocha, E.C., Annette, I., Enem, S.I. and Okoli, C.E. (2022) Prevalence and Characterization of Staphylococci from Dried Crayfish in Selected Markets in FCT, Abuja, Nigeria. EC Veterinary Science, 7, 30-41.
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref35">
    <label>35</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Grema, H.A., Geidam, Y.A., Gadzama, G.B., Ameh, J.A. and Suleiman, A. (2015) Methicillin Resistant Staphylococcus aureus (MRSA): A Review. Advances in Animal and Veterinary Sciences, 3, 79-98. &gt;https://doi.org/10.14737/journal.aavs/2015/3.2.79.98
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref36">
    <label>36</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rashid, N., Shafee, M., Iqbal, S., Samad, A., Khan, S.A., Hasni, M.S., et al. (2023) Enterotoxigenic Methicillin Resistant Staphylococcus aureus Contamination in Salted Fish from Gwadar Balochistan. Brazilian Journal of Biology, 83, e247701. &gt;https://doi.org/10.1590/1519-6984.247701
    </mixed-citation>
   </ref>
   <ref id="scirp.143597-ref37">
    <label>37</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Peacock, S.J., Moore, C.E., Justice, A., Kantzanou, M., Story, L., Mackie, K., et al. (2002) Virulent Combinations of Adhesin and Toxin Genes in Natural Populations of Staphylococcus aureus. Infection and Immunity, 70, 4987-4996. &gt;https://doi.org/10.1128/iai.70.9.4987-4996.2002
    </mixed-citation>
   </ref>
  </ref-list>
 </back>
</article>