<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article">
 <front>
  <journal-meta>
   <journal-id journal-id-type="publisher-id">
    jtr
   </journal-id>
   <journal-title-group>
    <journal-title>
     Journal of Tuberculosis Research
    </journal-title>
   </journal-title-group>
   <issn pub-type="epub">
    2329-843X
   </issn>
   <issn publication-format="print">
    2329-8448
   </issn>
   <publisher>
    <publisher-name>
     Scientific Research Publishing
    </publisher-name>
   </publisher>
  </journal-meta>
  <article-meta>
   <article-id pub-id-type="doi">
    10.4236/jtr.2024.124016
   </article-id>
   <article-id pub-id-type="publisher-id">
    jtr-138006
   </article-id>
   <article-categories>
    <subj-group subj-group-type="heading">
     <subject>
      Articles
     </subject>
    </subj-group>
    <subj-group subj-group-type="Discipline-v2">
     <subject>
      Biomedical 
     </subject>
     <subject>
       Life Sciences, Medicine 
     </subject>
     <subject>
       Healthcare
     </subject>
    </subj-group>
   </article-categories>
   <title-group>
    Prevalence of Pneumocystis jirovecii in Smear Negative Sputum Samples at the Coast General Teaching and Refferral Hospital in Kenya
   </title-group>
   <contrib-group>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Anne
      </surname>
      <given-names>
       Saitoti
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Fred
      </surname>
      <given-names>
       Wamunyokoli
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Christine
      </surname>
      <given-names>
       Bii
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref> 
     <xref ref-type="aff" rid="aff3"> 
      <sup>3</sup>
     </xref>
    </contrib>
   </contrib-group> 
   <aff id="aff1">
    <addr-line>
     aDepartment of Tropical Medicine and Infectious Disease, Jomo Kenyatta University of Agriculture and Technology, Juja, Kenya
    </addr-line> 
   </aff> 
   <aff id="aff2">
    <addr-line>
     aMycology Division, Center for Microbiology Research, Kenya Medical Research Institute, Nairobi, Kenya
    </addr-line> 
   </aff> 
   <aff id="aff3">
    <addr-line>
     aKenya Medical Research Institute, KEMRI, Nairobi, Kenya
    </addr-line> 
   </aff> 
   <pub-date pub-type="epub">
    <day>
     30
    </day> 
    <month>
     10
    </month>
    <year>
     2024
    </year>
   </pub-date> 
   <volume>
    12
   </volume> 
   <issue>
    04
   </issue>
   <fpage>
    215
   </fpage>
   <lpage>
    231
   </lpage>
   <history>
    <date date-type="received">
     <day>
      19,
     </day>
     <month>
      February
     </month>
     <year>
      2024
     </year>
    </date>
    <date date-type="published">
     <day>
      6,
     </day>
     <month>
      February
     </month>
     <year>
      2024
     </year> 
    </date> 
    <date date-type="accepted">
     <day>
      6,
     </day>
     <month>
      December
     </month>
     <year>
      2024
     </year> 
    </date>
   </history>
   <permissions>
    <copyright-statement>
     © Copyright 2014 by authors and Scientific Research Publishing Inc. 
    </copyright-statement>
    <copyright-year>
     2014
    </copyright-year>
    <license>
     <license-p>
      This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/
     </license-p>
    </license>
   </permissions>
   <abstract>
    Pneumcystis jirovecii is a pathogen that causes Pneumocystis pneumonia (PCP), an infection in (HIV/ADS) and other immunocompromised patients. The rare reports of P. jirovecii pneumonia in sub-Saharan Africa are controversial due to the high HIV/AIDS seropositivity. The study determined the significance of P. jirovecii in TB smear negative retreatment patients at the Coast General Teaching Referral Hospital-Mombasa. Sputum samples were subjected to toluidine blue O(TBO) stain for microscopy and polymerase chain reaction (PCR). A total of 100 TB smear negative participants were enrolled in the study and expectorated sputum was collected. Out of the 100 patients, 63 men and 37 women. Patients aged 31 to 53 made up 62% of the patients. The patients aged 31 to 53 made up 75% of the patients (Min = 11y, Max = 85y). The median age of the patients was 42 years. Nested PCR has a prevalence of 41% (41 instances). TBO staining has a prevalence of 29% (29 instances). Detecting an additional 13 more patients than toluidine O staining technique. The sensitivity of toluidine blue O staining was 33.82%, which indicates that it correctly identified 33.82% of true positive cases compared to PCR. The specificity of toluidine blue O staining was 97.82%, indicating that it had a high ability to correctly identify true negative cases compared to PCR, suggesting that it was good at ruling out non-P. jirovecii cases. The study confirms that P. jirovecii is as a significant cause of persistent symptoms in TB patients that could be responsible for persistent symptoms despite TB treatment. We recommend fungal diagnostics in such patients before retreatment.
   </abstract>
   <kwd-group> 
    <kwd>
     Pneumocystis jirovecii
    </kwd> 
    <kwd>
      Nested PCR
    </kwd> 
    <kwd>
      Pulmonary tuberculosis
    </kwd> 
    <kwd>
      Smear Negative
    </kwd>
   </kwd-group>
  </article-meta>
 </front>
 <body>
  <sec id="s1">
   <title>1. Introduction</title>
   <p>Pneumocystis jirovecii is an extracellular organism that causes pneumocystis pneumonia. It is usually found colonizing the alveolar spaces of the lungs although extra pulmonary manifestations have been reported.</p>
   <p>Currently, the documented frequency of pneumocystis infection is increasing in Africa, with PCP detection in up to 80% of infants with pneumonia <xref ref-type="bibr" rid="scirp.138006-1">
     [1]
    </xref>.</p>
   <p>
    <xref ref-type="bibr" rid="scirp.138006-"></xref>A limited number of epidemiological studies have evaluated the significance of PCP in developing countries compared to developed countries where the epidemiology and clinical picture of PCP is clearly well defined and documented <xref ref-type="bibr" rid="scirp.138006-2">
     [2]
    </xref>. Recent reports indicate an increased rate of PCP in Africa, Asia, and South America <xref ref-type="bibr" rid="scirp.138006-3">
     [3]
    </xref>. Mortality rates of 30% - 50% have been documented in several studies <xref ref-type="bibr" rid="scirp.138006-4">
     [4]
    </xref>. In persons with immunosuppressive underlying conditions, PCP carries worse prognosis and this has not changed in the past 20 years. In tuberculosis (TB) endemic parts of the world, substantial numbers of patients with pulmonary symptoms are managed as “smear negative TB patients” or treated for TB without a definitive diagnostic criterion <xref ref-type="bibr" rid="scirp.138006-5">
     [5]
    </xref> <xref ref-type="bibr" rid="scirp.138006-6">
     [6]
    </xref>. In sub-Saharan Africa, tuberculosis could be a common co-infection in persons with PCP <xref ref-type="bibr" rid="scirp.138006-7">
     [7]
    </xref>. However, the lack of access to routine PCP diagnosis is the limiting factor. The study sought to determine prevalence of Pneumocystis jirovecii Pneumonia (PCP) and compare specificity and sensitivity of Toluidine staining method and Polymerase Chain Reaction (PCR) in sputum of TB smear negative and retreatment patients at Coast General Hospital (CGH).</p>
  </sec><sec id="s2">
   <title>2. Materials and Methods</title>
   <sec id="s2_1">
    <title>2.1. Study Design</title>
    <p>The study was a cross-sectional laboratory study. Patients were recruited at the Coast General Hospital TB clinic during the study period. The laboratory procedures were done at the Mycology Division, Center for Microbiology Research, KEMRI.</p>
   </sec>
   <sec id="s2_2">
    <title>2.2. Study Area</title>
    <p>The study was carried out at the Coast General Hospital as it’s the main epicenter of most patients with TB referral cases in the coast region that captures a large population of the Coast and Mombasa County.</p>
   </sec>
   <sec id="s2_3">
    <title>2.3. Study Population</title>
    <p>The patients confirmed to be TB smear negative with pulmonary tuberculosis symptoms were enrolled in the study. All consenting patients above 18 that had been diagnosed as smear negative TB and were or not being retreated for TB and attending the TB clinic at the Coast General Hospital were enrolled.</p>
   </sec>
   <sec id="s2_4">
    <title>2.4. Sample Size Determination</title>
    <p>The sample size was determined based on the 37% prevalence of PCP in an urban hospital study carried in Nairobi. Using Fischer’s exact test with 95% confidence interval;</p>
    <p>
     <math display="inline" xmlns="http://www.w3.org/1998/Math/MathML"> <mrow> 
       <mi>
         n 
       </mi> 
       <mo>
         = 
       </mo> 
       <mfrac> 
        <mrow> 
         <msup> 
          <mtext>
            z 
          </mtext> 
          <mn>
            2 
          </mn> 
         </msup> 
         <mi>
           ρ 
         </mi> 
         <mrow> 
          <mo>
            ( 
          </mo> 
          <mrow> 
           <mn>
             1 
           </mn> 
           <mo>
             − 
           </mo> 
           <mi>
             ρ 
           </mi> 
          </mrow> 
          <mo>
            ) 
          </mo> 
         </mrow> 
        </mrow> 
        <mrow> 
         <msup> 
          <mi>
            δ 
          </mi> 
          <mn>
            2 
          </mn> 
         </msup> 
        </mrow> 
       </mfrac> 
      </mrow> 
     </math></p>
    <p>where: n = Sample size, ᴢ = 1.96.</p>
    <p>p = Prevalence of PCP (37%), d = Absolute precision (0.05). Therefore</p>
    <p>
     <math display="inline" xmlns="http://www.w3.org/1998/Math/MathML"> <mrow> 
       <mi>
         N 
       </mi> 
       <mo>
         = 
       </mo> 
       <mfrac> 
        <mrow> 
         <msup> 
          <mrow> 
           <mn>
             1.96 
           </mn> 
          </mrow> 
          <mn>
            2 
          </mn> 
         </msup> 
         <mo>
           × 
         </mo> 
         <mn>
           0.1 
         </mn> 
         <mrow> 
          <mo>
            ( 
          </mo> 
          <mrow> 
           <mn>
             1 
           </mn> 
           <mo>
             − 
           </mo> 
           <mn>
             0.37 
           </mn> 
          </mrow> 
          <mo>
            ) 
          </mo> 
         </mrow> 
        </mrow> 
        <mrow> 
         <msup> 
          <mrow> 
           <mn>
             0.05 
           </mn> 
          </mrow> 
          <mn>
            2 
          </mn> 
         </msup> 
        </mrow> 
       </mfrac> 
       <mo>
         = 
       </mo> 
       <mn>
         96.8 
       </mn> 
      </mrow> 
     </math></p>
    <p>We therefore recruited 100 patients from the study site.</p>
   </sec>
   <sec id="s2_5">
    <title>2.5. Sampling</title>
    <p>A total of 100 sputum samples were collected. And the quality of the sputum specimens was quantitatively accessed based on the number of squamous epithelial cells. Salivary specimens were discarded.</p>
   </sec>
   <sec id="s2_6">
    <title>2.6. Toluidine Blue O Staining</title>
    <p>The conventional staining method using TBO was used as the gold standard method for diagnosis of pneumocystis <xref ref-type="bibr" rid="scirp.138006-8">
      [8]
     </xref>, the sensitivity and specificity was compared with nested PCR.</p>
    <p>Sputum smears were made, air dried, placed in a sulphating agent, and then drained in excess cold water. The slide smears were then stained with toluidine blue o and rinsed with 95% ethanol followed by absolute ethanol and then xylene. The smears were air dried and examined at ×40 and ×100 for the presence of Pneumocystis jirovecii cysts or oocysts. A positive confirmation was taken if at least one cluster with characteristic cyst was detected defined as equal to or ≥ . The smears were examined for presence of oocysts and the samples with P. jirovecii scored as positive.</p>
   </sec>
   <sec id="s2_7">
    <title>2.7. PCR Detection of P. jirovecii</title>
    <p>Fungal DNA was extracted from the sputum samples using the MycXtra fungal DNA extraction kit (Myconostica Ltd., Manchester, United Kingdom) according to the manufacturer’s instructions.</p>
    <p>Sputum samples were subjected to DNA extraction in accordance with the manufacturer’s instructions. PCR was performed according to Wakefield <xref ref-type="bibr" rid="scirp.138006-9">
      [9]
     </xref>.</p>
    <p>The amplification was done using PCR primers; pAZ102E (GATGGCTGTT TCCAAGCCCA) and pAZ102H (GTGTACGTTGCAAAGTACTC), derived from the mitochondrion large subunit rRNA (mtLSUrRNA) gene.</p>
    <p>The selected primers used avoid 5 P. jirovecii polymorphisms in the mtLSUrRNA and are not affected by P. jirovecii heterogeneity while avoiding amplification of human DNA <xref ref-type="bibr" rid="scirp.138006-10">
      [10]
     </xref> <xref ref-type="bibr" rid="scirp.138006-11">
      [11]
     </xref>.</p>
    <p>The PCR conditions were; Denaturing, annealing and extension times were run at 1 min each, at 94˚C, 55˚C and 72˚C, respectively. Amplification was for 10 and 30 cycles respectively. PCR used primer set which were repeated the latter conditions for 35 cycles using the product of the 1<sup>st</sup> PCR round as the template. The resulting amplified product of 346 bp fragment was separated on 3% gel electrophoresis for 35 minutes at 100 Volts and observed under UV Trans illuminator device. Each run of PCR was performed with a positive and negative control so as to check performance of the test.</p>
    <p>The primers described above were used to amplify a 346 bp segment of a specific region at the Mitochondrial Large subunit gene of P. jirovecii. Amplification was done by adding 1 µl extracted DNA, 21 µl of nuclease free water, 0.5 µl of forward primer and 0.5 µl of reverse primer into a master mix which were lyophilized with 20 µl reaction volume containing a reaction buffer, MgCl<sub>2</sub>, DNTPs and a DNA polymerase. This mixture made a total volume of 25 µl. The 2 µl was for pipetting errors. Nested PCR was performed in the first round of amplification. Denaturing, annealing and extension times were run at 1 min each, at 94˚C, 55˚C and 72˚C, respectively for 10 cycles and repeated the latter conditions for 30 cycles using the product from the 1<sup>st</sup> PCR round as the template using the same primers as the first round.</p>
    <p>The first gel was for the positive microscopic slides that clearly had the cysts. The separation on gel agarose was done for 45 minutes and the gel was prestained with ethidium bromide.</p>
   </sec>
   <sec id="s2_8">
    <title>2.8. Statistical Analysis Plan</title>
    <p>Categorical data were tabulated and summarized using frequencies and percentages. Data was presented using bar charts and tables. To determine the association between outcome and predictor variables, a bivariate logistic regression model was fitted. The bivariate regression model was implemented in R statistical software (R Core Team, 2022).</p>
    <p>The strength of association between P. jirovecii status (by nested PCR test) and demographic characteristics and risk factors (fever, night sweat and euroqol) was reported using unadjusted odds ratios, 95% confidence intervals and p-values.</p>
    <p>Any predictor variable that would have a p-value of less than 0.2 in the bivariate model was to be entered into a multivariate regression model. A p-value of less than 0.05 was considered significant.</p>
   </sec>
  </sec><sec id="s3">
   <title>3. Results</title>
   <sec id="s3_1">
    <title>3.1. Microscopy Results</title>
    <p>
     <xref ref-type="bibr" rid="scirp.138006-"></xref>Toluidine blue O stains was positive on 11% of the samples with clear stained cyst forms. Results with the TBO are shown in <xref ref-type="fig" rid="fig1">
      Figure 1
     </xref>.</p>
    <p>The cysts were observed in clusters without budding. Very little background material is seen as the sulfation reagent digests away most of the background material but does not affect either fungal elements or P. jirovecii.</p>
   </sec>
   <sec id="s3_2">
    <title>3.2. Molecular Results</title>
    <p>The gel <xref ref-type="fig" rid="fig2">
      Figure 2
     </xref> was for the positive microscopic slides that clearly had the cysts and several trophozoites. The separation on gel agarose was done for 45 minutes and the electrophoresis gel was pre-stained with ethidium bromide. The above conditions were followed for the conditions and the gels pre-stained with ethidium bromide and viewed under the Trans illuminator. In all the gel runs the 100 bp ladder was used followed by the negative control and a positive control. A total of 41 samples out of the total 100 expressed the 346-band fragment on the</p>
    <fig id="fig1" position="float">
     <label>Figure 1</label>
     <caption>
      <title>Figure 1. Toluidine blue O Stain of P. jirovecii ×100 magnifications In Figures 1, 2 the cysts approximately 5 µm in diameter are lavender with a grainy appearance, with a spherical appearance and the cell wall of the cysts are not stained. The cyst outline is distinct, and the internal region stains uniformly <xref ref-type="bibr" rid="scirp.138006-12">
        [12]
       </xref>.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/1130527-rId18.jpeg?20250806042323" />
    </fig>
    <fig id="fig2" position="float">
     <label>Figure 2</label>
     <caption>
      <title>Figure 2. A gel representation of the positive P. jirovecii samples showing the 346 Bp gene.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/1130527-rId19.jpeg?20250806042323" />
    </fig>
    <p>agarose gel (<xref ref-type="fig" rid="fig2">
      Figure 2
     </xref>).</p>
   </sec>
   <sec id="s3_3">
    <title>3.3. Social Demographic Data</title>
    <p>Out of the 100 patients, 63 men and 37 women. Patients aged 31 to 53 made up 62% of the patients (Min = 11y, Max = 85y). The median age 42 years. 14 females and 27 males had the Pneumocystis Jirovecii Pneumonia. Majority of patients—35.8%—used charcoal (n = 29); 17.3% charcoal + firewood, kerosene, or gas (n = 14). 17.3% using kerosene (n = 14), 16% firewood (n = 13), and 13.6% gas (n = 11) for cooking (<xref ref-type="table" rid="table1">
      Table 1
     </xref>).</p>
    <p>Employed were 84 (84%) and 16 (16%) unemployed among the population studied. Evidence of fungal spores’ exposure through leaking or mouldy houses was reported in 28% and 26% of the population while only 9% ever smoked or were passive smokers as shown in <xref ref-type="table" rid="table1">
      Table 1
     </xref>.</p>
    <p>
     <xref ref-type="bibr" rid="scirp.138006-"></xref>Table 1. Socio-demographic characteristics of patients.</p>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td rowspan="2" class="custom-top-td aleft" width="38.48%"><p style="text-align:left">Variable</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="61.52%" colspan="3"><p style="text-align:center">P. jirovecii status</p></td> 
     </tr> 
     <tr> 
      <td class="custom-bottom-td custom-top-td acenter" width="20.50%"><p style="text-align:center">Positive(N = 41)</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="20.50%"><p style="text-align:center">Negative(N = 59)</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="20.52%"><p style="text-align:center">Overall(N = 100)</p></td> 
     </tr> 
     <tr> 
      <td class="custom-top-td aleft" width="38.48%"><p style="text-align:left">Age in years</p></td> 
      <td class="custom-top-td acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="custom-top-td acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="custom-top-td acenter" width="20.52%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">10 - 19</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">6 (14.6%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">5 (8.5%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">11 (11.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">20 - 29</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">5 (12.2%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">5 (8.5%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">10 (10.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">30 - 39</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">10 (24.4%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">9 (15.3%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">19 (19.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">40 - 49</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">6 (14.6%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">17 (28.8%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">23 (23.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">50 - 59</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">7 (17.1%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">13 (22.0%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">20 (20.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">60+</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">7 (17.1%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">10 (16.9%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">17 (17.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Gender</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Female</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">14 (34.1%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">23 (39.0%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">37 (37.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Male</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">27 (65.9%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">36 (61.0%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">63 (63.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Employment</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Employed</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">35 (85.4%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">49 (83.1%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">84 (84.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Unemployed</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">6 (14.6%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">10 (16.9%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">16 (16.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">House Wall type</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Brick wall</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">21 (51.2%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">33 (55.9%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">54 (54.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Concrete</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">8 (19.5%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">10 (16.9%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">18 (18.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Makuti/Thatched/Wood</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">2 (4.9%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">2 (3.4%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">4 (4.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Mud</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">10 (24.4%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">14 (23.7%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">24 (24.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Floods</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">No</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">29 (70.7%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">45 (76.3%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">74 (74.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Yes</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">12 (29.3%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">14 (23.7%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">26 (26.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">TB Treatment</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Currently on Treatment</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">6 (14.6%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">13 (22.0%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">19 (19.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Not on Treatment</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">35 (85.4%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">46 (78.0%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">81 (81.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Fungal Growth</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">No</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">31 (75.6%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">41 (69.5%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">72 (72.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Yes</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">10 (24.4%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">18 (30.5%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">28 (28.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Fuel</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Charcoal</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">16 (39.0%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">20 (33.9%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">36 (36.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Charcoal/Firewood</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">1 (2.4%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">1 (1.7%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">2 (2.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Charcoal/Gas</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">6 (14.6%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">6 (10.2%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">12 (12.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Charcoal/Kerosene</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">1 (2.4%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">3 (5.1%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">4 (4.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Firewood</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">5 (12.2%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">10 (16.9%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">15 (15.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Gas</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">6 (14.6%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">7 (11.9%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">13 (13.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Kerosene</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">6 (14.6%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">12 (20.3%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">18 (18.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Smoking Habit</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">No</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">39 (95.1%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">52 (88.1%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">91 (91.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="38.48%"><p style="text-align:left">Yes</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">2 (4.9%)</p></td> 
      <td class="acenter" width="20.50%"><p style="text-align:center">7 (11.9%)</p></td> 
      <td class="acenter" width="20.52%"><p style="text-align:center">9 (9.0%)</p></td> 
     </tr> 
    </table>
    <p>Productive cough 87%, night sweat 71.7%, fever and chest pains 59% were most common in pneumocystis jirovecii positive individuals. Bloody cough was present in only 19.6% of the individuals while shortness of breath and fatigue were present in 54.3% and 43.5% respectively. 19% were new cases and 81% were not on any treatment despite meeting PTB clinical criteria (<xref ref-type="table" rid="table2">
      Table 2
     </xref>).</p>
    <p>
     <xref ref-type="bibr" rid="scirp.138006-"></xref>Table 2. Clinical Characteristics of patients.</p>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td rowspan="2" class="aleft" width="26.83%"><p style="text-align:left">Variable</p></td> 
      <td class="custom-bottom-td acenter" width="73.17%" colspan="3"><p style="text-align:center">P. jirovecii status</p></td> 
     </tr> 
     <tr> 
      <td class="custom-bottom-td custom-top-td acenter" width="24.39%"><p style="text-align:center">Negative(N = 59)</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="24.39%"><p style="text-align:center">Positive(N = 41)</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="24.39%"><p style="text-align:center">Overall(N = 100)</p></td> 
     </tr> 
     <tr> 
      <td class="custom-top-td aleft" width="26.83%"><p style="text-align:left">Fever</p></td> 
      <td class="custom-top-td acenter" width="24.39%"><p style="text-align:center"></p></td> 
      <td class="custom-top-td acenter" width="24.39%"><p style="text-align:center"></p></td> 
      <td class="custom-top-td acenter" width="24.39%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="26.83%"><p style="text-align:left">No</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">27 (45.8%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">14 (34.1%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">41 (41.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="26.83%"><p style="text-align:left">Yes</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">32 (54.2%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">27 (65.9%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">59 (59.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="26.83%"><p style="text-align:left">Night Sweat</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="26.83%"><p style="text-align:left">No</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">21 (35.6%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">18 (43.9%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">39 (39.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="26.83%"><p style="text-align:left">Yes</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">38 (64.4%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">23 (56.1%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">61 (61.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="26.83%"><p style="text-align:left">Euroqol</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="26.83%"><p style="text-align:left">No</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">15 (25.4%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">11 (26.8%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">26 (26.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="26.83%"><p style="text-align:left">Yes</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">44 (74.6%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">30 (73.2%)</p></td> 
      <td class="acenter" width="24.39%"><p style="text-align:center">74 (74.0%)</p></td> 
     </tr> 
    </table>
    <p>
     <xref ref-type="bibr" rid="scirp.138006-"></xref>Table 3. Comparison of socio-demographics P. jirovecii Pneumonia positive patients who were Tuberculosis smear negative and being retreated at the Coast General Hospital.</p>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td class="custom-bottom-td custom-top-td aleft" width="41.18%"><p style="text-align:left">Variable</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="23.26%"><p style="text-align:center">Unadjusted OR</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="17.58%"><p style="text-align:center">95% CI</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="17.98%"><p style="text-align:center">p-value</p></td> 
     </tr> 
     <tr> 
      <td class="custom-top-td aleft" width="41.18%"><p style="text-align:left">Age in years</p></td> 
      <td class="custom-top-td acenter" width="23.26%"><p style="text-align:center"></p></td> 
      <td class="custom-top-td acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="custom-top-td acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">10 - 19</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.71</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.37, 8.29)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.490</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">20 - 29</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.43</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.29, 7.12)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.656</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">30 - 39</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.59</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.43, 6.13)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.493</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">40 - 49</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">0.50</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.13, 1.92)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.317</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">50 - 59</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">0.77</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.20, 2.94)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.700</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">60+</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">Ref</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Gender</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Female</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">Ref</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Male</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.23</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.54, 2.87)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.622</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Employment</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Employed</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.19</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.40, 3.78)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.756</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Unemployed</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">Ref</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">House Wall type</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Brick wall</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">Ref</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Concrete</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.26</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.42, 3.70)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.678</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Makuti/Thatched/Wood</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.57</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.18, 13.93)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.663</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Mud</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.12</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.41, 2.98)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.817</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Floods</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">No</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">Ref</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Yes</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.33</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.53, 3.28)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.535</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">TB Treatment</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Currently on Treatment</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">0.61</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.20, 1.70)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.356</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Not on Treatment</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">Ref</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Fungal Growth</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">No</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">Ref</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Yes</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">0.73</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.29, 1.79)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.503</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Fuel</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Charcoal</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">Ref</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Charcoal/Firewood</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.25</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.05, 33.29)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.878</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Charcoal/Gas</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.25</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.33, 4.73)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.738</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Charcoal/Kerosene</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">0.42</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.02, 3.61)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.467</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Firewood</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">0.63</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.17, 2.14)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.464</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Gas</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">1.07</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.29, 3.86)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.915</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Kerosene</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">0.63</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.18, 1.99)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.435</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Smoking Habit</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">No</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">Ref</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center"></p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="41.18%"><p style="text-align:left">Yes</p></td> 
      <td class="acenter" width="23.26%"><p style="text-align:center">0.38</p></td> 
      <td class="acenter" width="17.58%"><p style="text-align:center">(0.05, 1.68)</p></td> 
      <td class="acenter" width="17.98%"><p style="text-align:center">0.245</p></td> 
     </tr> 
    </table>
    <table-wrap id="table1">
     <label>
      <xref ref-type="table" rid="table1">
       Table 1
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.138006-"></xref>Table 4. Risk factors associated with P. jirovecii Pneumonia.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td aleft" width="34.26%"><p style="text-align:left">Variable</p></td> 
       <td class="custom-bottom-td acenter" width="21.90%"><p style="text-align:center">Unadjusted OR</p></td> 
       <td class="custom-bottom-td acenter" width="21.92%"><p style="text-align:center">95% CI</p></td> 
       <td class="custom-bottom-td acenter" width="21.92%"><p style="text-align:center">p-value</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td aleft" width="34.26%"><p style="text-align:left">Fever</p></td> 
       <td class="custom-top-td acenter" width="21.90%"><p style="text-align:center"></p></td> 
       <td class="custom-top-td acenter" width="21.92%"><p style="text-align:center"></p></td> 
       <td class="custom-top-td acenter" width="21.92%"><p style="text-align:center"></p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="34.26%"><p style="text-align:left">No</p></td> 
       <td class="acenter" width="21.90%"><p style="text-align:center">Ref</p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center"></p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center"></p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="34.26%"><p style="text-align:left">Yes</p></td> 
       <td class="acenter" width="21.90%"><p style="text-align:center">1.63</p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center">(0.72, 3.77)</p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center">0.2468</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="34.26%"><p style="text-align:left">Night Sweat</p></td> 
       <td class="acenter" width="21.90%"><p style="text-align:center"></p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center"></p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center"></p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="34.26%"><p style="text-align:left">No</p></td> 
       <td class="acenter" width="21.90%"><p style="text-align:center">Ref</p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center"></p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center"></p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="34.26%"><p style="text-align:left">Yes</p></td> 
       <td class="acenter" width="21.90%"><p style="text-align:center">0.71</p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center">(0.31, 1.60)</p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center">0.403</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="34.26%"><p style="text-align:left">Euroqol</p></td> 
       <td class="acenter" width="21.90%"><p style="text-align:center"></p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center"></p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center"></p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="34.26%"><p style="text-align:left">No</p></td> 
       <td class="acenter" width="21.90%"><p style="text-align:center">Ref</p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center"></p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center"></p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="34.26%"><p style="text-align:left">Yes</p></td> 
       <td class="acenter" width="21.90%"><p style="text-align:center">0.931</p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center">(0.38, 2.34)</p></td> 
       <td class="acenter" width="21.92%"><p style="text-align:center">0.875</p></td> 
      </tr> 
     </table>
    </table-wrap>
    <p>
     <xref ref-type="bibr" rid="scirp.138006-"></xref>Table 5. Prevalence of P. jirovecii by Toluidine blue O and Nested PCR tests.</p>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td class="custom-bottom-td aleft" width="42.69%"><p style="text-align:left">Type of Test</p></td> 
      <td class="custom-bottom-td acenter" width="57.31%"><p style="text-align:center">Prevalence P. jirovecii (N = 100)</p></td> 
     </tr> 
     <tr> 
      <td class="custom-top-td aleft" width="42.69%"><p style="text-align:left">Toluidine stain</p></td> 
      <td class="custom-top-td acenter" width="57.31%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="42.69%"><p style="text-align:left">Positive</p></td> 
      <td class="acenter" width="57.31%"><p style="text-align:center">29 (29.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="42.69%"><p style="text-align:left">Negative</p></td> 
      <td class="acenter" width="57.31%"><p style="text-align:center">71 (71.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="42.69%"><p style="text-align:left">Nested PCR</p></td> 
      <td class="acenter" width="57.31%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="42.69%"><p style="text-align:left">Positive</p></td> 
      <td class="acenter" width="57.31%"><p style="text-align:center">41 (41.0%)</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="42.69%"><p style="text-align:left">Negative</p></td> 
      <td class="acenter" width="57.31%"><p style="text-align:center">59 (59.0%)</p></td> 
     </tr> 
    </table>
    <p>
     <xref ref-type="bibr" rid="scirp.138006-"></xref>Table 6. Detection of P. jirovecii by Toluidine blue O and Nested PCR.</p>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td rowspan="2" class="acenter" width="37.25%"><p style="text-align:center"></p></td> 
      <td class="custom-bottom-td acenter" width="46.05%" colspan="2"><p style="text-align:center">Nested PCR</p></td> 
      <td rowspan="2" class="acenter" width="16.70%"><p style="text-align:center">Total</p></td> 
     </tr> 
     <tr> 
      <td class="custom-bottom-td custom-top-td acenter" width="22.13%"><p style="text-align:center">Positive</p></td> 
      <td class="custom-bottom-td custom-top-td acenter" width="23.92%"><p style="text-align:center">Negative</p></td> 
     </tr> 
     <tr> 
      <td class="custom-top-td aleft" width="37.25%"><p style="text-align:left">Toluidine stain</p></td> 
      <td class="custom-top-td acenter" width="22.13%"><p style="text-align:center"></p></td> 
      <td class="custom-top-td acenter" width="23.92%"><p style="text-align:center"></p></td> 
      <td class="custom-top-td acenter" width="16.70%"><p style="text-align:center"></p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="37.25%"><p style="text-align:left">Positive</p></td> 
      <td class="acenter" width="22.13%"><p style="text-align:center">28</p></td> 
      <td class="acenter" width="23.92%"><p style="text-align:center">1</p></td> 
      <td class="acenter" width="16.70%"><p style="text-align:center">29</p></td> 
     </tr> 
     <tr> 
      <td class="aleft" width="37.25%"><p style="text-align:left">Negative</p></td> 
      <td class="acenter" width="22.13%"><p style="text-align:center">13</p></td> 
      <td class="acenter" width="23.92%"><p style="text-align:center">58</p></td> 
      <td class="acenter" width="16.70%"><p style="text-align:center">71</p></td> 
     </tr> 
    </table>
    <p>
     <xref ref-type="bibr" rid="scirp.138006-"></xref>Table 7. Sensitivity and Specificity of Toluidine blue O as compared to Nested PCR.</p>
    <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
     <tr> 
      <td class="custom-bottom-td acenter" width="26.59%"><p style="text-align:center"></p></td> 
      <td class="custom-bottom-td acenter" width="24.33%"><p style="text-align:center">Point Estimate</p></td> 
      <td class="custom-bottom-td acenter" width="24.54%"><p style="text-align:center">Lower 95% C.I</p></td> 
      <td class="custom-bottom-td acenter" width="24.54%"><p style="text-align:center">Upper 95% C.I</p></td> 
     </tr> 
     <tr> 
      <td class="custom-top-td acenter" width="26.59%"><p style="text-align:center">Sensitivity</p></td> 
      <td class="custom-top-td acenter" width="24.33%"><p style="text-align:center">96.55%</p></td> 
      <td class="custom-top-td acenter" width="24.54%"><p style="text-align:center">82.82%</p></td> 
      <td class="custom-top-td acenter" width="24.54%"><p style="text-align:center">99.82</p></td> 
     </tr> 
     <tr> 
      <td class="acenter" width="26.59%"><p style="text-align:center">Specificity</p></td> 
      <td class="acenter" width="24.33%"><p style="text-align:center">81.69%</p></td> 
      <td class="acenter" width="24.54%"><p style="text-align:center">71.15</p></td> 
      <td class="acenter" width="24.54%"><p style="text-align:center">88.98</p></td> 
     </tr> 
    </table>
   </sec>
  </sec><sec id="s4">
   <title>4. Discussion</title>
   <p>Despite HAART medication PCP continues to be a deadly illness in AIDS patients. Previously, the prevalence of PCP among AIDS patients in Sub-Saharan Africa was unknown <xref ref-type="bibr" rid="scirp.138006-13">
     [13]
    </xref>. Recent data from Africa suggests an underreported opportunistic infection among AIDS patient. Recent research suggested that PCP may be more common in TB Patients with negative smears. The use of cotrimoxazole in HIV/AIDS patients may have impacted the prevalence of prevalence of PCP in Africa <xref ref-type="bibr" rid="scirp.138006-1">
     [1]
    </xref> <xref ref-type="bibr" rid="scirp.138006-12">
     [12]
    </xref> <xref ref-type="bibr" rid="scirp.138006-13">
     [13]
    </xref>.</p>
   <p>Out of the 100 patients, 63 men and 37 women. Patients aged 31 to 53 made up 62% of the patients (Min = 11y, Max = 85y). The median age 42 years. 14 females and 27 males had the Pneumocystis Jirovecii Pneumonia. Majority of patients—35.8%—used charcoal (n = 29); 17.3% charcoal + firewood, kerosene, or gas (n = 14). 17.3% using kerosene (n = 14), 16% firewood (n = 13), and 13.6% gas (n = 11) for cooking. 19 patients on TB treatment i.e. <xref ref-type="table" rid="table1">
     Table 1
    </xref>, <xref ref-type="table" rid="table2">
     Table 2
    </xref> and <xref ref-type="table" rid="table3">
     Table 3
    </xref>. Cases worsening or new cases TB treatment. 81 patients not currently on treatment but referred. Patients negative on TB diagnostic algorithms with PTB like symptoms are often considered TB relapse and retreated. As shown in <xref ref-type="table" rid="table4">
     Table 4
    </xref>.</p>
   <p>Toluidine blue 0 stains also apparently stained only the cyst forms. Results with the TBO are shown in <xref ref-type="fig" rid="fig1">
     Figure 1
    </xref>. The cysts are lavender in color but are somewhat grainy in appearance; much background material is also evident. In <xref ref-type="fig" rid="fig1">
     Figure 1
    </xref> structures thought to be P. jirovecii cysts have a spherical appearance and the outlines of individual cysts are quite faint. The cyst forms appear as lavender structures approximately 5 µm in diameter, and many are Pneumocystis organisms have a high tropism for the lung <xref ref-type="bibr" rid="scirp.138006-14">
     [14]
    </xref> <xref ref-type="bibr" rid="scirp.138006-15">
     [15]
    </xref>.</p>
   <p>The life cycle of Pneumocystis mainly consists of 3 major life cycle stages identified by morphology; the cyst, the pre-cystic and the trophic form stages. The trophic form is mono nuclear and thin walled and usually dominates during active infection and fills the alveoli space and is variable in length 1 to 8 µm long with multiple pseudo hyphal structures which are used as an anchor to host cells <xref ref-type="bibr" rid="scirp.138006-16">
     [16]
    </xref>. The alcohol and xylene washing procedures remove excess toluidine blue O from the slide. In some other cases, P. jirovecii was difficult to detect because of the presence of background debris. P. jirovecii cysts typically occur both singly and in small clusters of closely associated organisms <xref ref-type="bibr" rid="scirp.138006-17">
     [17]
    </xref>.</p>
   <p>A total of 41 samples out of the total 100 expressed the 346-band fragment on the agarose gel. Nested PCR prevalence of 41% (41 cases) TBO staining lower prevalence of 29% (29 cases). TBO had 71 negative cases, PCR 59 negative cases as in <xref ref-type="table" rid="table5">
     Table 5
    </xref> and <xref ref-type="table" rid="table6">
     Table 6
    </xref>. Males’ seemingly high prevalence susceptibility to TB could have been attributed to their poor health seeking behaviors <xref ref-type="bibr" rid="scirp.138006-18">
     [18]
    </xref>.</p>
   <p>The mitochondrial Ribosomal RNA large subunit gene is currently used as a PCR target for PCP diagnosis <xref ref-type="bibr" rid="scirp.138006-9">
     [9]
    </xref> <xref ref-type="bibr" rid="scirp.138006-17">
     [17]
    </xref>. According to a study done by Nowaseb et al., 2014, P. jirovecii was detected in 25/475 (5.3%) patients. Seventeen patients (3.6%) tested positive for P. Jirovecii by qPCR and direct microscopy Eight patients (1.7%) were positive only by qPCR. None of the samples tested were positive by direct microscopy alone <xref ref-type="bibr" rid="scirp.138006-19">
     [19]
    </xref>.</p>
   <p>Mt LSU-rRNA, is one of the highly sensitive and specific genetic regions because they are multiple copies of genomes in it <xref ref-type="bibr" rid="scirp.138006-19">
     [19]
    </xref>. The Mt LSU-rRNA gene is involved in basic metabolic functions and is considered to be a highly informative locus. This is also the locus used most widely for PCR-based detection of P. jirovecii, as it is present in a large number of copies <xref ref-type="bibr" rid="scirp.138006-20">
     [20]
    </xref>.</p>
   <p>Nested PCR additional 12 patients than TBO technique-high sensitivity, TBO had acceptable sensitivity &amp; very high specificity (<xref ref-type="table" rid="table6">
     Table 6
    </xref>). In developing countries rates of PJP are lower, possibly due to poor survival, under diagnosis, prior infection with tuberculosis and other organisms <xref ref-type="bibr" rid="scirp.138006-21">
     [21]
    </xref>-<xref ref-type="bibr" rid="scirp.138006-23">
     [23]
    </xref>.</p>
   <p>However, locally no studies have been done to determine the significance of co-infection of Pneumocystis pneumonia with tuberculosis <xref ref-type="bibr" rid="scirp.138006-24">
     [24]
    </xref> <xref ref-type="bibr" rid="scirp.138006-25">
     [25]
    </xref>.</p>
   <p>
    <xref ref-type="bibr" rid="scirp.138006-"></xref>Given that most tuberculosis patients are co-infected with HIV/AIDS and are severely immunocompromised <xref ref-type="bibr" rid="scirp.138006-26">
     [26]
    </xref> <xref ref-type="bibr" rid="scirp.138006-27">
     [27]
    </xref>, there is a possibility that Pneumocystis pneumonia is a significant co-pathogen in this group of patients <xref ref-type="bibr" rid="scirp.138006-28">
     [28]
    </xref> <xref ref-type="bibr" rid="scirp.138006-29">
     [29]
    </xref>.</p>
   <p>Pneumocystis pneumonia has been shown to be a co-infecting pathogen with other respiratory pathogens with a prevalence of <xref ref-type="bibr" rid="scirp.138006-30">
     [30]
    </xref>-<xref ref-type="bibr" rid="scirp.138006-32">
     [32]
    </xref>.</p>
   <p>However the majority, 89% of this study specimens were negative for P. jirovecii, These findings highlight the neccesity and the importance of fungal diagnosis in high risk population especially those with pulmonary TB <xref ref-type="bibr" rid="scirp.138006-33">
     [33]
    </xref> <xref ref-type="bibr" rid="scirp.138006-34">
     [34]
    </xref>. According to this study chi-squire test, there was no significance of co-infection Pneumocystis jirovecii with Mycobacterium tuberculosis with p-value of 0.86 <xref ref-type="bibr" rid="scirp.138006-35">
     [35]
    </xref> <xref ref-type="bibr" rid="scirp.138006-36">
     [36]
    </xref>. In order to evaluate the sensitivity and specificity of Nested PCR and Toluidine Blue O staining method in identifying P. jirovecii in the sputum of patients <xref ref-type="bibr" rid="scirp.138006-37">
     [37]
    </xref> <xref ref-type="bibr" rid="scirp.138006-38">
     [38]
    </xref> with tuberculosis smear negative and retreatment cases with the nested PCR method serving as the gold standard as shown in <xref ref-type="table" rid="table7">
     Table 7
    </xref>.</p>
   <p>The sensitivity of toluidine blue O staining is 33.82%, which indicates that it correctly identifies 33.82% The specificity of toluidine blue O staining is 97.82%, indicating that it has a high ability to correctly identify true negative cases compared to PCR, suggesting that it is good at ruling out non-P. jirovecii cases.</p>
   <p>
    <xref ref-type="bibr" rid="scirp.138006-"></xref>The sensitivity of toluidine blue O staining is 33.82%, which indicates that it correctly identifies 33.82% of true positive cases compared to PCR, missing a significant proportion of true positive cases. The specificity of toluidine blue O staining is 97.82%, indicating that it has a high ability to correctly identify true negative cases compared to PCR, suggesting that it is good at ruling out non-P. jirovecii cases <xref ref-type="bibr" rid="scirp.138006-39">
     [39]
    </xref>-<xref ref-type="bibr" rid="scirp.138006-42">
     [42]
    </xref>.</p>
   <p>The Positive Predictive Value (PPV) of toluidine blue O staining is 95.83%, indicating that when it gives a positive result, there is a 95.83% chance that the patient actually has P. jirovecii according to PCR. This suggests that a positive result with toluidine blue O staining is highly likely to be accurate (<xref ref-type="table" rid="table7">
     Table 7
    </xref>).</p>
   <p>The Negative Predictive Value (NPV) of toluidine blue O staining is 78.95%, indicating that when it gives a negative result, there is a 78.95% chance that the patient truly does not have P. jirovecii according to PCR (<xref ref-type="table" rid="table7">
     Table 7
    </xref>). A negative result with toluidine blue O staining, however, should be interpreted with caution, as it has a relatively higher rate of false negatives. The accuracy of toluidine blue O staining is 83.95%, which indicates the overall proportion of correct results (true positives + true negatives) compared to PCR <xref ref-type="bibr" rid="scirp.138006-32">
     [32]
    </xref>.</p>
   <p>A positive TBO stain usually indicated PCP, so this may be considered the minimum frequency of infection (3.6%) <xref ref-type="bibr" rid="scirp.138006-43">
     [43]
    </xref> <xref ref-type="bibr" rid="scirp.138006-44">
     [44]
    </xref>. Simultaneous co-contamination with M. tuberculosis and P. jirovecii isn’t always thought to be common, which may explain why the prevalence of P. jirovecii appeared to be low in regions with high M. tuberculosis burdens <xref ref-type="bibr" rid="scirp.138006-45">
     [45]
    </xref> <xref ref-type="bibr" rid="scirp.138006-46">
     [46]
    </xref>. The presence of PCP might also suggest colonization of those patients; however, it became more likely that Candida became a co-present oral pathogen in sufferers with PCP, because oral candidiasis is commonplace in these patients over the last decade, research have indicated that PCP can be more common in TB smear-negative sufferers <xref ref-type="bibr" rid="scirp.138006-47">
     [47]
    </xref> <xref ref-type="bibr" rid="scirp.138006-48">
     [48]
    </xref>. The doubtful image of PCP incidence in Africa can be because of empirical remedy and prophylaxis the usage of cotrimoxazole in HIV/AIDS patients <xref ref-type="bibr" rid="scirp.138006-49">
     [49]
    </xref>.</p>
  </sec><sec id="s5">
   <title>5. Conclusions</title>
   <p>Pneumonia is a significant economic burden on the healthcare system. In the developing world rates of PCP are lower, possibly due to poor survival, under diagnosis and prior infection with tuberculosis and other organisms <xref ref-type="bibr" rid="scirp.138006-22">
     [22]
    </xref>.</p>
   <p>Sensitive and specific diagnostic tools are warranted in resource constrained setting and PCR presents a potential rapid sensitive diagnostic tool. Considering cost simplicity and efficacy we recommend TBO as the most practical diagnostic test for use in resource-constrained setting.</p>
   <p>
    <xref ref-type="bibr" rid="scirp.138006-"></xref>The data obtained from this study is an indication of the coinfection of fungi and pulmonary tuberculosis. The study signifies the need for an evaluation of the recurring pulmonary tuberculosis and prudent antifungal treatment based on the culture results rather than broad-spectrum antibiotics for cure. Induced sputum is more cost-effective; however, it is also of limited use because it requires staff training, patient preparation and dedicated rooms. A few studies have compared the value of induced sputum with expectorated sputum and they concluded that the difference in yield was negligible. The current study demonstrated that expectorated sputum can be used in resource-limited settings in sub-Saharan Africa for the routine diagnosis of PCP.</p>
  </sec><sec id="s6">
   <title>6. Limitation of Study</title>
   <p>
    <xref ref-type="bibr" rid="scirp.138006-"></xref>Pneumocystis jirovecii is fastidious and thus in vitro culture is difficult. As Pneumocystis remains a non-cultivable microorganism, traditional diagnostic methods rely on microscopic observations of the pathogen in respiratory specimen which is inherently non-specific.</p>
  </sec><sec id="s7">
   <title>7. Recommendation</title>
   <p>Smear negative patients presenting with clinical symptoms of Tuberculosis the long run should undergo mycological testing before treatment. This necessitates investment in technical and infrastructure capabilities for the diagnosis of fungal illness such as Pneumocystis jirovecii.</p>
  </sec><sec id="s8">
   <title>Acknowledgements</title>
   <p>This study was funded by the Kenya Medical Research Institute. I acknowledge my supervisors for their essential evaluation of my work and their consistent encouragement. Secondly, I acknowledge the Centre for Microbiology Research (CMR), KEMRI, for the supply of laboratory area and the work force. I additionally acknowledge the Coast general hospital, Mombasa for their help in acquiring samples from their hospital. Ultimately, my colleagues, friends and family for their consistent support.</p>
  </sec><sec id="s9">
   <title>Abbreviations and Acronyms</title>
   <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
    <tr> 
     <td class="aleft"><p style="text-align:left">TB</p></td> 
     <td class="aleft"><p style="text-align:left">Tuberculosis</p></td> 
    </tr> 
    <tr> 
     <td class="aleft"><p style="text-align:left">KEMRI</p></td> 
     <td class="aleft"><p style="text-align:left">Kenya Medical Research Institute</p></td> 
    </tr> 
    <tr> 
     <td class="aleft"><p style="text-align:left">PCP/PJP</p></td> 
     <td class="aleft"><p style="text-align:left">Pneumocystis jirovecii Pneumonia</p></td> 
    </tr> 
    <tr> 
     <td class="aleft"><p style="text-align:left">SERU</p></td> 
     <td class="aleft"><p style="text-align:left">Scientific and Ethics Review Unit</p></td> 
    </tr> 
    <tr> 
     <td class="aleft"><p style="text-align:left">Retreatment Cases</p></td> 
     <td class="aleft"><p style="text-align:left">Any individual with a history of treatment for tuberculosis exhibiting clinical symptoms consistent with pulmonary tuberculosis.</p></td> 
    </tr> 
    <tr> 
     <td class="aleft"><p style="text-align:left">PCR</p></td> 
     <td class="aleft"><p style="text-align:left">Polymerase Chain Reaction</p></td> 
    </tr> 
    <tr> 
     <td class="aleft"><p style="text-align:left">CGH</p></td> 
     <td class="aleft"><p style="text-align:left">Coast General Teaching and Referral Hospital</p></td> 
    </tr> 
   </table>
  </sec>
 </body><back>
  <ref-list>
   <title>References</title>
   <ref id="scirp.138006-ref1">
    <label>1</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Abouya, Y.L., Beaumel, A., Lucas, S., Dago-Akribi, A., Coulibaly, G., N’dhatz, M., et al. (1992) Pneumocystis carinii Pneumonia: An Uncommon Cause of Death in African Patients with Acquired Immunodeficiency Syndrome. American Review of Respiratory Disease, 145, 617-620. &gt;https://doi.org/10.1164/ajrccm/145.3.617
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref2">
    <label>2</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Apostolopoulou, A. and Fishman, J.A. (2022) The Pathogenesis and Diagnosis of Pneumocystis jiroveci Pneumonia. Journal of Fungi, 8, Article 1167. &gt;https://doi.org/10.3390/jof8111167
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref3">
    <label>3</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bartlett, M.S. and Smith, J.W. (1991) Pneumocystis carinii, an Opportunist in Immunocompromised Patients. Clinical Microbiology Reviews, 4, 137-149. &gt;https://doi.org/10.1128/cmr.4.2.137
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref4">
    <label>4</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bateman, M., Oladele, R. and Kolls, J.K. (2020) Diagnosing Pneumocystis jirovecii Pneumonia: A Review of Current Methods and Novel Approaches. Medical Mycology, 58, 1015-1028. &gt;https://doi.org/10.1093/mmy/myaa024
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref5">
    <label>5</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bii, C.C., Kose, J., Taguchi, H., Amukoye, E., Ouko, T.T., Muita, L.C., et al. (2006) Pneumocystis jirovecii and Microbiological Findings in Children with Severe Pneumonia in Nairobi, Kenya. The International Journal of Tuberculosis and Lung Disease, 10, 1286-1291.
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref6">
    <label>6</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Calderonsandubete, E. (2002) Historical Perspective on Pneumocystis carinii Infection. Protist, 153, 303-310. &gt;https://doi.org/10.1078/1434-4610-00107
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref7">
    <label>7</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Carmona, E.M. and Limper, A.H. (2010) Update on the Diagnosis and Treatment of Pneumocystis Pneumonia. Therapeutic Advances in Respiratory Disease, 5, 41-59. &gt;https://doi.org/10.1177/1753465810380102
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref8">
    <label>8</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Chakaya, J.M., Bii, C., Ng’ang’a, L., Amukoye, E., Ouko, T., Muita, L., et al. (2004) Pneumocystis carinii Pneumonia in HIV/AIDS Patients at an Urban District Hospital in Kenya. East African Medical Journal, 80, 30-35. &gt;https://doi.org/10.4314/eamj.v80i1.8663
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref9">
    <label>9</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Chawla, K., Martena, S., Gurung, B., Mukhopadhyay, C., Varghese, G. and Bairy, I. (2011) Role of PCR for Diagnosing Pneumocystis jirovecii Pneumonia in HIV-Infected Individuals in a Tertiary Care Hospital in India. Indian Journal of Pathology and Microbiology, 54, 326-329. &gt;https://doi.org/10.4103/0377-4929.81624
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref10">
    <label>10</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Cushion, M.T. (2010) Are Members of the Fungal Genus Pneumocystis (a) Commensals; (b) Opportunists; (c) Pathogens; or (d) All of the Above? PLOS Pathogens, 6, e1001009. &gt;https://doi.org/10.1371/journal.ppat.1001009
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref11">
    <label>11</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Cushion, M.T., Linke, M.J., Ashbaugh, A., Sesterhenn, T., Collins, M.S., Lynch, K., et al. (2010) Echinocandin Treatment of Pneumocystis Pneumonia in Rodent Models Depletes Cysts Leaving Trophic Burdens That Cannot Transmit the Infection. PLOS ONE, 5, e8524. &gt;https://doi.org/10.1371/journal.pone.0008524
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref12">
    <label>12</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     De Armas Rodríguez, Y., Wissmann, G., Müller, A.L., Pederiva, M.A., Brum, M.C., Brackmann, R.L., et al. (2011) Pneumocystis jirovecii Pneumonia in Developing Countries. Parasite, 18, 219-228. &gt;https://doi.org/10.1051/parasite/2011183219
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref13">
    <label>13</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Eddens, T. and Kolls, J.K. (2014) Pathological and Protective Immunity to Pneumocystis Infection. Seminars in Immunopathology, 37, 153-162. &gt;https://doi.org/10.1007/s00281-014-0459-z
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref14">
    <label>14</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ewig, S., Bauer, T., Schneider, C., Pickenhain, A., Pizzulli, L., Loos, U., et al. (1995) Clinical Characteristics and Outcome of Pneumocystis carinii Pneumonia in HIV-Infected and Otherwise Immunosuppressed Patients. European Respiratory Journal, 8, 1548-1553. &gt;https://doi.org/10.1183/09031936.95.08091548
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref15">
    <label>15</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Harris, J.R., Marston, B.J., Sangrujee, N., DuPlessis, D. and Park, B. (2011) Cost-Effectiveness Analysis of Diagnostic Options for Pneumocystis Pneumonia (PCP). PLOS ONE, 6, e23158. &gt;https://doi.org/10.1371/journal.pone.0023158
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref16">
    <label>16</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Helweg-Larsen, J., Jensen, J.S., Dohn, B., Benfield, T.L. and Lundgren, B. (2002) Detection of Pneumocystis DNA in Samples from Patients Suspected of Bacterial Pneumonia—A Case-Control Study. BMC Infectious Diseases, 2, Article No. 28. &gt;https://doi.org/10.1186/1471-2334-2-28
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref17">
    <label>17</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Homayouni, M.M., Behniafar, H., Mehbod, A.S.A., Mohammad-Sadeghi, M. and Maleki, B. (2017) Prevalence of Pneumocystis jirovecii among Immunocompromised Patients in Hospitals of Tehran City, Iran. Journal of Parasitic Diseases, 41, 850-853. &gt;https://doi.org/10.1007/s12639-017-0901-y
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref18">
    <label>18</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Huang, L. and Crothers, K. (2009) HIV‐Associated Opportunistic Pneumonias. Respirology, 14, 474-485. &gt;https://doi.org/10.1111/j.1440-1843.2009.01534.x
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref19">
    <label>19</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Huang, L., Morris, A., Limper, A.H. and Beck, J.M. (2006) An Official ATS Workshop Summary: Recent Advances and Future Directions in Pneumocystis Pneumonia (PCP). Proceedings of the American Thoracic Society, 3, 655-664. &gt;https://doi.org/10.1513/pats.200602-015ms
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref20">
    <label>20</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Kovacs, J.A. and Masur, H. (2009) Evolving Health Effects of Pneumocystis: One Hundred Years of Progress in Diagnosis and Treatment. JAMA, 301, 2578-2585. &gt;https://doi.org/10.1001/jama.2009.880
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref21">
    <label>21</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Minor, O.L., Germani, Y., Chartier, L., Lan, N.H., Lan, N.T.P., Duc, N.H., et al. (2008) Predictors of Pneumocystosis or Tuberculosis in HIV-Infected Asian Patients with AFB Smear-Negative Sputum Pneumonia. JAIDS Journal of Acquired Immune Deficiency Syndromes, 48, 620-627. &gt;https://doi.org/10.1097/qai.0b013e31817efb3c
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref22">
    <label>22</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lowe, D.M., Rangaka, M.X., Gordon, F., James, C.D. and Miller, R.F. (2013) Pneumocystis jirovecii Pneumonia in Tropical and Low and Middle Income Countries: A Systematic Review and Meta-Regression. PLOS ONE, 8, e69969. &gt;https://doi.org/10.1371/journal.pone.0069969
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref23">
    <label>23</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lu, Y., Ling, G., Qiang, C., Ming, Q., Wu, C., Wang, K., et al. (2011) PCR Diagnosis of Pneumocystis Pneumonia: A Bivariate Meta-Analysis. Journal of Clinical Microbiology, 49, 4361-4363. &gt;https://doi.org/10.1128/jcm.06066-11
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref24">
    <label>24</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mohamed, A., Obanda, B.A., Njeri, H.K., Loroyokie, S.N., Mashedi, O.M., Ouko, T.T., et al. (2022) Serological Evidence of Chronic Pulmonary Aspergillosis in Tuberculosis Patients in Kenya. BMC Infectious Diseases, 22, Article No. 798. &gt;https://doi.org/10.1186/s12879-022-07782-9
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref25">
    <label>25</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Jarboui, M.A., Mseddi, F., Sellami, H., Sellami, A., Makni, F. and Ayadi, A. (2013) Genetic Diversity of Pneumocystis Jirovecii Strains Based on Sequence Variation of Different DNA Region. Medical Mycology, 51, 561-567. &gt;https://doi.org/10.3109/13693786.2012.744879
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref26">
    <label>26</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Morris, A. and Norris, K.A. (2012) Colonization by Pneumocystis jirovecii and Its Role in Disease. Clinical Microbiology Reviews, 25, 297-317. &gt;https://doi.org/10.1128/cmr.00013-12
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref27">
    <label>27</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Morris, A., Lundgren, J.D., Masur, H., Walzer, P.D., Hanson, D.L., Frederick, T., et al. (2004) Current Epidemiology of Pneumocystis Pneumonia. Emerging Infectious Diseases, 10, 1713-1720. &gt;https://doi.org/10.3201/eid1010.030985
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref28">
    <label>28</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Murray J.F. (2005) Pulmonary Complications of HIV-1 Infection among Adults Living in Sub-Saharan Africa. The International Journal of Tuberculosis and Lung Disease, 9, 826-835.
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref29">
    <label>29</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mwaura, E.N., Matiru, V. and Bii, C. (2013) Mycological Findings of Sputum Samples from Pulmonary Tuberculosis Patients Attending TB Clinic in Nairobi, Kenya. Virology&amp;Mycology, 2, Article 1000119. &gt;https://doi.org/10.4172/2161-0517.1000119 
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref30">
    <label>30</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Nowaseb, V., Gaeb, E., Fraczek, M.G., Richardson, M.D. and Denning, D.W. (2014) Frequency of Pneumocystis jirovecii in Sputum from HIV and TB Patients in Namibia. The Journal of Infection in Developing Countries, 8, 349-357. &gt;https://doi.org/10.3855/jidc.3864
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref31">
    <label>31</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Onishi, A., Sugiyama, D., Kogata, Y., Saegusa, J., Sugimoto, T., Kawano, S., et al. (2012) Diagnostic Accuracy of Serum 1,3-β-D-Glucan for Pneumocystis jiroveci Pneumonia, Invasive Candidiasis, and Invasive Aspergillosis: Systematic Review and Meta-Analysis. Journal of Clinical Microbiology, 50, 7-15. &gt;https://doi.org/10.1128/jcm.05267-11
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref32">
    <label>32</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Patel, N. and Koziel, H. (2004) Pneumocystis jiroveci Pneumonia in Adult Patients with AIDS: Treatment Strategies and Emerging Challenges to Antimicrobial Therapy. Treatments in Respiratory Medicine, 3, 381-397. &gt;https://doi.org/10.2165/00151829-200403060-00005
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref33">
    <label>33</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rath, P. and Steinmann, J. (2014) Update on Diagnosis of Pneumocystis Pulmonary Infections. Current Fungal Infection Reports, 8, 227-234. &gt;https://doi.org/10.1007/s12281-014-0188-8
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref34">
    <label>34</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Reid, A.B., Chen, S.C.-A. and Worth, L.J. (2011) Pneumocystis jirovecii Pneumonia in Non-HIV-Infected Patients: New Risks and Diagnostic Tools. Current Opinion in Infectious Diseases, 24, 534-544. &gt;https://doi.org/10.1097/qco.0b013e32834cac17
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref35">
    <label>35</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Roux, A., Canet, E., Valade, S., Gangneux-Robert, F., Hamane, S., Lafabrie, A., et al. (2014) Pneumocystis jirovecii Pneumonia in Patients with or without AIDS, France. Emerging Infectious Diseases, 20, 1490-1497. &gt;https://doi.org/10.3201/eid2009.131668
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref36">
    <label>36</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Roux, A., Gonzalez, F., Roux, M., Mehrad, M., Menotti, J., Zahar, J.-R., et al. (2014) Update on Pulmonary Pneumocystis jirovecii Infection in Non-HIV Patients. Médecine et Maladies Infectieuses, 44, 185-198. &gt;https://doi.org/10.1016/j.medmal.2014.01.007
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref37">
    <label>37</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Russian, D.A. and Levine, S.J. (2001) Pneumocystis carinii Pneumonia in Patients without HIV Infection. The American Journal of the Medical Sciences, 321, 56-65. &gt;https://doi.org/10.1097/00000441-200101000-00009
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref38">
    <label>38</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Masur, H., Kovacs, J. and Siegel, M. (2016) Pneumocystis jirovecii Pneumonia in Human Immunodeficiency Virus Infection. Seminars in Respiratory and Critical Care Medicine, 37, 243-256. &gt;https://doi.org/10.1055/s-0036-1579556
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref39">
    <label>39</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Slogrove, A.L., Cotton, M.F. and Esser, M.M. (2009) Severe Infections in HIV-Exposed Uninfected Infants: Clinical Evidence of Immunodeficiency. Journal of Tropical Pediatrics, 56, 75-81. &gt;https://doi.org/10.1093/tropej/fmp057
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref40">
    <label>40</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Thomas, C.F. and Limper, A.H. (2004) Pneumocystis Pneumonia. New England Journal of Medicine, 350, 2487-2498. &gt;https://doi.org/10.1056/nejmra032588
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref41">
    <label>41</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Thomas, C.F. and Limper, A.H. (2007) Current Insights into the Biology and Pathogenesis of Pneumocystis Pneumonia. Nature Reviews Microbiology, 5, 298-308. &gt;https://doi.org/10.1038/nrmicro1621
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref42">
    <label>42</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Luísa Tomás, A. and Matos, O. (2018) Pneumocystis jirovecii Pneumonia: Current Advances in Laboratory Diagnosis. OBM Genetics, 2, Article 49. &gt;https://doi.org/10.21926/obm.genet.1804049
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref43">
    <label>43</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Toper, C., Rivaud, E., Daniel, C., Cerf, C., Parquin, F., Catherinot, É., et al. (2011) Pneumocystose pulmonaire chez des patients immunodéprimés non infectés par le VIH: Étude de 41 cas. Revue de Pneumologie Clinique, 67, 191-198. &gt;https://doi.org/10.1016/j.pneumo.2011.06.001
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref44">
    <label>44</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Tufa, T.B. and Denning, D.W. (2019) The Burden of Fungal Infections in Ethiopia. Journal of Fungi, 5, Article 109. &gt;https://doi.org/10.3390/jof5040109
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref45">
    <label>45</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Vargas, S.L., A. Ponce, C., Gigliotti, F., Ulloa, A.V., Prieto, S., Muñoz, M.P., et al. (2000) Transmission of Pneumocystis carinii DNA from a Patient with P. Carinii Pneumonia to Immunocompetent Contact Health Care Workers. Journal of Clinical Microbiology, 38, 1536-1538. &gt;https://doi.org/10.1128/jcm.38.4.1536-1538.2000
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref46">
    <label>46</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Vray, M., Germani, Y., Chan, S., Duc, N.H., Sar, B., Sarr, F.D., et al. (2008) Clinical Features and Etiology of Pneumonia in Acid-Fast Bacillus Sputum Smear-Negative HIV-Infected Patients Hospitalized in Asia and Africa. AIDS, 22, 1323-1332. &gt;https://doi.org/10.1097/qad.0b013e3282fdf8bf
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref47">
    <label>47</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Wakefield, A.E. (1996) DNA Sequences Identical to Pneumocystis carinii f. sp. carinii and Pneumocystis carinii f. sp. Hominis in Samples of Air SPORA. Journal of Clinical Microbiology, 34, 1754-1759. &gt;https://doi.org/10.1128/jcm.34.7.1754-1759.1996
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref48">
    <label>48</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Worodria, W., Okot-Nwang, M., Yoo, S.D. and Aisu, T. (2003) Causes of Lower Respiratory Infection in HIV-Infected Ugandan Adults Who Are Sputum AFB Smear-Negative. The International Journal of Tuberculosis and Lung Disease, 7, 117-123.
    </mixed-citation>
   </ref>
   <ref id="scirp.138006-ref49">
    <label>49</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zakrzewska, M., Roszkowska, R., Zakrzewski, M. and Maciorkow-Ska, E. (2019) Pneumocystis Pneumonia: Still a Serious Disease in Children. Journal of Mother and Child, 23, 159-162. &gt;https://doi.org/10.34763/devperiodmed.20192303.159162
    </mixed-citation>
   </ref>
  </ref-list>
 </back>
</article>