<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article">
 <front>
  <journal-meta>
   <journal-id journal-id-type="publisher-id">
    aim
   </journal-id>
   <journal-title-group>
    <journal-title>
     Advances in Microbiology
    </journal-title>
   </journal-title-group>
   <issn pub-type="epub">
    2165-3402
   </issn>
   <issn publication-format="print">
    2165-3410
   </issn>
   <publisher>
    <publisher-name>
     Scientific Research Publishing
    </publisher-name>
   </publisher>
  </journal-meta>
  <article-meta>
   <article-id pub-id-type="doi">
    10.4236/aim.2024.1410033
   </article-id>
   <article-id pub-id-type="publisher-id">
    aim-136580
   </article-id>
   <article-categories>
    <subj-group subj-group-type="heading">
     <subject>
      Articles
     </subject>
    </subj-group>
    <subj-group subj-group-type="Discipline-v2">
     <subject>
      Biomedical 
     </subject>
     <subject>
       Life Sciences
     </subject>
    </subj-group>
   </article-categories>
   <title-group>
    New Beauveria bassiana Strains from Kyrgyzstan with Endophytic and Insecticidal Activities
   </title-group>
   <contrib-group>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Tinatin
      </surname>
      <given-names>
       Doolotkeldieva
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Elita
      </surname>
      <given-names>
       Ismailova
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
   </contrib-group> 
   <aff id="aff1">
    <addr-line>
     aPlant Protection Centre, Kyrgyz National Agrarian University, Bishkek, Kyrgyzstan
    </addr-line> 
   </aff> 
   <aff id="aff2">
    <addr-line>
     aPlant Protection Department, Kyrgyz-Turkish Manas University, Bishkek, Kyrgyzstan
    </addr-line> 
   </aff> 
   <pub-date pub-type="epub">
    <day>
     12
    </day> 
    <month>
     10
    </month>
    <year>
     2024
    </year>
   </pub-date> 
   <volume>
    14
   </volume> 
   <issue>
    10
   </issue>
   <fpage>
    469
   </fpage>
   <lpage>
    492
   </lpage>
   <history>
    <date date-type="received">
     <day>
      29,
     </day>
     <month>
      August
     </month>
     <year>
      2024
     </year>
    </date>
    <date date-type="published">
     <day>
      12,
     </day>
     <month>
      August
     </month>
     <year>
      2024
     </year> 
    </date> 
    <date date-type="accepted">
     <day>
      12,
     </day>
     <month>
      October
     </month>
     <year>
      2024
     </year> 
    </date>
   </history>
   <permissions>
    <copyright-statement>
     © Copyright 2014 by authors and Scientific Research Publishing Inc. 
    </copyright-statement>
    <copyright-year>
     2014
    </copyright-year>
    <license>
     <license-p>
      This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/
     </license-p>
    </license>
   </permissions>
   <abstract>
    Beauveria bassiana (Ascomycota: Cordycipitaceae) is an entomopathogenic fungus used as an ecofriendly insecticide to infect arthropods. B. bassiana also possesses endophytic activity to contribute to plant growth. This study aimed to evaluate the potential insecticidal and endophytic activity of native B. bassiana isolates. The nymphal and adult stages of the apple tree aphid (Aphis pomi) and whitefly (Trialeurodes vaporariorum) were used as targets in bioinsecticidal experiments, and vegetables (beans, tomatoes and cucumbers) were used as targets in biostimulant experiments. The endophytic activity of the B. bassiana strains was assessed after inoculation them to the crop seeds and plants via soil drenching, foliar spraying and seed immersion. In bean plants, seed immersion was the most effective application method. Soil drenching was more effective in the cucumber and tomato plants. The results of in vitro bioassay tests against pests have revealed the LC
    <sub>50</sub> and LT
    <sub>50</sub> values of B. bassiana isolate Col-2. The LC
    <sub>50</sub> of this isolate for A. pomi adults and nymphs was 2.5 × 10
    <sup>6</sup> conidia/mL
    <sup>−1</sup>; for T. vaporariorum, it was lower 1.8 × 10
    <sup>6</sup> conidia/mL
    <sup>−</sup>
    <sup>1</sup>. Such mortality occurred after 55.49 h. in A. pomi adults and nymphs (LT
    <sub>50</sub>), after 62.3 h. in T. vaporariorum (LT
    <sub>50</sub>).
   </abstract>
   <kwd-group> 
    <kwd>
     Entomopathogenic Fungus
    </kwd> 
    <kwd>
      Bioinsecticide
    </kwd> 
    <kwd>
      Bioinoculant
    </kwd> 
    <kwd>
      Biocontrol
    </kwd>
   </kwd-group>
  </article-meta>
 </front>
 <body>
  <sec id="s1">
   <title>1. Introduction</title>
   <p>The excessive use of chemical fertilizers has led to several ecological and environmental problems, such as soil pollution and degradation and reductions in beneficial soil organisms. In recent years, there has been a growing trend of using biological agents as an alternative to chemically synthesized pesticides in global markets <xref ref-type="bibr" rid="scirp.136580-1">
     [1]
    </xref> <xref ref-type="bibr" rid="scirp.136580-2">
     [2]
    </xref>. Currently, many microorganisms are used as biopesticides. From this group, entomopathogenic fungi play an important role and have been widely studied <xref ref-type="bibr" rid="scirp.136580-2">
     [2]
    </xref> <xref ref-type="bibr" rid="scirp.136580-3">
     [3]
    </xref>. Beauveria bassiana (Ascomycota: Cordycipitaceae) is an entomopathogenic fungus that is used as an ecofriendly insecticide due to its ability to infect and kill arthropods. It causes mycosis in about 700 species of harmful insects from various orders, including Lepidoptera, Hemiptera, Hymenoptera, Coleoptera and Diptera <xref ref-type="bibr" rid="scirp.136580-4">
     [4]
    </xref>-<xref ref-type="bibr" rid="scirp.136580-7">
     [7]
    </xref>. Like other entomopathogenic fungi, B. bassiana produces conidia that penetrate the cuticle of host insects and mites <xref ref-type="bibr" rid="scirp.136580-8">
     [8]
    </xref> <xref ref-type="bibr" rid="scirp.136580-9">
     [9]
    </xref>. Hence, B. bassiana may have an advantage over other biological agents (i.e., bacteria and viruses) for some applications as a contact biopesticide. Because of its ability to rapidly produce infectious conidia when incubated on inexpensive nutrient media, there is significant interest in the commercial mass production of highly effective bioproducts with broad ranges based on B. bassiana <xref ref-type="bibr" rid="scirp.136580-10">
     [10]
    </xref>. Another important property of this fungus has been identified: the ability to suppress plant pathogens <xref ref-type="bibr" rid="scirp.136580-11">
     [11]
    </xref>-<xref ref-type="bibr" rid="scirp.136580-16">
     [16]
    </xref>. In addition, B. bassiana possesses endophytic activity, and this may be able to contribute to plant growth. B. bassiana species have been found to be able to colonise plants and exist as endophytes <xref ref-type="bibr" rid="scirp.136580-17">
     [17]
    </xref>-<xref ref-type="bibr" rid="scirp.136580-23">
     [23]
    </xref>. Endophytes are plant-associated microorganisms that spend part of their life cycle inside the plant without causing harm or disease to the host <xref ref-type="bibr" rid="scirp.136580-24">
     [24]
    </xref> <xref ref-type="bibr" rid="scirp.136580-25">
     [25]
    </xref>. They are physiologically dependent on host plants, receiving nutrition and protection from the host <xref ref-type="bibr" rid="scirp.136580-26">
     [26]
    </xref>. The endophytic activity of B. bassiana has been well-proven by many studies, although its application as a bioinoculant in modern agricultural systems is relatively under-explored <xref ref-type="bibr" rid="scirp.136580-19">
     [19]
    </xref> <xref ref-type="bibr" rid="scirp.136580-27">
     [27]
    </xref> <xref ref-type="bibr" rid="scirp.136580-28">
     [28]
    </xref>. For example, the study demonstrated the process of endophytic colonization, in which B. bassiana colonizes the interior of cowpea (Vigna unguiculata) seeds. It also showed the positive effects on plant growth in both laboratory and field conditions, as well as their increased resistance to insect attacks <xref ref-type="bibr" rid="scirp.136580-29">
     [29]
    </xref>. The results of the study have practical implications. In laboratory conditions, significant differences were observed between inoculated and control plants in terms of plant height and root dry weight. In the field, treated plants showed reduced susceptibility to pests such as Aphis craccivora (Koch, 1854), Liriomyza sp., and Crinocerus sanctus (Fabricius, 1775), indicating the potential of B. bassiana in pest management.</p>
   <p>The main abiotic factors influencing the effectiveness and sustainability of B. bassiana are temperature, relative humidity, soil water content, and pH regimes. Conidia survival in nonsterile soil that was amended with carbon sources, nitrogen sources, or combinations of carbon and nitrogen was significantly decreased, and loss was often complete in less than 22 days, highlighting the urgent need to address this issue. In contrast, sterile soil treated in the same manner showed dramatic increases in number, demonstrating that B. bassiana is capable of growth in sterile soil <xref ref-type="bibr" rid="scirp.136580-30">
     [30]
    </xref>.</p>
   <p>It’s important to recognize that the effectiveness and sustainability of B. bassiana in field conditions hinge on the control of abiotic factors, such as desiccation and ultraviolet radiation. The authors also discovered that B. bassiana is highly sensitive to UV radiation, a factor that could potentially reduce the fungus’s effectiveness in plants <xref ref-type="bibr" rid="scirp.136580-31">
     [31]
    </xref>.</p>
   <p>Enhanced virulence through genetic engineering of B. bassiana blastospores against a wide range of arthropod hosts and its resistance to environmental stressors. To achieve this, the protoplasts of B. bassiana were transformed with a constitutively expressed endogenous gene encoding chitinase (BbChit1) <xref ref-type="bibr" rid="scirp.136580-32">
     [32]
    </xref>-<xref ref-type="bibr" rid="scirp.136580-34">
     [34]
    </xref>.</p>
   <p>To improve contact of the fungus with the insect cuticle, some studies have used diatomaceous earth in polyvinyl alcohol to immobilize conidia of B. bassiana and algal shells present in diatomaceous earth have been shown to cause damage to the cuticle of G. mellonella; the effectiveness of the fungus was increased and guaranteed <xref ref-type="bibr" rid="scirp.136580-35">
     [35]
    </xref>. Novel research has been undertaken to identify the most effective method for propagating B. bassiana in the development of biopesticides. The efficiency of blastospores formed during submerged cultivation was compared with aerial conidia produced on a solid medium. In general, blastospores and submerged conidia demonstrated a faster insect-killing rate than aerial conidia against the cotton boll weevil Anthonomus grandis and the fall armyworm Spodoptera frugiperda <xref ref-type="bibr" rid="scirp.136580-36">
     [36]
    </xref>.</p>
   <p>Many biological agents are developed in public sector laboratories. They come with additional costs and restrictions, and economic assessments must be carried out early in the development process for farmers to adopt them <xref ref-type="bibr" rid="scirp.136580-37">
     [37]
    </xref>. However, biological control is primarily funded by governments, which require evidence of its return on investment. Cost/benefit analyses can also compare biological control to other management methods. Seeking advice from economists throughout a biological control program should be as routine as consulting statisticians <xref ref-type="bibr" rid="scirp.136580-38">
     [38]
    </xref>.</p>
   <p>This is despite the fact that it is often necessary to obtain and use local isolates to meet regulatory and environmental requirements for ﬁeld applications of such bioagents. In addition, for the successful application of an entomopathogenic fungus and its integration into plant protection programs as an endophyte and a long-term preventive measure against insect pests, it is essential to critically examine the potential inoculation methods and optimize the colonization of the host plants <xref ref-type="bibr" rid="scirp.136580-16">
     [16]
    </xref>. Therefore, there is an urgent need to identify B. bassiana strains that possess both high bioinsecticidal and growth-stimulating activities for the development of biological products based on this fungal species.</p>
   <p>Aphis pomi (Aphididae) commonly known as the apple aphid is an economically important sucking pest that annually causes significant damage to horticulture and fruit nurseries in the country. Especially in the southern regions, this pest forms several generations, damaging especially young trees of apple, pear and other rosaceous plants. To combat these annoying insects, gardeners use high concentrations of chemical insecticides, which are not desirable for the environment and the emergence of resistant pest races.</p>
   <p>Trialeurodes vaporariorum (Aleyrodidae), commonly known as the greenhouse whitefly, causes significant damage in greenhouses and open fields in the country. Nymphal stages and adults of the pest damage many fruit, vegetable and ornamental crops, in addition, they spread viral plant diseases and create conditions for the development and spread of bacterial and fungal pathogens on crops. In the country, effective control is achieved using selective chemical insecticides; an annual increase in the population of this pest is noted, especially in greenhouse farms that grow tomatoes and cucumbers, as well as flowers.</p>
   <p>The aims of the present study were: i) to evaluate the effect of different inoculation methods on the ability of Kyrgyz B. bassiana isolates to colonize bean, tomato and cucumber plants under laboratory conditions, ii) to determine the persistence of the fungus inside the plant tissues and iii) to determine the effect of the fungus on the growth potential of the plant organs. In addition, we aimed to evaluate the insecticidal potential of native B. bassiana isolates against nymphal and adult stages of the apple tree aphid (Aphis pomi) and whitefly (Trialeurodes vaporariorum) in vitro and in vivo.</p>
  </sec><sec id="s2">
   <title>2. Materials and Methods</title>
   <sec id="s2_1">
    <title>2.1. Fungal isolates</title>
    <p>
     <xref ref-type="bibr" rid="scirp.136580-"></xref>The local native Col-2, VT and 12K strains of B. bassiana were isolated from soil and dead insects found in the Chui region of Kyrgyzstan (42˚56˚17; 74˚34˚8). The isolates were identified morphologically as B. bassiana based on the work of <xref ref-type="bibr" rid="scirp.136580-39">
      [39]
     </xref> <xref ref-type="bibr" rid="scirp.136580-40">
      [40]
     </xref> and <xref ref-type="bibr" rid="scirp.136580-41">
      [41]
     </xref>. Cultures of the above strains were stored at 4˚C on Czapek’ agar medium (Sigma-Aldrich, USA) (20 g sucrose, 2 g NaNO<sub>3</sub>, 1 g KH<sub>2</sub>PO<sub>4</sub>, 0.5 g MgSO<sub>4</sub>∙7H<sub>2</sub>O, 0.5 g KCL, 0.01 g FeSO<sub>4</sub>, 20 g agar, 1000 mL distilled water).</p>
   </sec>
   <sec id="s2_2">
    <title>2.2. Fungal biomass Production</title>
    <p>Low-cost, solid nutrient media consisting of barley, wheat, millet and rice groats were used to produce biomass of each B. bassiana strain. The groats were sterilized in an autoclave and dried in an oven at 120˚C - 140˚C for additional sterilization. The groats were distributed into sterile dishes (5 - 10 cm layer) after adjusting pH values (5.5 - 5.6) and 70% humidity by adding sterilized salt solution. The dishes with groats were inoculated with the B. bassiana strains that had been previously grown in modified Czapek’s liquid medium (15 g fodder yeast, 3 g sucrose, 3 g (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>, 0.1 g KH<sub>2</sub>PO<sub>4</sub>, 0.05 g MgSO<sub>4</sub>, 0.05 g KCl, 0.002 g ZnSO<sub>4</sub>, 0.003 g KI, traces of FeSO<sub>4</sub>, 100 mL water) on a shaker (Shaker-incubator ES-20/8, BIOSAN, USA) within 48 h. After incubation, a suspension was prepared from growing fungi conidia in distilled water, and 0.01% Tween 80, vortexed and the concentration of conidia was counted using a Neubauer hemacytometer. Inoculants containing 1 × 10<sup>9</sup> spores/mL were prepared and used to inoculate the cereals groats. The suspensions were mixed well to ensure the uniform distribution of the B. bassiana spores across all the layers of the nutrient medium. The dishes were incubated at room temperature (25˚C) and with natural night and daylight. Each type of groats for the production of fungi biomass was tested in three replicates. After the 15-day incubation on the barley, wheat, millet and rice groats, a spore suspension was prepared from the dried biomass. For this, 10 mL of distilled water containing 1% Tween 80 was added to 1 g of biomass. Then, each conidial suspension was transferred into a 50 mL tube and mixed for 3 min at 1500 rpm to separate the conidia and mycelium from each other. The conidial concentration (conidia/g biomass) was determined by first counting the number of conidia (using phase contrast microscopy and a Neubauer chamber) and using the following formula: N = а · 1000K/h · S (where N = number of conidia in 1 g of biomass, a = average number of spores in one cell of the chamber, K = dilution number, h = chamber depth and S = area of one cell of the chamber) <xref ref-type="bibr" rid="scirp.136580-41">
      [41]
     </xref>. Conidia viability was assessed using the germination assessment method <xref ref-type="bibr" rid="scirp.136580-40">
      [40]
     </xref>. The percentage of germination was determined by randomly counting at least 300 spores for each plate. A conidium was considered to have germinated when it had a germ tube that was at least as long as the smallest diameter of the conidium.</p>
   </sec>
   <sec id="s2_3">
    <title>2.3. Plant Seeds and Sowing Conditions</title>
    <p>Lopatka variety bean plants (Phaseolus vulgaris), Linda variety tomato plants (Solanum lycopersicum) and Curling variety cucumber plants (Cucumis sativus) were used in the experiments. Plant seeds were soaked in 0.5% sodium hypochlorite for 2 min and in 70% ethanol for 2 min. They were then washed three times with sterile distilled water. Sterile soil was mixed with perlite (1:1) and placed in pots. After sowing, the seeds were grown in a greenhouse with a temperature of 25˚C and a photoperiod of 16 h of light and 8 h of darkness.</p>
   </sec>
   <sec id="s2_4">
    <title>2.4. Bioinoculation of Crops with B. bassiana Strains</title>
    <p>The endophytic activity of the B. bassiana strains was evaluated by bioinoculating crops in three ways: seed immersion (soaking seeds for 2 h in a 1 × 10<sup>6</sup> spores/mL suspension of B. bassiana strains), soil drenching (watering with a 1 × 10<sup>6</sup> spores/mL suspension of B. bassiana strains around the root system, 50 mL/per plant) and foliar spraying (spraying the surface of the leaves and stems with a 1 × 10<sup>6</sup> spores/mL suspension of B. bassiana strains). Foliar spraying was performed manually, and 5 mL of suspension was sprayed on each plant. To ensure that the suspensions did not drip from the leaves and enter the soil, each pot was covered with aluminium foil. The fungal suspension was sprayed on the plants three times for one month. The soil drenching was applied three times for one month. Ten plants of each variety were cultivated for each treatment, and five replicates were used for each sampling date. Control pots received sterile water containing 0.01% Tween 80 in place of suspensions. The endophytic activity of the B. bassiana strains was assessed 60 days after last application of fungal suspension by three ways: seed immersion, soil drenching and foliar spraying. Experimental plants were kept at 25˚C temperature, 60% - 70% humidity and exposed to light for no more than 16 hours a day.</p>
   </sec>
   <sec id="s2_5">
    <title>2.5. Assessment of the Endophytic Colonisation by the B. bassiana Strains</title>
    <p>Analyses were performed according to the method of Barta <xref ref-type="bibr" rid="scirp.136580-42">
      [42]
     </xref> to determine the endophytic colonization activity of the B. bassiana strains in plants grown in laboratory conditions. When the plants reached the stem elongation stage 60 days after the last application of fungal suspension were used for the assessment of endophytic activity. The experimental plants had new cells at the tips of growing shoots, and the side shoots constantly appeared next to the main shoot. Data were collected and analyzed from groups of 10 plants inoculated with each variant. Various parts of the plants (i.e., the leaves, stems and roots) were washed thoroughly with tap water. Their surfaces were disinfected by washing in 2.5% sodium hypochlorite solution for 3 min, then in 70% ethanol for 1 min, and rinsed three times in sterile water for 2 min. They were then dried on sterile filter paper, stored at -20˚C in sterile bags. From the last volume of rinsing water, 100 μL were sown on Potato Dextrose Agar (PDA) for two weeks. To avoid bacterial pollution 10 μg/mL of kanamycin was added to the medium. If the surface disinfection was successful (i.e., there was no fungal colony growth), then the plant parts were cut into small pieces (4 × 4 mm each). Six pieces from each plant organ were placed on PDA and incubated, and the grown colonies were studied morphologically under a microscope. The B. bassiana colonization was calculated using the following formula: % colonization = (number of plant pieces showing fungal colony growth/total number of plant pieces) × 100 <xref ref-type="bibr" rid="scirp.136580-43">
      [43]
     </xref> <xref ref-type="bibr" rid="scirp.136580-44">
      [44]
     </xref>. The ability of the studied B. bassiana strains to induce systematic growth in non-inoculated symptoms observed in the inoculated plants compared to the control plants were recorded.</p>
   </sec>
   <sec id="s2_6">
    <title>2.6. Assessment of in Vitro Insecticidal Activity against the Apple Tree Aphid (A. pomi)</title>
    <p>B. bassiana isolates’ conidia produced on the grain bran, harvested after 15 d cultivation and used for inoculum to infect the pests. The mycelium-containing dry biomass of the strains was suspended with adding 0.01% Tween 80 and vortexed. For bioassays, fungal conidial suspensions were adjusted to 1 × 10<sup>6</sup>; 1 × 10<sup>7</sup> and 1 × 10<sup>8</sup> conidia/mL using a hemocytometer. The apple leaves were washed with sterile distilled water. Ten wingless females and ten second-stage nymphs of A. pomi were released on one leaf surface of host plants and directly sprayed with different concentrations (above mentioned) of B. bassiana conidia suspensions. Spraying was carried out using a Potter -Spray-Tower (Burkard Manufacturing Company Limited, England), so that each leaf received 2 ml of suspension. Three leaves in triplicate for each dose, in total, the complete experiment was repeated 3 times. Insects sprayed with warm sterile water with 0.01% Tween 80 were used as a control. Observations for infected insects have lasted within seven days at 25˚C ± 2˚C. The development of mycosis on the experimental and control insects and the humidity in the Petri dishes were monitored daily. To create moist conditions for the germination of the fungal conidia, the filter paper under the leaves was sprayed with sterile water as the humidity decreased. The infected and dead insects were observed under a microscope every day.</p>
   </sec>
   <sec id="s2_7">
    <title>2.7. Molecular Identification of Fungal Isolates</title>
    <p>Each isolate was grown in a YE (yeast extract) liquid media for 48 h at 28˚C and the resulting mycelia were harvested by filtration. For DNA extraction, 0.5 g of frozen mycelia was ground to a fine powder in liquid nitrogen, and immediately transferred to a 2-ml microcentrifuge tube with 800 μL of DNA extraction buffer (100 mM Tris-HCl, pH 8.0, 25 mM EDTA, 1% SDS, and 25 mM NaCl) and placed at 65˚C for 20 min. The suspension was deproteinized once by extraction with an equal volume of phenol and once with an equal volume of chloroform- isoamyl alcohol (24:1). Genomic DNA was precipitated by adding two volumes of ice-cold ethanol and 10% (v/v) 3 M NaCl. The precipitate was collected by centrifugation, washed with 70% ethanol, then dried and resuspended in TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA).</p>
    <p>The ITS1 and ITS4 DNA fragments of select fungal isolates were amplified by PCR using the primer pairs ITS1 (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (CAGGAGACTTGTACACGGTCCAG) and genomic DNA as the template as described by White et al. <xref ref-type="bibr" rid="scirp.136580-45">
      [45]
     </xref>, using the following conditions: initial denaturation step of 2 min at 95˚C followed by 35 cycles, each consisting of a 45 s denaturation step at 95˚C, a 45 s annealing step at 52˚C, and a1 min extension step at 68˚C, and then followed by a final extension step for 5 min at 68˚C.</p>
    <p>An approximately 1.200 bp fragment of the EF1-α gene region was amplified using following primers: EF1T (5’-ATGGGTAAGGARGACAAGAC-3’ and 1567R (5 ACHGTRCCRATACCACCSATCTT-3’ as described by Rehner and Buckley <xref ref-type="bibr" rid="scirp.136580-46">
      [46]
     </xref>. PCR conditions were adapted essentially as described by Rehner and Buckley <xref ref-type="bibr" rid="scirp.136580-46">
      [46]
     </xref>.</p>
    <p>Amplification products were purified using Montage PCR Cleanup Filter Plates (Millipore). Sequencing reactions were conducted by Starseq (Mainz, Germany). Phylogenetic analysis was performed in MEGA 7 <xref ref-type="bibr" rid="scirp.136580-47">
      [47]
     </xref> using the Maximum Likelihood method with a General Time Reversible model. The complete deletion option was used, and the level of bootstrap support was calculated from 1000 replicates.</p>
    <p>Data Collection and Statistical Analysis. The virulence of each fungal isolate was estimated by calculation of the median lethal time (LT<sub>50</sub>) and the median lethal dose (LD<sub>50</sub>) by Probit statistical analyses using the STATISTICAR 6.0 software (Stat Soft Inc). Mortality data obtained from the study were normalized using an arc-sine square root transformation and subjected to an analysis of variance (ANOVA). Untransformed means are presented here P Values: (P) of ≤0.05; P &lt; 0.01; P &lt; 0.001 were accepted as statistically significant (the STATISTICAR 6.0 software).</p>
    <p>To determine whether there were any differences among the fungal strains in terms of their endophytic activities multiple mean comparisons were made using Tukey’s honestly significant difference (HSD) test when statistical differences were found between data sets (P ≤ 0.05).</p>
   </sec>
  </sec><sec id="s3">
   <title>3. Results</title>
   <sec id="s3_1">
    <title>3.1. Mass Production of Fungal Isolates in Laboratory Conditions</title>
    <p>To grow the B. bassiana strains in laboratory conditions and determine their entomopathogenic and endophytic activities, it was necessary to choose low-cost nutrient media that meet the physiological requirements of these fungal isolates. We used low-cost, solid nutrient media for their cultivation that consisted of barley, wheat, millet and rice groats. Colonization of the solid media by fungal mycelia was seen from the third day. All tested strains grew well on wheat and barley, completely covering the medium and forming dense mycelia (<xref ref-type="fig" rid="fig1(a)">
      Figure 1(a)
     </xref>, <xref ref-type="fig" rid="fig1(b)">
      Figure 1(b)
     </xref> and <xref ref-type="fig" rid="fig2(a)">
      Figure 2(a)
     </xref>). However, the millet and rice groat media were not completely covered with fungal mycelia. To select the most suitable growth medium for producing inexpensive bioproducts based on B. bassiana, the conidial titer of each fungal biomass grown on the various cereal groats was determine. It was found that conidial formation varied among the different strains and depended on the medium used. High conidial titers were recorded when the VT (25 × 10<sup>9</sup> spores/g) and Col-2 (23 × 10<sup>9</sup> spores/g) strains were grown on wheat groats. When grown on barley groats, the VT strain produced 23 × 10<sup>9</sup> spores/g, and the 12 K strain produced 24 × 10<sup>9</sup> spores/g. On millet groats, the VT strain formed 17 × 10<sup>9</sup> spores/g, the Col-2 strain formed 18 × 10<sup>9</sup> spores/g and the 12 K strain formed 14 × 10<sup>9</sup> spores/g. The lowest conidial titers were recorded when the Col-2 strain was grown on rice groats (8 × 10<sup>9</sup> spores/g) and the 12 K strain was grown on wheat groats (10 × 10<sup>9</sup> spores/g) (<xref ref-type="fig" rid="fig2(b)">
      Figure 2(b)
     </xref>). Thus, based on these results, we selected two medium compositions—wheat and barley groats—to produce biomass from the B. bassiana strains for use in bioproducts. The resultant biomass material was dried in a drying oven at 30˚C - 31˚C and subsequently packed in waterproof paper bags that were labelled with the product’s weight.</p>
   </sec>
   <sec id="s3_2">
    <title>3.2. Assessment of Plant Growth after Bioinoculation with B. bassiana Strains: Foliar Spraying</title>
    <p>It was found that the growth-stimulating effect of the B. bassiana strains on the different vegetable crops varied with the bioinoculation method. When the B. bassiana</p>
    <fig id="fig1" position="float">
     <label>Figure 1</label>
     <caption>
      <title>Figure 1. Growth intensity of Beauveria bassiana VT (a) and 12 K (b) strains on cereal groats during 15 days of surface cultivation. Values are given as mean ± SD (n = 3) and significantly different when P ≤ 0.05.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId15.jpeg?20241015111817" />
    </fig>
    <p>strain suspensions were delivered by foliar spraying, the VT strain exhibited the greatest effect on the growth and development of tomato plants. In this case, the stems of the experimental plants were 4.0 - 4.5 ± 0.71 cm longer than those of the control plants. The stems of the experimental plants sprayed with the Сol-2 and 12 K strain suspensions were 2.5 - 3.0 ± 0.45 cm longer than those of the control plants (<xref ref-type="fig" rid="fig3">
      Figure 3
     </xref>).</p>
    <fig id="fig2" position="float">
     <label>Figure 2</label>
     <caption>
      <title>Figure 2. (a) Growth intensity of Beauveria bassiana Col-2 strain on cereal groats during 15 days of surface cultivation. (b) Number of fungal conidia per 1 g of dry bioproduct produced by the different fungal strains grown on different types of cereal groats. Values are given as mean ± SD (n = 3) and significantly different when P ≤ 0.05.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId16.jpeg?20241015111817" />
    </fig>
    <fig id="fig3" position="float">
     <label>Figure 3</label>
     <caption>
      <title>Figure 3. Effect of Beauveria bassiana strain suspensions delivered by foliar spraying on the growth of tomato seedlings. Values are given as mean ± SD (n = 3) and significantly different when P ≤ 0.05.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId17.jpeg?20241015111817" />
    </fig>
    <p>The fungal strains had less effect on the growth of cucumber plants compared to tomato plants. Here, the 12 K strain was found to have the greatest effect on plant growth. Plants sprayed with the 12 K strain grew 2.0 ± 0.31 cm taller than the control plants. Plants sprayed with the Col-2 and VT strains grew only 1.0 ± 0.15 cm taller than the control plants (<xref ref-type="fig" rid="fig4">
      Figure 4
     </xref>).</p>
    <p>The most potent growth stimulating effect exhibited by these B. bassiana strains was observed in the bean plants. Three days after spraying, the experimental plants were 5.5 - 7.0 ± 0.90 cm taller than the control plants, and after seven days, they were 10.0 ± 0.95 cm taller. Spraying with the VT and 12 K strain suspensions resulted in 9.0 ± 0.73 cm and 5.5 ± 0.71 cm of additional growth, respectively, compared to that of the control plants (<xref ref-type="fig" rid="fig5">
      Figure 5
     </xref>).</p>
    <fig id="fig4" position="float">
     <label>Figure 4</label>
     <caption>
      <title>Figure 4. Effect of Beauveria bassiana strain suspensions delivered by foliar spraying on the growth of cucumber s’ seedlings. Values are given as mean ± SD, n = 3, significantly different at P ≤ 0.05.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId18.jpeg?20241015111817" />
    </fig>
    <fig id="fig5" position="float">
     <label>Figure 5</label>
     <caption>
      <title>Figure 5. Effect of Beauveria bassiana strain suspensions delivered by foliar spraying on the growth of been seedlings. Values are given as mean ± SD, n = 3, significantly different at P ≤ 0.05.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId19.jpeg?20241015111817" />
    </fig>
   </sec>
   <sec id="s3_3">
    <title>3.3. Assessment of Plant Growth after Bioinoculation with B. bassiana Strains: Seed Immersion</title>
    <p>Tomato, cucumber and bean seeds were soaked for 2 h in suspensions of the B. bassiana strains. The effect on tomato plant growth was observed only after the appearance of several true leaves, seven days after the start of the experiment. Unlike the other strains, the 12 K strain showed promising results, producing experimental plants that were 3 ± 0.21 cm taller than the control plants. Immersing seeds in suspensions of the VT and Col-2 strains resulted in minimal shoot growth in the experimental group (1.5 ± 0.11 cm).</p>
    <p>Slight differences between the experimental and control plants were also noted in the cucumber plants. When seeds were soaked in suspensions of the Col-2 and 12 K strains, the experimental plants were 1.8 - 2.5 ± 0.12 cm taller than the control plants, whereas when seeds were soaked in a suspension of the VT strain, the resultant plants were 1.5 ± 0.09 cm taller than the control plants. A similar effect was observed when bean seeds were soaked in suspensions of all tested strains. The difference in height between the control and experimental plants was almost 2.0 ± 0.19 cm.</p>
    <p>Hence, it was concluded that B. bassiana has endophytic activity and can affect plant growth. Our findings show that the level of plant growth in the tested vegetable crops depends on the bioinoculation method used to deliver the B. bassiana strains. Soil drenching produced the highest level of growth in the tomato and cucumber plants, whereas all the tested bioinoculation methods produced the same high levels of growth in the bean plants (<xref ref-type="fig" rid="fig6(a)">
      Figure 6(a)
     </xref>, <xref ref-type="fig" rid="fig6(b)">
      Figure 6(b)
     </xref> and <xref ref-type="fig" rid="fig7">
      Figure 7
     </xref>).</p>
    <fig id="fig6" position="float">
     <label>Figure 6</label>
     <caption>
      <title>Figure 6. (a) The effect of the Beauveria bassiana strains on the growth of tomato seedlings; (b) The effect of the Beauveria bassiana strains on the growth of cucumber seedlings. The strains were applied in three different ways (foliar spraying, soil drenching or see immersion). Values are given as mean ± SD (n = 3) and significantly different when P ≤ 0.05.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId20.jpeg?20241015111817" />
    </fig>
    <fig id="fig7" position="float">
     <label>Figure 7</label>
     <caption>
      <title>Figure 7. The effect of the Beauveria bassiana strains on the growth of bean seedlings. The strains were applied in three different ways (foliar spraying, soil drenching or see immersion). Values are given as mean ± SD (n = 3) and significantly different when P ≤ 0.05.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId21.jpeg?20241015111817" />
    </fig>
    <p>Using the soil drenching method to apply the B. bassiana strains showed promising results for tomatoes: all three tested strains impacted plant growth. When foliar spraying was used, the VT strain showed a strong effect, the 12 K strain showed a moderate effect and the Col-2 strain had a weak effect. In contrast, the seed immersion method proved ineffective compared to soil drenching and foliar spraying.</p>
    <p>In terms of cucumber plant growth, soil drenching was found to be the most effective delivery method for maximising Col-2 and VT strain activity. All three strains had almost equal effects on plant growth when the seed immersion method was used. Foliar spraying resulted in only the 12 K strain having an effect on plant growth; the other two strains had no effect.</p>
    <p>Regarding the growth of the bean plants, seed immersion proved to be the most effective method.</p>
    <p>Seeds immersed in suspensions of all three strains produced plants that were 6 - 10 cm taller than those exposed to the strains via foliar spraying and soil drenching. The Col-2 strain showed excellent results in terms of effect on plant growth when delivered via all tested bioinoculation methods.</p>
   </sec>
   <sec id="s3_4">
    <title>3.4. Endophytic Colonization: Presence and Persistence of Endophytic B. bassiana Strains in Vegetable Crops</title>
    <p>In the tested tomato plants, application of the fungal strains via soil drenching resulted in a high level of root colonization by the endophytic B. bassiana strains—up to 73.0% ± 0.15%. Stem and leaf colonization levels were also significant (67.0% ± 0.2% and 53.0% ± 0.2%, respectively). When the strains were applied via foliar spraying, root colonization reached 55.0% ± 0.2%. When the seeds were immersed in the various B. bassiana suspensions, colonization was low: up to 32% ± 0.2% in the roots, 21.0% ± 0.2% in the stem and 17.0% ± 0.2% in the leaf tissue (<xref ref-type="fig" rid="fig8(a)">
      Figure 8(a)
     </xref>).</p>
    <fig id="fig8" position="float">
     <label>Figure 8</label>
     <caption>
      <title>Figure 8. Colonization of tomato (a) and cucumber plant organs (b) by Beauveria bassiana strains delivered via three different methods. Values are given as mean ± SD, n = 3, significantly different at P ≤ 0.05.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId22.jpeg?20241015111818" />
    </fig>
    <p>In the tested cucumber plants, colonization reached almost 80% ± 0.2% when the Col-2 and VT strains were delivered via soil drenching. When seeds were immersed in and leaves were sprayed with B. bassiana strain suspensions, colonization reached 60% ± 0.2% and 27% ± 0.2%, respectively (<xref ref-type="fig" rid="fig8(b)">
      Figure 8(b)
     </xref>).</p>
    <p>When bean seeds were immersed in the B. bassiana strain suspensions, high levels of colonization were observed, reaching almost 85% ± 0.2%. The other inoculation methods also resulted in significant colonization. Soil drenching resulted in up to 62% ± 0.2% of root samples, 53.0% ± 0.2% of stem samples and 47% ± 0.2% of leaf samples being colonized (<xref ref-type="fig" rid="fig9">
      Figure 9
     </xref>). Sixty days after injection, fungal colonies were isolated from plant stems, leaves and roots and their morphological features were studied, proving that they belong to Beauveria bassiana (<xref ref-type="fig" rid="fig10">
      Figure 10
     </xref>).</p>
    <fig id="fig9" position="float">
     <label>Figure 9</label>
     <caption>
      <title>Figure 9. Colonization of beans plant organs by Beauveria bassiana strains delivered via three different methods. Values are given as mean ± SD, n = 3, significantly different at P ≤ 0.05.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId23.jpeg?20241015111818" />
    </fig>
    <fig id="fig10" position="float">
     <label>Figure 10</label>
     <caption>
      <title>Figure 10. (a) The colonies of Beauveria bassiana grown from leaves on PDA media; foliar spray inoculation method. (b) The colonies of Beauveria bassiana grown from stems on PDA media; Soil inoculation method.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId24.jpeg?20241015111818" />
    </fig>
   </sec>
   <sec id="s3_5">
    <title>3.5. Insecticidal Activity of B. bassiana Strains against A. pomi</title>
    <p>Dried formulation with high content of tested isolates conidia was used for assessment of their insecticidal activity against adults and nymphs of A. pomi using the doses 1 × 10<sup>6</sup>; 1 × 10<sup>7</sup> and 1 × 10<sup>8</sup> conidia/mL. As a result, the tested B. bassiana strains have shown varying biological activity. At a dose of 1 × 10<sup>6</sup> conidia/mL, the mortality of adults and nymphs of the pest did not exceed 40.2% ± 0.95%, when using a dose of 1 × 10<sup>7</sup> conidia/mL, mortality increased to 63.7% ± 0.95%. The Col-2 strain was effective at all doses, especially at a dose of 1 × 10<sup>8</sup> conidia/mL, mortality reached 76.7% ± 0.95% within 5 days, and the death rate of control individuals was up to 12.0% ± 0.95% (<xref ref-type="fig" rid="fig11">
      Figure 11
     </xref>). The fungus mycelium began attaching to the covers of adults and nymphs in 48 h (<xref ref-type="fig" rid="fig12">
      Figure 12
     </xref>). Complete coverage of the insects with a white felt mycelium occurred after five days. It should be noted that the humidity has a direct impact on the development of the entomopathogenic fungus, since the experiments resulted in mortality when the dishes were kept in conditions with a humidity of 80% - 85%, at a temperature of 25˚C ± 2˚C.</p>
   </sec>
   <sec id="s3_6">
    <title>3.6. Insecticidal Activity of B. bassiana Strains against T. vaporariorum</title>
    <p>The B. bassiana strains grown on the media composed of wheat and barley groats</p>
    <fig id="fig11" position="float">
     <label>Figure 11</label>
     <caption>
      <title>Figure 11. Insecticidal activity of the Beauveria bassiana strains against apple aphids’ (A. poma) nymphs and adults by contact infection (1 × 10<sup>6</sup>; 1 × 10<sup>7</sup> and 1 × 10<sup>8</sup> conidia/mL). Values are given as mean ± SD (n = 3) and significantly different when P ≤ 0.05.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId25.jpeg?20241015111818" />
    </fig>
    <fig id="fig12" position="float">
     <label>Figure 12</label>
     <caption>
      <title>Figure 12. The hyphal and conidial germination of Bav. bassina attached to legs of A. poma adults. Images were produced using × 40 stereo microscopy.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId26.jpeg?20241015111818" />
    </fig>
    <fig id="fig13" position="float">
     <label>Figure 13</label>
     <caption>
      <title>Figure 13. (a) Insecticidal activity of the Beauveria bassiana strains against whitefly’ (Trialeurodes vaporariorum) nymphs and adults. Values are given as mean ± SD (n = 3) and significantly different when P ≤ 0.05. (b) Mycosis observed in whitefly’ nymphs and adults exposed to the Beauveria bassiana strains in 48 h.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId27.jpeg?20241015111818" />
    </fig>
    <p>showed significant insecticidal activity against whitefly adults and nymphs within five days. Exposure of the whitefly adults and nymphs to 1 × 10<sup>6</sup> conidia/mL dose of the 12 K, Col-2 and VT strains resulted in mortality of 37.7% ± 0.95%, 43.9% ± 0.95% and 40.5% ± 0.95% respectively (Р ≤ 0.05). The mortality recorded for the whitefly adults and nymphs was higher by using 1 × 10<sup>7</sup> conidia/mL dose of the 12 K, Col-2 and VT strains: 56.4% ± 0.95%, 61.3% ± 0.95%, 55.9% ± 0.95% respectively (Р ≤ 0.05). The mortality of tested insects reached to 69.7% ± 0.95%, 81.2% ± 0.95% and 75.2% ± 0.95% respectively (Р ≤ 0.05) of the 12 K, Col-2 and VT strains at the dose 1 × 10<sup>8</sup> conidia/mL. Of all the tested strains, the Col-2 strain demonstrated the highest levels of insecticidal activity against both stages of the pest (<xref ref-type="fig" rid="fig13(a)">
      Figure 13(a)
     </xref>). The results in vitro bioassay tests against sucking pests have revealed the LC<sub>50</sub> and LT<sub>50 </sub>values of B. bassiana isolate Col-2. The dose that caused 50% mortality in the population of used pests was different. The LC<sub>50</sub> of this isolate for A. pomi adults and nymphs was 2.5 × 10<sup>6</sup> conidiamL<sup>−</sup><sup>1</sup>; for T. vaporariorum it was lower - 1.8 × 10<sup>6</sup> conidiamL<sup>−</sup><sup>1</sup>. Such mortality occurred after 55.49 hours in A. pomi adults and nymphs (LT<sub>50</sub>), after 62.3 hours in T. vaporariorum (LT<sub>50</sub>). These data indicate that sucking pests have shown susceptibility to infection caused by B. bassiana isolate Col-2.</p>
    <p>Complete coverage of the insects with a white felt mycelium occurred after five days (<xref ref-type="fig" rid="fig13(b)">
      Figure 13(b)
     </xref>). The death rate of control individuals was up to 8.9% ± 0.95%. It should be noted that the humidity has a direct impact on the development of the entomopathogenic fungus, since the experiments resulted in mortality when the dishes were kept in conditions with a humidity of 80% - 85%, at a temperature of 25˚C ± 2˚C.</p>
    <p>The results in vitro bioassay tests against sucking pests have revealed the LC<sub>50</sub> and LT<sub>50 </sub>values of B. bassiana isolate Col-2. The dose that caused 50% mortality in the population of used pests was different. The LC<sub>50</sub> of this isolate for A. pomi adults and nymphs was 2.5 × 10<sup>6</sup> conidiamL<sup>−</sup><sup>1</sup>; for T. vaporariorum it was lower - 1.8 × 10<sup>6</sup> conidia/mL<sup>−</sup><sup>1</sup>. Such mortality occurred after 55.49 hours in A. pomi adults and nymphs (LT<sub>50</sub>), after 62.3 hours in T. vaporariorum (LT<sub>50</sub>). These data indicate that sucking pests have shown susceptibility to infection caused by B. bassiana isolate Col-2. LC<sub>50</sub> and LT<sub>50</sub> values and 95% confidence limits (CL) expressed as conidia (×10<sup>4</sup>) (Proc Probit (SPSS). LT<sub>50</sub> values for mortality were estimated by analysis (Proc Probit (SPSS) data for &gt;72 hours for A. pomi and T. vaporariorum, corresponding to the last day of incubation in bioassay &gt; 5 days.</p>
   </sec>
   <sec id="s3_7">
    <title>3.7. Molecular Characterization of Fungal Isolates; Sequencing of 18S rDNA, ITS1-5.8S-ITS2, and EF1-α and EF1-α Genomic Loci</title>
    <p>Selected fungal isolates were subjected to DNA sequencing for identification. The ITS1 and ITS4 DNA fragments of select fungal isolates were ampliﬁed by PCR using the primer pairs ITS1(CTTGGTCATTTAGAGGAAGTAA) and ITS4 (CAGGAGACTTGTACACGGTCCAG) and genomic DNA as the template. Based on their morphological characteristics, including the production of ellipsoidal conidia, and molecular characteristics (ITS, partial 18S [SSU rDNA] and EF1-α sequences), the isolates were identiﬁed as B. bassiana belonging to Clade E from Asia (<xref ref-type="fig" rid="fig14">
      Figure 14
     </xref>).</p>
   </sec>
  </sec><sec id="s4">
   <title>4. Discussion</title>
   <p>Studies emphasize that biological agents are highly effective, with their main</p>
   <fig id="fig14" position="float">
    <label>Figure 14</label>
    <caption>
     <title>Figure 14. Phylogenetic position of the isolate Col-2 strains (KY973650) within Beauveria genus based on ITS1-5.8S-ITS2 sequence, among other closely related Beauveria bassiana species from the database.</title>
    </caption>
    <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2272091-rId28.jpeg?20241015111819" />
   </fig>
   <p>advantages being lower negative impacts on human health and the environment. They have low toxicity; biocontrol also has very short or no pre-harvest intervals. The biological agents as natural products degrade quickly without disturbing biodiversity or ecosystems. Compared to chemicals, the critical advantage of biocontrol agents is that they slow down pest resistance. Some biocontrol agents can actively seek out pests. A significant advantage of biocontrol is its compatibility with environmental and health regulations; they also align with integrated pest management (IPM) and organic certification schemes. Moreover, they can support biodynamic agriculture <xref ref-type="bibr" rid="scirp.136580-48">
     [48]
    </xref>-<xref ref-type="bibr" rid="scirp.136580-51">
     [51]
    </xref>.</p>
   <p>The endophytic and insecticidal activities of entomopathogenic fungi allow them to be used as agents in long-term preventive measures against pests and diseases. In recent years, many studies have identified B. bassiana strains with several beneficial properties <xref ref-type="bibr" rid="scirp.136580-9">
     [9]
    </xref> <xref ref-type="bibr" rid="scirp.136580-16">
     [16]
    </xref> <xref ref-type="bibr" rid="scirp.136580-21">
     [21]
    </xref> <xref ref-type="bibr" rid="scirp.136580-22">
     [22]
    </xref> <xref ref-type="bibr" rid="scirp.136580-29">
     [29]
    </xref>. Such isolates can potentially be incorporated into an industrial formula with insecticidal and growth-promoting effects. Combining several entities with valuable properties into one biological product is a rational, economically sound and ecofriendly way to protect plants from pests and diseases. In this study, we examined the potential of endophytic and entomopathogenic fungi as biocontrol agents and plant growth promoters, as well as the impact of various artificial inoculation methods on their endophytic colonization of host plants. More specifically, we evaluated the endophytic and insecticidal activity of newly isolated, naturally occurring B. bassiana strains.</p>
   <p>The first step was to develop a low-cost growth medium that can support the generation of high conidial titres and be used in adverse field conditions. Several low-cost nutrient formulations were tested, and the findings indicate that media composed of wheat and barley groats support the generation of biomass with sufficiently high conidial titres for the production of an industrial formula. Other studies have also reported abundant growth of B. bassiana colonies in food industry waste <xref ref-type="bibr" rid="scirp.136580-42">
     [42]
    </xref>-<xref ref-type="bibr" rid="scirp.136580-54">
     [54]
    </xref>.</p>
   <p>Next, the endophytic activity of the newly isolated B. bassiana strains was assessed using three important vegetable crops: beans, tomatoes and cucumbers. The strains were delivered to the seeds and plants using three different inoculation methods to optimize the delivery of the fungi and their effects and to identify the factors that limit the colonization of host plants by B. bassiana. The results show that the most suitable method for the delivery of B. bassiana varies among plant species; therefore, it is necessary to determine the most appropriate method for each individual species, such as leaf spraying, soil impregnation or seed inoculation.</p>
   <p>
    <xref ref-type="bibr" rid="scirp.136580-"></xref>The colonization of the plant organs by the B. bassiana strains across the plant species and depended on the inoculation method. However, considerable colonization of all tested organs (i.e., roots, stem and leaves) was observed in the bean plants regardless of the type of inoculation. Successful colonization by entomopathogenic fungi delivered via different methods has been observed in several plant types <xref ref-type="bibr" rid="scirp.136580-20">
     [20]
    </xref> <xref ref-type="bibr" rid="scirp.136580-55">
     [55]
    </xref>-<xref ref-type="bibr" rid="scirp.136580-58">
     [58]
    </xref>. María et al. <xref ref-type="bibr" rid="scirp.136580-59">
     [59]
    </xref> found that colonisation by B. bassiana delivered via leaf spraying peaked in soybean seedlings at 24% after seven days. They also reported that root immersion resulted in peak colonisation 14 days post-inoculation (10.5%) and that seed inoculation resulted in peak colonisation at seven days (14%).</p>
   <p>In another study, B. bassiana strains were more successful colonizers than Metharisium strains, showing 100%, 90% and 45% recovery from leaves, stem and roots, respectively, seven days after inoculation <xref ref-type="bibr" rid="scirp.136580-60">
     [60]
    </xref>. In the same study, the ability of the entomopathogenic fungi to move through plant tissues was demonstrated, entering through the roots, stems and leaves. Leaf aspersion has been reported as the most efficient technique for inoculating different fungal strains into soybean plants <xref ref-type="bibr" rid="scirp.136580-24">
     [24]
    </xref>. However, others have mostly reisolated entomopathogenic fungi from roots and in lower proportions from leaves <xref ref-type="bibr" rid="scirp.136580-61">
     [61]
    </xref> <xref ref-type="bibr" rid="scirp.136580-62">
     [62]
    </xref>. In our study, high colonisation levels were observed when tomato plants were inoculated with fungal strains via soil drenching. Foliar spraying resulted in low levels of colonisation. Other studies have shown that selected Bav. bassiana strains can colonise tomato plants as endophytes and control two critical disease agents (Botrytis cinerea and Alternaria alternata) and the pest aphid Macrosiphum euphorbiae <xref ref-type="bibr" rid="scirp.136580-63">
     [63]
    </xref>. Similarly, soil drenching led to the highest levels of colonisation in cucumber plants. The observed colonisation of different plant organs indicated that these fungi may move systemically throughout the plant <xref ref-type="bibr" rid="scirp.136580-23">
     [23]
    </xref> <xref ref-type="bibr" rid="scirp.136580-58">
     [58]
    </xref> <xref ref-type="bibr" rid="scirp.136580-64">
     [64]
    </xref>. Early studies in this area reported that B. bassiana can colonise the spaces between parenchymal cells and can move within the plant and colonise untreated tissues <xref ref-type="bibr" rid="scirp.136580-65">
     [65]
    </xref> <xref ref-type="bibr" rid="scirp.136580-66">
     [66]
    </xref>.</p>
   <p>The apple tree aphid (A. pomi) and whitefly (T. vaporariorum) are signiﬁcant agricultural pests responsible for yield losses across several crops, including fruits and vegetables. In this study, we examined the potential of the same three local entomopathogenic B. bassiana isolates tested for endophytic activity for the management of these pests in Kyrgyzstan. For this part of the study, B. bassiana conidial suspensions were prepared and sprayed onto the pests. Other studies have also reported that B. bassiana can persist inside different cucumber tissues for up to 90 days after inoculation <xref ref-type="bibr" rid="scirp.136580-54">
     [54]
    </xref>. Soil drenching led to the highest recovery rates, while foliar spraying led to the lowest recovery rates <xref ref-type="bibr" rid="scirp.136580-54">
     [54]
    </xref>. Others have also achieved high mortality rates by spraying B. bassiana onto pest species, namely Lipaphis erysimi (Kalt.) (Hemiptera: Aphididae) <xref ref-type="bibr" rid="scirp.136580-67">
     [67]
    </xref>. Many studies have confirmed that B. bassiana is an aphid pathogen <xref ref-type="bibr" rid="scirp.136580-22">
     [22]
    </xref> <xref ref-type="bibr" rid="scirp.136580-68">
     [68]
    </xref> <xref ref-type="bibr" rid="scirp.136580-69">
     [69]
    </xref>. Asi et al. <xref ref-type="bibr" rid="scirp.136580-70">
     [70]
    </xref> reported high mortality rates in the cabbage aphid (Brevicoryne brassicae L.) as a result of increasing the concentration of B. bassiana conidia and exposure time. It has also been found that foliar spraying and foliar spraying with root impregnation reduces the fecundity of pests such as Eurygaster integriceps <xref ref-type="bibr" rid="scirp.136580-71">
     [71]
    </xref> and Aphis gossypii Glover <xref ref-type="bibr" rid="scirp.136580-22">
     [22]
    </xref>. Furthermore, other studies have shown that endo endophytic entomopathogens can increase plant viability exposure to abiotic and biotic stress <xref ref-type="bibr" rid="scirp.136580-31">
     [31]
    </xref> <xref ref-type="bibr" rid="scirp.136580-49">
     [49]
    </xref> <xref ref-type="bibr" rid="scirp.136580-70">
     [70]
    </xref> <xref ref-type="bibr" rid="scirp.136580-72">
     [72]
    </xref> <xref ref-type="bibr" rid="scirp.136580-73">
     [73]
    </xref> <xref ref-type="bibr" rid="scirp.136580-74">
     [74]
    </xref>.</p>
  </sec><sec id="s5">
   <title>5. Conclusion</title>
   <p>
    <xref ref-type="bibr" rid="scirp.136580-"></xref>Our findings show that B. bassiana can promote plant growth, support the growth of taller plants, improve seed germination and kill pests. Hence, this study confirms the potential of the tested B. bassiana strains as biological pest control agents and bioinoculants that increase the growth and development of plant seedlings. These findings can be used to develop bioagents, which will reduce the indiscriminate use of chemical insecticides on crops and thereby protect the environment and its vital natural components from excessive pesticide pollution. Therefore, we recommend incorporating a formulation of the tested B. bassiana isolates into integrated pest management (IPM) programmes to improve the growth of vegetable crops and control economically important sucking pests, such as aphids and whiteflies, in greenhouse and open field conditions in Kyrgyzstan.</p>
  </sec><sec id="s6">
   <title>Authors’ Contributions</title>
   <p>Conceptualization and design were done by Tinatin Doolotkeldieva. Sample preparation, data collection, and analysis were performed by Elita Ismailova.</p>
   <p>The first draft of the manuscript was written by Elita Ismailova and revised by Tinatin Doolotkeldieva. All authors read and approved the final manuscript.</p>
  </sec><sec id="s7">
   <title>Financial Support and Sponsorship</title>
   <p>This work was supported by the Science Foundation of the Science and Education Ministry of Kyrgyz Republic under the project “A Creation of Industrial Biopesticide Formula Based on Entomopathogenic Fungi Beauveria bassiana and Its Use in Protection of Crops against Suction and Root Pests” [KG. 000775].</p>
  </sec><sec id="s8">
   <title>Ethical Approvals</title>
   <p>This experiment does not involve the use of animal or human subjects.</p>
  </sec><sec id="s9">
   <title>Data Availability</title>
   <p>The authors confirmed that, the data supporting the finding of the present study are available within the article.</p>
  </sec><sec id="s10">
   <title>Use of Artificial Intelligence (AI)-Assisted Technology</title>
   <p>The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.</p>
  </sec>
 </body><back>
  <ref-list>
   <title>References</title>
   <ref id="scirp.136580-ref1">
    <label>1</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bisht, N. and Singh Chauhan, P. (2021) Excessive and Disproportionate Use of Chemicals Cause Soil Contamination and Nutritional Stress. In: Larramendy, M.L. and Soloneski, S., Eds., Soil Contamination—Threats and Sustainable Solutions, IntechOpen, 1-10. &gt;https://doi.org/10.5772/intechopen.94593
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref2">
    <label>2</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Das, H., Devi, N.S., Venu, N. and Borah, A. (2023) Chapter 3. Chemical Fertilizer and Its Effects on the Soil Environment. In: Research and Review in Agriculture Sciences, Bright Sky Publications, 7.
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref3">
    <label>3</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Pan, X.Y. and Zhang, F. (2020) Advances in Biological Control of the German Cockroach, Blattella germanica (L.). Biological Control, 142, Article ID: 104104. &gt;https://doi.org/10.1016/j.biocontrol.2019.104104
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref4">
    <label>4</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zélé, F., Altıntaş, M., Santos, I., Cakmak, I. and Magalhães, S. (2020) Inter-and Intraspecific Variation of Spider Mite Susceptibility to Fungal Infections: Implications for the Long-Term Success of Biological Control. Ecology and Evolution, 10, 3209-3221. &gt;https://doi.org/10.1002/ece3.5958
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref5">
    <label>5</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Alagesan, A., Padmanaban, B., Tharani, G., Jawahar, S. and Manivannan, S. (2019) An Assessment of Biological Control of the Banana Pseudostem Weevil Odoiporus longicollis (Olivier) by Entomopathogenic Fungi Beauveria bassiana. Biocatalysis and Agricultural Biotechnology, 20, Article ID: 101262. &gt;https://doi.org/10.1016/j.bcab.2019.101262
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref6">
    <label>6</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zimmermann, G. (2007) Review on Safety of the Entomopathogenic Fungi Beauveria bassiana and Beauveria brongniartii. Biocontrol Science and Technology, 17, 553-596. &gt;https://doi.org/10.1080/09583150701309006
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref7">
    <label>7</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Faria, M.R.d. and Wraight, S.P. (2007) Mycoinsecticides and Mycoacaricides: A Comprehensive List with Worldwide Coverage and International Classification of Formulation Types. Biological Control, 43, 237-256. &gt;https://doi.org/10.1016/j.biocontrol.2007.08.001
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref8">
    <label>8</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Wright, M.S. and Lax, A.R. (2015) Improved Mortality of the Formosan Subterranean Termite by Fungi, When Amended with Cuticle-Degrading Enzymes or Eicosanoid Biosynthesis Inhibitors. Folia Microbiologica, 61, 73-83. &gt;https://doi.org/10.1007/s12223-015-0412-0
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref9">
    <label>9</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Pedrini, N., Crespo, R. and Juárez, M.P. (2007) Biochemistry of Insect Epicuticle Degradation by Entomopathogenic Fungi. Comparative Biochemistry and Physiology Part C: Toxicology&amp;Pharmacology, 146, 124-137. &gt;https://doi.org/10.1016/j.cbpc.2006.08.003
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref10">
    <label>10</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Pedrini, N., Ortiz-Urquiza, A., Huarte-Bonnet, C., Zhang, S. and Keyhani, N.O. (2013) Targeting of Insect Epicuticular Lipids by the Entomopathogenic Fungus Beauveria bassiana: Hydrocarbon Oxidation within the Context of a Host-Pathogen Interaction. Frontiers in Microbiology, 4, Article No. 24. &gt;https://doi.org/10.3389/fmicb.2013.00024
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref11">
    <label>11</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mascarin, G.M. and Jaronski, S.T. (2016) The Production and Uses of Beauveria bassiana as a Microbial Insecticide. World Journal of Microbiology and Biotechnology, 32, Article No. 177. &gt;https://doi.org/10.1007/s11274-016-2131-3
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref12">
    <label>12</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bing, L.A. and Lewis, L.C. (1992) Endophytic Beauveria bassiana (Balsamo) Vuillemin in Corn: The Influence of the Plant Growth Stage and Ostrinia nubilalis (Hübner). Biocontrol Science and Technology, 2, 39-47. &gt;https://doi.org/10.1080/09583159209355216
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref13">
    <label>13</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Arab, Y.A. and El-Deeb, H.M. (2012) The Use of Endophyte Beauveria bassiana for Bio-Protection of Date Palm Seedlings against Red Palm Weevil and Rhizoctonia Root-Rot Disease. Scientific Journal of King Faisal University Basic and Applied Sciences, 13, 91-101.
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref14">
    <label>14</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Griﬃn, M., Ownley, B., Klingeman, W. and Pereira, R. (2006) Evidence of Induced Systemic Resistance with Beauveria bassiana against Xanthomonas in Cotton. Phyto-pathology, 96, S42.
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref15">
    <label>15</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Jaber, L.R. and Salem, N.M. (2014) Endophytic Colonisation of Squash by the Fungal Entomopathogen Beauveria bassiana (Ascomycota: Hypocreales) for Managing Zucchini Yellow Mosaic Virus in Cucurbits. Biocontrol Science and Technology, 24, 1096-1109. &gt;https://doi.org/10.1080/09583157.2014.923379
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref16">
    <label>16</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Jaber, L.R. (2014) Grapevine Leaf Tissue Colonization by the Fungal Entomopathogen Beauveria bassiana S.l. and Its Effect against Downy Mildew. BioControl, 60, 103-112. &gt;https://doi.org/10.1007/s10526-014-9618-3
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref17">
    <label>17</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bamisile, B.S., Dash, C.K., Akutse, K.S., Keppanan, R. and Wang, L. (2018) Fungal Endophytes: Beyond Herbivore Management. Frontiers in Microbiology, 9, Article No. 544. &gt;https://doi.org/10.3389/fmicb.2018.00544
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref18">
    <label>18</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Vega, F.E., Posada, F., Catherine Aime, M., Pava-Ripoll, M., Infante, F. and Rehner, S.A. (2008) Entomopathogenic Fungal Endophytes. Biological Control, 46, 72-82. &gt;https://doi.org/10.1016/j.biocontrol.2008.01.008
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref19">
    <label>19</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Vega, F.E., Meyling, N.V., Luangsa-ard, J.J. and Blackwell, M. (2012) Fungal Entomopathogens. In: Vega, F.E. and Kaya, H.K., Eds., Insect Pathology, Elsevier, 171-220. &gt;https://doi.org/10.1016/b978-0-12-384984-7.00006-3
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref20">
    <label>20</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Vega, F.E. (2018) The Use of Fungal Entomopathogens as Endophytes in Biological Control: A Review. Mycologia, 110, 4-30. &gt;https://doi.org/10.1080/00275514.2017.1418578
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref21">
    <label>21</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Vidal, S. and Jaber, L.R. (2015) Entomopathogenic Fungi as Endophytes: Plant-Endophyte-Herbivore Interactions and Prospects for Use in Biological Control. Current Science, 109, 46-54. &gt;https://www.jstor.org/stable/24905690
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref22">
    <label>22</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Gurulingappa, P., Sword, G.A., Murdoch, G. and McGee, P.A. (2010) Colonization of Crop Plants by Fungal Entomopathogens and Their Effects on Two Insect Pests When in Planta. Biological Control, 55, 34-41. &gt;https://doi.org/10.1016/j.biocontrol.2010.06.011
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref23">
    <label>23</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ownley, B.H., Griffin, M.R., Klingeman, W.E., Gwinn, K.D., Moulton, J.K. and Pereira, R.M. (2008) Beauveria bassiana: Endophytic Colonization and Plant Disease Control. Journal of Invertebrate Pathology, 98, 267-270. &gt;https://doi.org/10.1016/j.jip.2008.01.010
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref24">
    <label>24</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Parsa, S., Ortiz, V. and Vega, F.E. (2013) Establishing Fungal Entomopathogens as Endophytes: Towards Endophytic Biological Control. Journal of Visualized Experiments, 74, e50360. &gt;https://doi.org/10.3791/50360
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref25">
    <label>25</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Suryanarayanan, T.S. (2013) Endophyte Research: Going Beyond Isolation and Metabolite Documentation. Fungal Ecology, 6, 561-568. &gt;https://doi.org/10.1016/j.funeco.2013.09.007
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref26">
    <label>26</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Hardoim, P.R., van Overbeek, L.S., Berg, G., Pirttilä, A.M., Compant, S., Campisano, A., et al. (2015) The Hidden World within Plants: Ecological and Evolutionary Considerations for Defining Functioning of Microbial Endophytes. Microbiology and Molecular Biology Reviews, 79, 293-320. &gt;https://doi.org/10.1128/mmbr.00050-14
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref27">
    <label>27</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Backman, P.A. and Sikora, R.A. (2008) Endophytes: An Emerging Tool for Biological Control. Biological Control, 46, 1-3. &gt;https://doi.org/10.1016/j.biocontrol.2008.03.009
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref28">
    <label>28</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Jaber, L.R. and Ownley, B.H. (2018) Can We Use Entomopathogenic Fungi as Endophytes for Dual Biological Control of Insect Pests and Plant Pathogens? Biological Control, 116, 36-45. &gt;https://doi.org/10.1016/j.biocontrol.2017.01.018
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref29">
    <label>29</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Pachoute, J. and Souza, D.J.D. (2024) Effects of Beauveria bassiana (Bals.-Criv.) Vuill. on the Growth of Vigna Unguiculata (Linnaeus) Walpers under Laboratory and Field Conditions, and the Resistance of the Plant to Insect Attack. EntomoBrasilis, 17, e1064. &gt;https://doi.org/10.12741/ebrasilis.v17.e1064
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref30">
    <label>30</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lingg, A.J. and Donaldson, M.D. (1981) Biotic and Abiotic Factors Affecting Stability of Beauveria bassiana Conidia in Soil. Journal of Invertebrate Pathology, 38, 191-200. &gt;https://doi.org/10.1016/0022-2011(81)90122-1
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref31">
    <label>31</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Fernandes, É.K.K., Rangel, D.E.N., Moraes, Á.M.L., Bittencourt, V.R.E.P. and Roberts, D.W. (2007) Variability in Tolerance to UV-B Radiation among Beauveria Spp. Isolates. Journal of Invertebrate Pathology, 96, 237-243. &gt;https://doi.org/10.1016/j.jip.2007.05.007
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref32">
    <label>32</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Barreto, L.P., Luz, C., Mascarin, G.M., Roberts, D.W., Arruda, W. and Fernandes, É.K.K. (2016) Effect of Heat Stress and Oil Formulation on Conidial Germination of Metarhizium anisopliae s.s. on Tick Cuticle and Artificial Medium. Journal of Invertebrate Pathology, 138, 94-103. &gt;https://doi.org/10.1016/j.jip.2016.06.007
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref33">
    <label>33</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Acheampong, M.A., Hill, M.P., Moore, S.D. and Coombes, C.A. (2020) UV Sensitivity of Beauveria bassiana and Metarhizium anisopliae Isolates under Investigation as Potential Biological Control Agents in South African Citrus Orchards. Fungal Biology, 124, 304-310. &gt;https://doi.org/10.1016/j.funbio.2019.08.009
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref34">
    <label>34</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mascarin, G.M., Shrestha, S., Christopher, A., Dunlap, C.A., Ramirez, J.L. and Cole-man, J.J. (2024) Enhanced Virulence through Genetic Engineering of Beauveria bassiana Blastospores by Overexpression of a Cuticle-Degrading Endochitinase. &gt;https://doi.org/10.21203/rs.3.rs-4284564/v1
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref35">
    <label>35</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zárate-Rivas, F., Reyes-López, D., Vázquez-Cruz, F. and Hernández-Domínguez, C. (2024) Diatomaceous Earth and Beauveria bassiana in Polyvinyl Alcohol Matrices, a Combined Effect for Pi-Eris Brassicae Control. Biotecnia, 26, 249-255. &gt;https://doi.org/10.18633/biotecnia.v26.2124
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref36">
    <label>36</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Iwanicki, N.S., Lopes, E.C.M., de Lira, A.C., Poletto, T.B., Fonceca, L.Z. and Delalibera Júnior, I. (2023) Comparative Analysis of Beauveria bassiana Submerged Conidia with Blastospores: Yield, Growth Kinetics, and Virulence. Biological Control, 185, Article ID: 105314. &gt;https://doi.org/10.1016/j.biocontrol.2023.105314
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref37">
    <label>37</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Carlson, G.A. (1988) Economics of Biological Control of Pests. American Journal of Alternative Agriculture, 3, 110-116. &gt;https://doi.org/10.1017/s0889189300002277
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref38">
    <label>38</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     McFadyen, R. (2008) Return on Investment: Determining the Economic Impact of Biological Control Programs. Proceeding of XII International Symposium on Biological Control of Weeds, Cooperative Research Centre for Australian Weed Management, Australia, 67-74.
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref39">
    <label>39</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Humber, R.A. (2012) Identification of Entomopathogenic Fungi. In: Lacey, L.A., Ed., Manual of Techniques in Invertebrate Pathology, Elsevier, 151-187. &gt;https://doi.org/10.1016/b978-0-12-386899-2.00006-3
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref40">
    <label>40</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rehner, S.A., Minnis, A.M., Sung, G., Luangsa-ard, J.J., Devotto, L. and Humber, R.A. (2011) Phylogeny and Systematics of the Anamorphic, Entomopathogenic Genus Beauveria. Mycologia, 103, 1055-1073. &gt;https://doi.org/10.3852/10-302
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref41">
    <label>41</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lacey, L.A. (2012) Manual of Techniques in Invertebrate Pathology. Academic Press.
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref42">
    <label>42</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Barta, M. (2011) Endophytic Beauveria bassiana: Its Natural Occurrence in the Mlyňany Arboretum SAS and Laboratory Inoculation of Musa acuminata Tissue. In: COST FA1103 Workgroups Meeting Endophytes: From Discovery to Application, Arborètum Mlyňany Slovenskej akadèmie vied, Italy.
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref43">
    <label>43</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Masoudi, A., Koprowski, J.L., Bhattarai, U.R. and Wang, D. (2017) Elevational Distribution and Morphological Attributes of the Entomopathogenic Fungi from Forests of the Qinling Mountains in China. Applied Microbiology and Biotechnology, 102, 1483-1499. &gt;https://doi.org/10.1007/s00253-017-8651-4
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref44">
    <label>44</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Petrini, O. and Fisher, P.J. (1986) Fungal Endophytes in Salicornia Perennis. Transactions of the British Mycological Society, 87, 647-651. &gt;https://doi.org/10.1016/s0007-1536(86)80109-7
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref45">
    <label>45</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In: Innis, M.A., et al., Eds., PCR Protocols, Elsevier, 315-322. &gt;https://doi.org/10.1016/b978-0-12-372180-8.50042-1
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref46">
    <label>46</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rehner, S.A. and Buckley, E. (2005) A Beauveria Phylogeny Inferred from Nuclear ITS and EF1-Sequences: Evidence for Cryptic Diversification and Links to Cordyceps Teleomorphs. Mycologia, 97, 84-98. &gt;https://doi.org/10.3852/mycologia.97.1.84
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref47">
    <label>47</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Kumar, S., Stecher, G. and Tamura, K. (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33, 1870-1874. &gt;https://doi.org/10.1093/molbev/msw054
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref48">
    <label>48</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     EU-OSHA (European Agency for Safety and Health at Work) (2019) Exposure to Biological Agents and Related Health Problems in Arable Farming—Discussion Paper. Publications Office of the European Union. &gt;https://osha.europa.eu/en/publications
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref49">
    <label>49</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     EU-OSHA (European Agency for Safety and Health at Work) (2019) Exposure to Biological Agents and Related Health Effects in the Waste Management and Wastewater Treatment Sectors. Discussion Paper, Publications Office of the Euro-pean Union. &gt;https://osha.europa.eu/en/publications
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref50">
    <label>50</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Paroli, M.P., Abbouda, A., Abicca, I., Sapìa, A. and Paroli, M. (2013) Biological Agents in the Treatment of Uveitis. Advances in Bioscience and Biotechnology, 4, 64-72. &gt;https://doi.org/10.4236/abb.2013.48a2009
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref51">
    <label>51</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Liu, Y., Zou, X., Cheng, S. and Zhang, Z. (2024) Progress in the Use of Glucocorticoids and Biological Agents in Non-Infectious Uveitis. Journal of Biosciences and Medicines, 12, 138-155. &gt;https://doi.org/10.4236/jbm.2024.122011
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref52">
    <label>52</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Charif, R., Waack, A. and Strickman, L. (2010) Raven Pro 1.4. User’s Manual. Idaho National Lab.
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref53">
    <label>53</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Francardi, V., Benvenuti, C., Barzantie, G. and Roversi, P.E. (2013) Autocontamination Trap with Entomopathogenic Fungi: A Possible Strategy in the Control of Rhynchophorus ferrugineus (Olivier) (Coleoptera Curculionidae). Redia, 96, 57-67.
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref54">
    <label>54</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Hassan, F., Abdullah, S. and Assaf, L. (2020) Molecular Identification and Biomass Production of an Endophytic Beauveria bassiana Isolated from Cucumber Leaves in Iraq. The Journal of The University of Duhok, 22, 38-47. &gt;https://doi.org/10.26682/cajuod.2020.22.2.5
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref55">
    <label>55</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Biswas, C., Dey, P., Satpathy, S. and Satya, P. (2011) Establishment of the Fungal Entomopathogen Beauveria bassiana as a Season Long Endophyte in Jute (Corchorus olitorius) and Its Rapid Detection Using SCAR Marker. BioControl, 57, 565-571. &gt;https://doi.org/10.1007/s10526-011-9424-0
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref56">
    <label>56</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Jaber, L.R. and Araj, S. (2018) Interactions among Endophytic Fungal Entomopathogens (Ascomycota: Hypocreales), the Green Peach Aphid Myzus persicae Sulzer (Homoptera: Aphididae), and the Aphid Endoparasitoid Aphidius colemani Viereck (Hymenoptera: Braconidae). Biological Control, 116, 53-61. &gt;https://doi.org/10.1016/j.biocontrol.2017.04.005
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref57">
    <label>57</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Quesada-Moraga, E., Landa, B.B., Muñoz-Ledesma, J., Jiménez-Diáz, R.M. and Santiago-Álvarez, C. (2006) Endophytic Colonisation of Opium Poppy, Papaver somniferum, by an Entomopathogenic Beauveria bassiana Strain. Mycopathologia, 161, 323-329. &gt;https://doi.org/10.1007/s11046-006-0014-0
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref58">
    <label>58</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Tefera, T. and Vidal, S. (2009) Effect of Inoculation Method and Plant Growth Medium on Endophytic Colonization of Sorghum by the Entomopathogenic Fungus Beauveria bassiana. BioControl, 54, 663-669. &gt;https://doi.org/10.1007/s10526-009-9216-y
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref59">
    <label>59</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Russo, M.L., Pelizza, S.A., Cabello, M.N., Stenglein, S.A. and Scorsetti, A.C. (2014) Endophytic Colonisation of Tobacco, Corn, Wheat and Soybeans by the Fungal Entomopathogen Beauveria bassiana (Ascomycota, Hypocreales). Biocontrol Science and Technology, 25, 475-480. &gt;https://doi.org/10.1080/09583157.2014.982511
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref60">
    <label>60</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Russo, M.L., Pelizza, S.A., Vianna, M.F., Allegrucci, N., Cabello, M.N., Toledo, A.V., et al. (2019) Effect of Endophytic Entomopathogenic Fungi on Soybean Glycine max (L.) Merr. Growth and Yield. Journal of King Saud University—Science, 31, 728-736. &gt;https://doi.org/10.1016/j.jksus.2018.04.008
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref61">
    <label>61</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Greenfield, M., Gómez-Jiménez, M.I., Ortiz, V., Vega, F.E., Kramer, M. and Parsa, S. (2016) Beauveria bassiana and Metarhizium anisopliae Endophytically Colonize Cassava Roots Following Soil Drench Inoculation. Biological Control, 95, 40-48. &gt;https://doi.org/10.1016/j.biocontrol.2016.01.002
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref62">
    <label>62</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Qayyum, M.A., Wakil, W., Arif, M.J., Sahi, S.T. and Dunlap, C.A. (2015) Infection of Helicoverpa armigera by Endophytic Beauveria bassiana Colonizing Tomato Plants. Biological Control, 90, 200-207. &gt;https://doi.org/10.1016/j.biocontrol.2015.04.005
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref63">
    <label>63</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Sinno, M., Ranesi, M., Di Lelio, I., Iacomino, G., Becchimanzi, A., Barra, E., et al. (2021) Selection of Endophytic Beauveria bassiana as a Dual Biocontrol Agent of Tomato Pathogens and Pests. Pathogens, 10, Article No. 1242. &gt;https://doi.org/10.3390/pathogens10101242
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref64">
    <label>64</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Akutse, K.S., Maniania, N.K., Fiaboe, K.K.M., Van den Berg, J. and Ekesi, S. (2013) Endophytic Colonization of Vicia faba and Phaseolus vulgaris (Fabaceae) by Fungal Pathogens and Their Effects on the Life-History Parameters of Liriomyza huidobrensis (Diptera: Agromyzidae). Fungal Ecology, 6, 293-301. &gt;https://doi.org/10.1016/j.funeco.2013.01.003
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref65">
    <label>65</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Garrido-Jurado, I., Resquín-Romero, G., Amarilla, S.P., Ríos-Moreno, A., Carrasco, L. and Quesada-Moraga, E. (2016) Transient Endophytic Colonization of Melon Plants by Entomopathogenic Fungi after Foliar Application for the Control of Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae). Journal of Pest Science, 90, 319-330. &gt;https://doi.org/10.1007/s10340-016-0767-2
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref66">
    <label>66</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Landa, B.B., López-Díaz, C., Jiménez-Fernández, D., Montes-Borrego, M., Muñoz-Ledesma, F.J., Ortiz-Urquiza, A., et al. (2013) In-Planta Detection and Monitorization of Endophytic Colonization by a Beauveria bassiana Strain Using a New-Developed Nested and Quantitative PCR-Based Assay and Confocal Laser Scanning Microscopy. Journal of Invertebrate Pathology, 114, 128-138. &gt;https://doi.org/10.1016/j.jip.2013.06.007
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref67">
    <label>67</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Thaochan, N., Ngampongsai, A., Prabhakar, C.S. and Hu, Q. (2021) Beauveria bassiana PSUB01 Simultaneously Displays Biocontrol Activity against Lipaphis erysimi (Kalt.) (Hemiptera: Aphididae) and Promotes Plant Growth in Chinese Kale under Hydroponic Growing Conditions. Biocontrol Science and Technology, 31, 997-1015. &gt;https://doi.org/10.1080/09583157.2021.1917512
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref68">
    <label>68</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Kim, J.J., Jeong, G., Han, J.H. and Lee, S. (2013) Biological Control of Aphid Using Fungal Culture and Culture Filtrates of Beauveria bassiana. Mycobiology, 41, 221-224. &gt;https://doi.org/10.5941/myco.2013.41.4.221
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref69">
    <label>69</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Shrestha, B., Hyun, M.W., Oh, J., Han, J., Lee, T.H., Cho, J.Y., et al. (2014) Molecular Evidence of a Teleomorph-Anamorph Connection between Cordyceps scarabaeicola and Beauveria sungii and Its Implication for the Systematics of Cordyceps Sensu Stricto. Mycoscience, 55, 231-239. &gt;https://doi.org/10.1016/j.myc.2013.09.004
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref70">
    <label>70</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Jaber, L.R. and Enkerli, J. (2016) Fungal Entomopathogens as Endophytes: Can They Promote Plant Growth? Biocontrol Science and Technology, 27, 28-41. &gt;https://doi.org/10.1080/09583157.2016.1243227
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref71">
    <label>71</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Trissi, A.N., El Bouhsini, M., Alsalti, M.N., von Korff, M., Hamwieh, A., Skinner, M., et al. (2013) Genetic Diversity among Summer and Winter Beauveria bassiana Populations as Revealed by AFLP Analysis. Journal of Asia-Pacific Entomology, 16, 269-273. &gt;https://doi.org/10.1016/j.aspen.2013.03.006
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref72">
    <label>72</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Hartley, S.E. and Gange, A.C. (2009) Impacts of Plant Symbiotic Fungi on Insect Herbivores: Mutualism in a Multitrophic Context. Annual Review of Entomology, 54, 323-342. &gt;https://doi.org/10.1146/annurev.ento.54.110807.090614
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref73">
    <label>73</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mantzoukas, S. and Lagogiannis, I. (2019) Endophytic Colonization of Pepper (Capsicum annuum) Controls Aphids (Myzus persicae Sulzer). Applied Sciences, 9, Article No. 2239. &gt;https://doi.org/10.3390/app9112239
    </mixed-citation>
   </ref>
   <ref id="scirp.136580-ref74">
    <label>74</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Doolotkeldieva, T. and Ismailova, E. (2022) In Vitro and in Vivo Screening of Beauveria bassiana Strains for Endophytic and Insecticide Activity. Proceedings of IV International Agricultural, Biological and Life Science Conference, Edirne, 29-31 August 2022, 29-31.
    </mixed-citation>
   </ref>
  </ref-list>
 </back>
</article>