<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article">
 <front>
  <journal-meta>
   <journal-id journal-id-type="publisher-id">
    as
   </journal-id>
   <journal-title-group>
    <journal-title>
     Agricultural Sciences
    </journal-title>
   </journal-title-group>
   <issn pub-type="epub">
    2156-8553
   </issn>
   <issn publication-format="print">
    2156-8561
   </issn>
   <publisher>
    <publisher-name>
     Scientific Research Publishing
    </publisher-name>
   </publisher>
  </journal-meta>
  <article-meta>
   <article-id pub-id-type="doi">
    10.4236/as.2024.158048
   </article-id>
   <article-id pub-id-type="publisher-id">
    as-135227
   </article-id>
   <article-categories>
    <subj-group subj-group-type="heading">
     <subject>
      Articles
     </subject>
    </subj-group>
    <subj-group subj-group-type="Discipline-v2">
     <subject>
      Biomedical 
     </subject>
     <subject>
       Life Sciences, Earth 
     </subject>
     <subject>
       Environmental Sciences
     </subject>
    </subj-group>
   </article-categories>
   <title-group>
    East African Cassava Mosaic Virus and East African Cassava Mosaic Cameroon Virus: Two Species Emerging in Togo
   </title-group>
   <contrib-group>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Senya Sakina
      </surname>
      <given-names>
       Allado
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Kossikouma Djodji
      </surname>
      <given-names>
       Adjata
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Justin Simon
      </surname>
      <given-names>
       Pita
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Kodjovi Atassé
      </surname>
      <given-names>
       Dansou-Kodjo
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Assion Sétu
      </surname>
      <given-names>
       Mivedor
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Koffi
      </surname>
      <given-names>
       Tozo
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff3"> 
      <sup>3</sup>
     </xref>
    </contrib>
   </contrib-group> 
   <aff id="aff1">
    <addr-line>
     aLaboratoire de Virologie et de Biotechnologies Végétales, Ecole Supérieure d’Agronomie (ESA), Université de Lomé, Lomé, Togo
    </addr-line> 
   </aff> 
   <aff id="aff2">
    <addr-line>
     aLaboratory of Plant Virology, Université Félix Houphouët-Boigny, Pôle Scientifique et d’Innovation, Bingerville, Côte d’Ivoire
    </addr-line> 
   </aff> 
   <aff id="aff3">
    <addr-line>
     aLaboratoire de Physiologie et Biotechnologies Végétales, Faculté des Sciences, Université de Lomé, Lomé, Togo
    </addr-line> 
   </aff> 
   <pub-date pub-type="epub">
    <day>
     01
    </day> 
    <month>
     08
    </month>
    <year>
     2024
    </year>
   </pub-date> 
   <volume>
    15
   </volume> 
   <issue>
    08
   </issue>
   <fpage>
    864
   </fpage>
   <lpage>
    876
   </lpage>
   <history>
    <date date-type="received">
     <day>
      8,
     </day>
     <month>
      July
     </month>
     <year>
      2024
     </year>
    </date>
    <date date-type="published">
     <day>
      11,
     </day>
     <month>
      July
     </month>
     <year>
      2024
     </year> 
    </date> 
    <date date-type="accepted">
     <day>
      11,
     </day>
     <month>
      July
     </month>
     <year>
      2024
     </year> 
    </date>
   </history>
   <permissions>
    <copyright-statement>
     © Copyright 2014 by authors and Scientific Research Publishing Inc. 
    </copyright-statement>
    <copyright-year>
     2014
    </copyright-year>
    <license>
     <license-p>
      This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/
     </license-p>
    </license>
   </permissions>
   <abstract>
    Cassava mosaic disease (CMD) caused by the whitefly-transmitted Begomoviruses (family Geminiviridae) is a major threat to production of cassava (Manihot esculenta Crantz) in Togo. Survey was conducted in 2020 in the 5 agroecological zones of Togo to assess the status of East African cassava mosaic virus (EACMV), East African cassava mosaic Cameroon virus (EACMCMV) and its distribution. Polymerase chain reaction (PCR) and Sanger sequencing were used for the detection of cassava mosaic Begomoviruses (CMBs) in the sampled leaves. The incidence of EACMV was 47.93% (278/580) and varied between 41.30% (Zone V) and 62.29% (Zone IV) across the agroecological zone but no significant difference was observed. The EACMCMV incidence was 13.67% (38/278) and varied significantly (p ≤ 0.001) through the agroecological zone. Phylogenetic analysis of the viral isolates showed that they are closely related to those from Nigeria, Ghana, and Ivory coast. Nucleotide sequence analysis of CP revealed an overall genetic diversity (π) of around 3.4%. These results showed that EACMV was the predominant virus and that EACMCMV incidence could be more widespread in Togo.
   </abstract>
   <kwd-group> 
    <kwd>
     Begomovirus
    </kwd> 
    <kwd>
      PCR
    </kwd> 
    <kwd>
      EACMV
    </kwd> 
    <kwd>
      EACMCMV
    </kwd> 
    <kwd>
      Togo
    </kwd> 
    <kwd>
      Genetic Diversity
    </kwd>
   </kwd-group>
  </article-meta>
 </front>
 <body>
  <sec id="s1">
   <title>1. Introduction</title>
   <p>Cassava (Manihot esculenta Crantz) is recognized as one of the most important tuber crops cultivated in tropical and subtropic regions, providing a major source of food to more than 800 million people worldwide <xref ref-type="bibr" rid="scirp.135227-1">
     [1]
    </xref>. In Togo, cassava is the important largest food crop with an annual production estimated at 1.15 million tons <xref ref-type="bibr" rid="scirp.135227-2">
     [2]
    </xref> and its diversity of processing. Despite its many advantages, cassava production is affected by dozens of factors across the producing countries, including <xref ref-type="bibr" rid="scirp.135227-3">
     [3]
    </xref> especially Cassava Mosaic Disease (CMD). CMD is caused by a group of viruses commonly referred to as Cassava Mosaic Begomoviruses (CMBs), belonging to the genus Begomovirus in the family Geminiviridae <xref ref-type="bibr" rid="scirp.135227-4">
     [4]
    </xref> <xref ref-type="bibr" rid="scirp.135227-5">
     [5]
    </xref>. It is reported wherever cassava is grown. This disease is spread by a whitefly Bemisia tabaci (Gennadius) or by the infected cuttings used for planting a new field <xref ref-type="bibr" rid="scirp.135227-6">
     [6]
    </xref>. Eleven cassava mosaic Begomovirus (CMB) species have been reported in Africa <xref ref-type="bibr" rid="scirp.135227-7">
     [7]
    </xref>-<xref ref-type="bibr" rid="scirp.135227-11">
     [11]
    </xref> among which African cassava mosaic virus (ACMV), East African cassava mosaic virus (EACMV), and East African cassava mosaic Cameroon virus (EACMCMV) are known to be widely prevalent in sub-Saharan Africa <xref ref-type="bibr" rid="scirp.135227-12">
     [12]
    </xref>. The first studies carried out on the geographical distribution of these viral species suggested that EACMV mainly present in East Africa <xref ref-type="bibr" rid="scirp.135227-13">
     [13]
    </xref> and EACMCMV in Cameroon <xref ref-type="bibr" rid="scirp.135227-7">
     [7]
    </xref>.</p>
   <p>East African cassava mosaic virus (EACMV) and East African cassava mosaic Cameroon virus (EACMCMV) were reported in Togo in 2009 and 2017 <xref ref-type="bibr" rid="scirp.135227-14">
     [14]
    </xref> <xref ref-type="bibr" rid="scirp.135227-15">
     [15]
    </xref>. EACMV in combination with African cassava mosaic virus (ACMV), is the major cause of cassava mosaic disease in sub-Saharan Africa, with attendant important yield reduction of cassava <xref ref-type="bibr" rid="scirp.135227-16">
     [16]
    </xref>. Zhou et al. <xref ref-type="bibr" rid="scirp.135227-17">
     [17]
    </xref> provided evidence of inter-specific recombination of DNAs of ACMV and EACMV to give rise to a strain of EACMV in Uganda (EACMV-Ug).</p>
   <p>The aim of this study is to determine the status of East African Cassava mosaic virus and East African cassava mosaic Cameroon virus on cassava’s farm in Togo. The outcomes could be utilized in the screening of cassava genotypes for resistance to cassava mosaic disease (CMD) on agroecological zones.</p>
  </sec><sec id="s2">
   <title>2. Material and Methods</title>
   <sec id="s2_1">
    <title>2.1. Collection of Cassava Leaves</title>
    <p>Surveys were conducted between August-September 2020 throughout Togo. A total of 580 cassava leaves with characteristic CMD symptoms and CMD-free were collected from farmers’ fields at 3 - 6 months after planting (MAP) located at intervals of between 10 km in five (05) agroecological zones of Togo <xref ref-type="bibr" rid="scirp.135227-18">
      [18]
     </xref>. The agroecological zones were Sudanian savannah (Zone I), dense forests and grassy savannah (Zone II), Guinean wooded savannah, clear forests and discontinuous forests along the main rivers (Zone III). Agroecological zone IV corresponds to the humid and semi-deciduous forests zone and Zone V is located at the extreme south of the country with fallow land, thickets, bushes, derived and coastal grassland savannah <xref ref-type="bibr" rid="scirp.135227-19">
      [19]
     </xref>.</p>
    <p>The collection of samples was done following the random method based on the presence of viral symptoms. The latitude and longitude of each farm were recorded using Global Positioning System equipment (Garmin GPSMAP 64s) and the software QGIS 2.4.0 was used to superimpose on the agroecological map of Togo.</p>
    <p>Symptom severity of CMD was rated on a 1 to 5 scale as described by ITTA <xref ref-type="bibr" rid="scirp.135227-20">
      [20]
     </xref> where 1 = asymptomatic, 2 = Mild symptom, 3 = Moderate symptom, 4 = Severe symptom and 5 = Very severe symptom. The samples were kept in the envelopes and dried at 25˚C.</p>
   </sec>
   <sec id="s2_2">
    <title>2.2. DNA Extraction</title>
    <p>Total DNAs were extracted from 100 mg of leaf tissue of infected plants. Total DNA was extracted from leaf samples using InnuPREP Plant DNA Kit (Endress + hauser Compagny, Germany) according to the manufacturer’s instructions. The extracted DNA was stored at −20˚C for analysis. The concentration and purity of extracted DNA samples were determined using a Nano Drop spectrophotometer (Thermo Scientific, Nano drop-2000C, Germany).</p>
   </sec>
   <sec id="s2_3">
    <title>2.3. Molecular characterization of Cassava Mosaic Begomoviruses</title>
    <p>The DNA samples of the cassava were tested for the presence or absence of CMB using primers that could detect EACMV and EACMCMV. Four (04) primers pairs were used (<xref ref-type="table" rid="table1">
      Table 1
     </xref>). The samples positive for EACMV virus were subjected to another round of PCR using specific primers for the detection of EACMCMV (VNF031/VNF032).</p>
    <p>The PCR mixture (25 µL) contained 12.5 µL Master Mix (New England Biolab, NEB), 1.25 µL each of forward and reverse primers (10 µM), 8 µL nuclease free PCR water (Inqaba Biotech West Africa Ltd) and 2 µL DNA. The PCR conditions used are those described by the various authors in <xref ref-type="table" rid="table1">
      Table 1
     </xref>. The DNA amplification was carried out in the Applied Bio systems Thermal Cycler. The PCR amplified products were separated by agarose gel electrophoresis on 1% (which was stained with ethidium bromide) for 100 V for 35 min in 1% TBE</p>
    <table-wrap id="table1">
     <label>
      <xref ref-type="table" rid="table1">
       Table 1
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.135227-"></xref>Table 1. Primers pairs used for the amplification of CMBs.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="15.58%"><p style="text-align:center">Primer Name</p></td> 
       <td class="custom-bottom-td acenter" width="12.59%"><p style="text-align:center">Virus</p></td> 
       <td class="custom-bottom-td acenter" width="36.97%"><p style="text-align:center">Primer sequence (5’ 3’)</p></td> 
       <td class="custom-bottom-td acenter" width="11.54%"><p style="text-align:center">Tm (˚C)</p></td> 
       <td class="custom-bottom-td acenter" width="11.74%"><p style="text-align:center">Amplicon (bp)</p></td> 
       <td class="custom-bottom-td acenter" width="11.57%"><p style="text-align:center">References</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td acenter" width="15.58%"><p style="text-align:center">JSP001</p></td> 
       <td rowspan="6" class="custom-top-td acenter" width="12.59%"><p style="text-align:center">EACMV</p></td> 
       <td class="custom-top-td acenter" width="36.97%"><p style="text-align:center">ATGTCGAAGCGACCAGGAGAT</p></td> 
       <td rowspan="2" class="custom-top-td acenter" width="11.54%"><p style="text-align:center">55</p></td> 
       <td rowspan="2" class="custom-top-td acenter" width="11.74%"><p style="text-align:center">780</p></td> 
       <td rowspan="2" class="custom-top-td acenter" width="11.57%"><p style="text-align:center">
         <xref ref-type="bibr" rid="scirp.135227-21">
          [21]
         </xref></p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.58%"><p style="text-align:center">JSP003</p></td> 
       <td class="acenter" width="36.97%"><p style="text-align:center">CCTTTATTAATTTGTCACTGC</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.58%"><p style="text-align:center">CMBRep F</p></td> 
       <td class="acenter" width="36.97%"><p style="text-align:center">CRTCAATGACGTTGTACCA</p></td> 
       <td rowspan="2" class="acenter" width="11.54%"><p style="text-align:center">56</p></td> 
       <td rowspan="2" class="acenter" width="11.74%"><p style="text-align:center">650</p></td> 
       <td rowspan="2" class="acenter" width="11.57%"><p style="text-align:center">
         <xref ref-type="bibr" rid="scirp.135227-22">
          [22]
         </xref></p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.58%"><p style="text-align:center">EACMVRep R</p></td> 
       <td class="acenter" width="36.97%"><p style="text-align:center">GGTTTGCAGAGAACTACATC</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.58%"><p style="text-align:center">EAB555/F</p></td> 
       <td class="acenter" width="36.97%"><p style="text-align:center">TACATCGGCCTTTGAGTCGCATGG</p></td> 
       <td rowspan="2" class="acenter" width="11.54%"><p style="text-align:center">58</p></td> 
       <td rowspan="2" class="acenter" width="11.74%"><p style="text-align:center">550</p></td> 
       <td rowspan="4" class="acenter" width="11.57%"><p style="text-align:center">
         <xref ref-type="bibr" rid="scirp.135227-7">
          [7]
         </xref></p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.58%"><p style="text-align:center">EAB555/R</p></td> 
       <td class="acenter" width="36.97%"><p style="text-align:center">CTTATTAACGCCTATATAAACACC</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.58%"><p style="text-align:center">VNF031/F</p></td> 
       <td rowspan="2" class="acenter" width="12.59%"><p style="text-align:center">EACMCMV</p></td> 
       <td class="acenter" width="36.97%"><p style="text-align:center">GGATACAGATAGGGTTCCCAC</p></td> 
       <td rowspan="2" class="acenter" width="11.54%"><p style="text-align:center">52</p></td> 
       <td rowspan="2" class="acenter" width="11.74%"><p style="text-align:center">560</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="15.58%"><p style="text-align:center">VNF032/R</p></td> 
       <td class="acenter" width="36.97%"><p style="text-align:center">GACGAGGACAAGAATTCCAAT</p></td> 
      </tr> 
     </table>
    </table-wrap>
    <p>Buffer. Bands were viewed under UV light using and the images saved using a gel documentation system (MultiDoc-It Digital Imaging System). PCR products of 24 EACMV and EACMCMV positive samples were directly sequenced in both forward and reverse orientations using the Sanger method at Inqaba Biotec company.</p>
    <p>Disease incidence per field was calculated using the formula below <xref ref-type="bibr" rid="scirp.135227-23">
      [23]
     </xref>:</p>
    <p>
     <math display="inline" xmlns="http://www.w3.org/1998/Math/MathML"> <mrow> 
       <mtext>
         Incidence 
       </mtext> 
       <mo>
         = 
       </mo> 
       <mfrac> 
        <mrow> 
         <mtext>
           Number 
         </mtext> 
         <mtext>
             
         </mtext> 
         <mtext>
           of 
         </mtext> 
         <mtext>
             
         </mtext> 
         <mtext>
           infected 
         </mtext> 
         <mtext>
             
         </mtext> 
         <mtext>
           plants 
         </mtext> 
        </mrow> 
        <mrow> 
         <mtext>
           Total 
         </mtext> 
         <mtext>
             
         </mtext> 
         <mtext>
           number 
         </mtext> 
         <mtext>
             
         </mtext> 
         <mtext>
           of 
         </mtext> 
         <mtext>
             
         </mtext> 
         <mtext>
           plants 
         </mtext> 
        </mrow> 
       </mfrac> 
       <mo>
         × 
       </mo> 
       <mn>
         100 
       </mn> 
      </mrow> 
     </math></p>
   </sec>
   <sec id="s2_4">
    <title>2.4. Phylogenetic Analysis</title>
    <p>The sequence of 24 samples were used phylogenetic analysis. Blastn program was used for preliminary analysis <xref ref-type="bibr" rid="scirp.135227-24">
      [24]
     </xref> using Consensus sequence obtained from forward and re-verse sequences for each sample. Multiple sequences alignment was performed with Clustalw of the Megalign program included in the Lasergene v10.0 software (DNASTAR). The nucleotide diversity (π) was calculated using a 100-nucleotide (nt) sliding window with 25-nt steps using DNAsp 6.0 software <xref ref-type="bibr" rid="scirp.135227-25">
      [25]
     </xref>. Phylogenetic trees were constructed using the Maximum Likelihood (ML) method and the Kimura two parameter (K2) nucleotide substitution model <xref ref-type="bibr" rid="scirp.135227-26">
      [26]
     </xref> The tree was 1000 replicates using MEGA11 <xref ref-type="bibr" rid="scirp.135227-27">
      [27]
     </xref>.</p>
   </sec>
   <sec id="s2_5">
    <title>2.5. Statistical Analysis</title>
    <p>Data analysis was performed using the R software v. 4.3.2. The normality of the variables was determined using the Shapiro-Wilk test and the generalized linear model was used. Statistical analysis of the incidence by agroecological zone were conducted with the analysis of variance (ANOVA) with one criteria of classification. The difference between the means was compared using the LSD test at 5%.</p>
   </sec>
  </sec><sec id="s3">
   <title>3. Results</title>
   <sec id="s3_1">
    <title>3.1. Symptomatology</title>
    <p>Cassava samples collection was carried out in 159 farms surveyed. A total of 580 leaf samples including 392 symptomatic samples and 188 asymptomatic samples were collected. Different types of symptom phenotypes occurred in the different locations in all the surveyed fields. Mosaic, leaf distortion, stunting, and leaf reduction were observed on the symptomatic samples collected (<xref ref-type="fig" rid="fig1">
      Figure 1
     </xref>).</p>
   </sec>
   <sec id="s3_2">
    <title>3.2. Detection of EACMV and EACMCMV Per Agroecological Zone</title>
    <p>Samples analyzed by PCR confirmed the presence of CMD in Togo. PCR amplification with expected sizes of 560 bp and 780 bp were obtained from the cassava samples with VNF031/VNF032, and JSP001/JSP003 respectively (<xref ref-type="fig" rid="fig2">
      Figure 2
     </xref>).</p>
    <p>Out of a total of 580 samples, 65.69% (381/580) were positive by PCR for CMD, 44.31% (257/580) reacted positive with ACMV primers (unpublished result) and 47.93% (278/580) also were positive for EACMV primers. The specific</p>
    <fig id="fig1" position="float">
     <label>Figure 1</label>
     <caption>
      <title>Figure 1. Symptoms of cassava mosaic disease observed on infected cassava plants during the surveys (a) Asymptomatic leaves; (b) Mild mosaic; (c) Moderate mosaic; (d) Severe mosaic.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/3004669-rId17.jpeg?20240814101530" />
    </fig>
    <fig id="fig2" position="float">
     <label>Figure 2</label>
     <caption>
      <title>Figure 2. Agarose gel electrophoresis with primers JSP001/JSP003 identifying EACMV, giving fragments of 780 pb (A) and primers VNF031/VNF032 identifying EACMCMV, giving fragments of 560 pb (B). Lanes 1 = T + (Positive sample), 2 to 8 contained separate cassava samples. M = Marker.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/3004669-rId18.jpeg?20240814101530" />
    </fig>
    <p>primer (VNF031/VNF032) passed on the EACMV positive samples showed that 13.67% (38/278) of positive EACMV were tested positive to EACMCMV. PCR results showed that EACMV and EACMCMV were present in all the 5 agroecological zones. The incidence of EACMV across the agroecological zone varied between 41.30% (Zone V) and 62.29% (Zone IV) but no a significant difference was observed. The EACMCMV incidence varied significantly (p ≤ 0.001) through the agroecological zone. The high incidence was 13% (Zone II) and the lowest 04.92% (Zone IV) (<xref ref-type="table" rid="table2">
      Table 2
     </xref>).</p>
    <table-wrap id="table2">
     <label>
      <xref ref-type="table" rid="table2">
       Table 2
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.135227-"></xref>Table 2. Incidence (%) from samples tested by agroecological zones.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td rowspan="2" class="acenter" width="21.06%"><p style="text-align:center">Agroecological Zone</p></td> 
       <td rowspan="2" class="acenter" width="15.95%"><p style="text-align:center">Tested samples</p></td> 
       <td class="custom-bottom-td acenter" width="31.99%" colspan="2"><p style="text-align:center">EACMV</p></td> 
       <td class="custom-bottom-td acenter" width="31.01%" colspan="2"><p style="text-align:center">EACMCMV</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td custom-top-td acenter" width="17.70%"><p style="text-align:center">Positives samples</p></td> 
       <td class="custom-bottom-td custom-top-td acenter" width="14.29%"><p style="text-align:center">%</p></td> 
       <td class="custom-bottom-td custom-top-td acenter" width="18.22%"><p style="text-align:center">Positives samples</p></td> 
       <td class="custom-bottom-td custom-top-td acenter" width="12.78%"><p style="text-align:center">%</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td acenter" width="21.06%"><p style="text-align:center">Zone I</p></td> 
       <td class="custom-top-td acenter" width="15.95%"><p style="text-align:center">54</p></td> 
       <td class="custom-top-td acenter" width="17.70%"><p style="text-align:center">24</p></td> 
       <td class="custom-top-td acenter" width="14.29%"><p style="text-align:center">44.44 a</p></td> 
       <td class="custom-top-td acenter" width="18.22%"><p style="text-align:center">3</p></td> 
       <td class="custom-top-td acenter" width="12.78%"><p style="text-align:center">12.5 b</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="21.06%"><p style="text-align:center">Zone II</p></td> 
       <td class="acenter" width="15.95%"><p style="text-align:center">100</p></td> 
       <td class="acenter" width="17.70%"><p style="text-align:center">35</p></td> 
       <td class="acenter" width="14.29%"><p style="text-align:center">35 a</p></td> 
       <td class="acenter" width="18.22%"><p style="text-align:center">13</p></td> 
       <td class="acenter" width="12.78%"><p style="text-align:center">37.14 a</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="21.06%"><p style="text-align:center">Zone III</p></td> 
       <td class="acenter" width="15.95%"><p style="text-align:center">120</p></td> 
       <td class="acenter" width="17.70%"><p style="text-align:center">67</p></td> 
       <td class="acenter" width="14.29%"><p style="text-align:center">55.83 a</p></td> 
       <td class="acenter" width="18.22%"><p style="text-align:center">11</p></td> 
       <td class="acenter" width="12.78%"><p style="text-align:center">16.42 b</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="21.06%"><p style="text-align:center">Zone IV</p></td> 
       <td class="acenter" width="15.95%"><p style="text-align:center">122</p></td> 
       <td class="acenter" width="17.70%"><p style="text-align:center">76</p></td> 
       <td class="acenter" width="14.29%"><p style="text-align:center">62.29 a</p></td> 
       <td class="acenter" width="18.22%"><p style="text-align:center">6</p></td> 
       <td class="acenter" width="12.78%"><p style="text-align:center">7.89 b</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="21.06%"><p style="text-align:center">Zone V</p></td> 
       <td class="acenter" width="15.95%"><p style="text-align:center">184</p></td> 
       <td class="acenter" width="17.70%"><p style="text-align:center">76</p></td> 
       <td class="acenter" width="14.29%"><p style="text-align:center">41.30 a</p></td> 
       <td class="acenter" width="18.22%"><p style="text-align:center">5</p></td> 
       <td class="acenter" width="12.78%"><p style="text-align:center">6.54 b</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="21.06%"><p style="text-align:center">Total</p></td> 
       <td class="acenter" width="15.95%"><p style="text-align:center">580</p></td> 
       <td class="acenter" width="17.70%"><p style="text-align:center">278</p></td> 
       <td class="acenter" width="14.29%"><p style="text-align:center">47.93</p></td> 
       <td class="acenter" width="18.22%"><p style="text-align:center">38</p></td> 
       <td class="acenter" width="12.78%"><p style="text-align:center">13.67</p></td> 
      </tr> 
     </table>
    </table-wrap>
    <p>Note: Percentages followed by the same letters are not significantly different.</p>
    <p>EACMCMV occurred in the 5 agroecological zones, <xref ref-type="fig" rid="fig3">
      Figure 3
     </xref> shows its distribution. A near-equitable distribution of EACMCMV was observed in agroecological zones IV and V. In other agroecological zone, the distribution of EACMCMV remains concentrated only in certain prefectures (Zone III: Amou, Tchaoudjo, Tchamba, Sotouboua; Zone II: Kozah, Assoli, Bassar, Tchaoudjo and Zone I: Oti, Binah, Dankpen).</p>
    <fig id="fig3" position="float">
     <label>Figure 3</label>
     <caption>
      <title>Figure 3. Geographical location of EACMCMV on cassava’s farm in Togo.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/3004669-rId19.jpeg?20240814101530" />
    </fig>
   </sec>
   <sec id="s3_3">
    <title>3.3. Phylogenetic Analysis of EACMV and EACMCMV Isolates</title>
    <p>The result of Blastn of sequences in the GenBank database (NCBI) showed that the 24 sequences of EACMV and EACMCMV isolates correspond to those already identified in the sub-region. They shared the highest nucleotide identity (97% - 99%) with EACMV isolates from Nigeria (OM386996.1, OM387001.1, OM387002.1, OM307000.1) and Togo (EU155148.1). The sequences of EACMCMV shared too the highest nucleotide sequence (97% - 99%) with EACMCMV isolates from Nigeria (EU685326.1, EU685321.1, EU685319.1, EU685327.1), Ivory Coast (LC722231.1, AF259896.1, LC722234.1), Ghana (JN165089.1), Madagascar (KJ887944.1, KJ888078.1).</p>
    <p>The obtained sequences were used to study the phylogenetic relationships between viral populations. The construction of the phylogenetic tree by the maximum likelihood (ML) method, revealed that EACMV and EACMCMV isolates are distinguished into 3 groups (G1, G2, G3) (<xref ref-type="fig" rid="fig4">
      Figure 4
     </xref>). Groups 1 contains</p>
    <fig id="fig4" position="float">
     <label>Figure 4</label>
     <caption>
      <title>Figure 4. Maximum-likelihood phylogenetic tree obtained from alignment of nucleotide sequences of East African cassava mosaic virus and East African cassava mosaic Cameroon virus. The names of the sequences characterized in this study are in red.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/3004669-rId20.jpeg?20240814101530" />
    </fig>
    <p>EACMV, EACMCMV isolates from Togo and isolates of Genbank. Groups 2 contains only EACMCMV isolates from Togo and Group 3 EACMV isolates from Togo and Genbank.</p>
    <p>The analysis of the structuring of viral populations according to their geographical origin shows that there is no relationship between the geographical origins and the genetic diversity of the isolates.</p>
    <p>The analysis of the near-total nucleotide sequences of the capsid protein (CP) gene of EACMV and EACMCMV viruses revealed a genetic diversity of 3.4 % with a peak of 4.6% at the terminus. C-terminal (<xref ref-type="fig" rid="fig5">
      Figure 5
     </xref>). The alignment of the CP nucleotide showed that they have 768 nucleotides including 577 variable sites corresponding to 75% of the total sequence.</p>
    <fig id="fig5" position="float">
     <label>Figure 5</label>
     <caption>
      <title>Figure 5. Nucleotide diversity (π) along the EACMV et EACMV capsid protein (CP) gene.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/3004669-rId21.jpeg?20240814101530" />
    </fig>
   </sec>
  </sec><sec id="s4">
   <title>4. Discussion</title>
   <p>In the present study, the status of East African Cassava Mosaic Virus (EACMV) and East African Cassava Mosaic Cameroon Virus (EACMCMV) on cassava’s farm in Togo has been reported. PCR analysis with the 4 pairs of primers specific to EACMV and EACMCMV confirmed the presence of these viruses in the leaf samples, respectively at proportions of 47.93% and 13,67%. EACMV was detected in the majority of CMD-affected cassava leaves, and was the predominant Cassava mosaic Begomovirus species in Togo, which is not consistent with earlier findings in Togo <xref ref-type="bibr" rid="scirp.135227-14">
     [14]
    </xref> <xref ref-type="bibr" rid="scirp.135227-15">
     [15]
    </xref> <xref ref-type="bibr" rid="scirp.135227-28">
     [28]
    </xref>, Burkina Faso <xref ref-type="bibr" rid="scirp.135227-29">
     [29]
    </xref>, Nigeria <xref ref-type="bibr" rid="scirp.135227-30">
     [30]
    </xref> in which they reported ACMV as the frequently detected CMD. These results show that the situation has evolved. Indeed, most samples (47.93%) tested positive for EACMV im-plying that EACMV has displaced ACMV. The use of a large number of primers (04) gives better results, hence a more specific real idea of these diseases in Togo. This finding is similar to an earlier observation by Legg and Thresh <xref ref-type="bibr" rid="scirp.135227-31">
     [31]
    </xref> and Were et al., <xref ref-type="bibr" rid="scirp.135227-32">
     [32]
    </xref>. These authors showed that in post epidemic areas ACMV had been largely displaced by the more virulent EACMV-UG2. This increase could be explained by the exchange of cuttings from diseased plants from East Africa via Cameroon and Nigeria given that phylogenetic analyzes showed that the majority of isolates from Togo would be closer to those from Nigeria. East African cassava mosaic Cameroon virus (EACMCMV) was found in 13.67 % samples that positive for EACMV.</p>
   <p>The expansion of CMD is mainly favored by biological vectors of the disease and by the use of infected cuttings from previous seasons. Similar observations are made by <xref ref-type="bibr" rid="scirp.135227-33">
     [33]
    </xref> and <xref ref-type="bibr" rid="scirp.135227-34">
     [34]
    </xref>, who assimilated the increase in incidence to the recycling of infected cuttings by farmers. The importance of the incidence could also be justified by the high susceptibility to cassava mosaic disease of the sampled cultivars. The high incidence rates observed in various fields suggests that stem cuttings are the likely origin of the virus due of the use of planting materials stems which are often infected by viruses. Sources of inoculum are naturally infected plants when used as planting materials in successive years and also other herbaceous hosts of Begomovirus <xref ref-type="bibr" rid="scirp.135227-22">
     [22]
    </xref> <xref ref-type="bibr" rid="scirp.135227-35">
     [35]
    </xref> <xref ref-type="bibr" rid="scirp.135227-36">
     [36]
    </xref>.</p>
   <p>The majority of EACMV isolates characterized belong to the East African cassava mosaic Cameroon virus (EACMCMV) species first described by Fondong et al., <xref ref-type="bibr" rid="scirp.135227-7">
     [7]
    </xref>. EACMCMV species of cassava mosaic Begomovirus result from two recombination events at ORFs AC2/AC3 <xref ref-type="bibr" rid="scirp.135227-7">
     [7]
    </xref>. East African cassava mosaic Cameroon virus acts in synergy with the African cassava mosaic virus species and is responsible for the expression of severe symptoms on cassava.</p>
   <p>The results from the phylogenetic analysis showed that 3 groups were obtained. Group 2 is made up only of EACMCMV. It should be noted that, the most isolates of EACMV and EACMCMV are specific to Togo. The connection between the sequences of the characterized isolates and those of neighboring countries (Nigeria, Ghana, Ivory Coast, Madagascar) could be explained by the exchanges of plant material between Togo and these countries. It is possible that EACMV was introduced from coastal areas of East Africa, including Madagascar, where the virus is predominant <xref ref-type="bibr" rid="scirp.135227-16">
     [16]
    </xref> <xref ref-type="bibr" rid="scirp.135227-37">
     [37]
    </xref>. Among these countries, Nigeria appears to be the country whose sequences share the most nucleotide identity with the isolates in this study.</p>
   <p>The nucleotide sequences analysis (π) of EACMV and EACMCMV revealed overall low diversity compared to low diversity RNA viruses (3% - 10%) <xref ref-type="bibr" rid="scirp.135227-38">
     [38]
    </xref> <xref ref-type="bibr" rid="scirp.135227-39">
     [39]
    </xref>. The analysis of the distribution of isolates from Togo according to their geographical origins indicates an absence of correlation between the geographical structure and the genetic diversity of EACMV and EACMCMV viruses. This absence of correlation represents ideal conditions for the emergence of interspecific variants which would represent a major epidemiological risk for cassava cultivation in Togo. Previous perennial crop studies investigating Tobacco Mild Green Mosaic Virus (TMGMV) and Citrus Treza Virus (CTV) with results reported similar results <xref ref-type="bibr" rid="scirp.135227-40">
     [40]
    </xref> <xref ref-type="bibr" rid="scirp.135227-41">
     [41]
    </xref>.</p>
   <p>The current work confirms that the situation has rather evolved through the emergence of EACMV viruses, unlike previous work <xref ref-type="bibr" rid="scirp.135227-14">
     [14]
    </xref> <xref ref-type="bibr" rid="scirp.135227-42">
     [42]
    </xref> in Togo between 2010 and 2020. These results show that the presence of EACMCMV and even ACMV could be more widespread in Togo than previously thought. The coexistence of species native to Togo and those of foreign strains of cassava mosaic Begomovirus could cause mixed infections and therefore new recombinations <xref ref-type="bibr" rid="scirp.135227-15">
     [15]
    </xref>.</p>
  </sec><sec id="s5">
   <title>5. Conclusion</title>
   <p>East African cassava mosaic virus (EACMV) and East African cassava mosaic Cameroon virus were characterized in this study. The analysis of the geographical distribution of the isolates obtained suggests that the two species are distributed in the five agroecological zones of Togo. The use of virus-free cuttings of cassava genotypes with enhanced resistance and the varietal improvement remains the most important control option.</p>
  </sec><sec id="s6">
   <title>Acknowledgements</title>
   <p>This research was funded by the Bill and Melinda Gates Foundation and the United Kingdom Foreign, Commonwealth, and Development Office (Grant number OPP1212988) to the Central and West African Virus Epidemiology (WAVE-UL) Program for root and tuber crops.</p>
  </sec>
 </body><back>
  <ref-list>
   <title>References</title>
   <ref id="scirp.135227-ref1">
    <label>1</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     McCallum, E.J., Anjanappa, R.B. and Gruissem, W. (2017) Tackling Agriculturally Relevant Diseases in the Staple Crop Cassava (Manihot esculenta). Current Opinion in Plant Biology, 38, 50-58. &gt;https://doi.org/10.1016/j.pbi.2017.04.008 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref2">
    <label>2</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     FAOSTAT (2022) Statistique de l’Organisation des Nations Unies pour l’alimentation. &gt;https://www.fao.org/faostat/fr/#data/QCL 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref3">
    <label>3</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Tokunaga, H., Baba, T., Ishitani, M., Ito, K., Kim, O., Ham, L.H., et al. (2018) Sustainable Management of Invasive Cassava Pests in Vietnam, Cambodia, and Thailand. In: Kokubun, M. and Asanuma, S., Eds., Crop Production under Stressful Conditions, Springer, 131-157. &gt;https://doi.org/10.1007/978-981-10-7308-3_8 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref4">
    <label>4</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ariyo, O.A., Koerbler, M., Dixon, A.G.O., Atiri, G.I. and Winter, S. (2005) Molecular Variability and Distribution of Cassava Mosaic Begomoviruses in Nigeria. Journal of Phytopathology, 153, 226-231. &gt;https://doi.org/10.1111/j.1439-0434.2005.00958.x 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref5">
    <label>5</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Thottappilly, G., Thresh, J.M., Calvert, L.A. and Winter, S. (2003) Cassava. In: Loebenstein, G. and Thottappilly, G., Eds., Virus and Virus-Like Diseases of Major Crops in Developing Countries, Springer, 107-165. &gt;https://doi.org/10.1007/978-94-007-0791-7_6 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref6">
    <label>6</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Calvert, L.A. and Thresh, J.M. (2001) The Viruses and Virus Diseases of Cassava. In: Hillocks, R.J. and Thresh, J.M., Eds., Cassava: Biology, Production and Utilization, CABI Publishing, 237-260. &gt;https://doi.org/10.1079/9780851995243.0237 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref7">
    <label>7</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Fondong, V.N., Pita, J.S., Rey, M.E.C., de Kochko, A., Beachy, R.N. and Fauquet, C.M. (2000) Evidence of Synergism between African Cassava Mosaic Virus and a New Double-Recombinant Geminivirus Infecting Cassava in Cameroon. Microbiology, 81, 287-297. &gt;https://doi.org/10.1099/0022-1317-81-1-287 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref8">
    <label>8</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bull, S.E., Briddon, R.W., Sserubombwe, W.S., Ngugi, K., Markham, P.G. and Stanley, J. (2006) Genetic Diversity and Phylogeography of Cassava Mosaic Viruses in Kenya. Journal of General Virology, 87, 3053-3065. &gt;https://doi.org/10.1099/vir.0.82013-0 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref9">
    <label>9</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Otim-Nape, G., Bua, A., Thresh, J., Baguma, Y., Ogwal, S., Ssemakula, G., Acola, G., Byabakama, B., Colvin, J. and Cooter, R. (2001) The Current Pandemic of Cassava Mosaic Virus Disease in East Africa and Its Control. Natural Resources Institute.
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref10">
    <label>10</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Maruthi, M.N., Seal, S., Colvin, J., Briddon, R.W. and Bull, S.E. (2004) East African Cassava Mosaic Zanzibar Virus? A Recombinant Begomovirus Species with a Mild Phenotype. Archives of Virology, 149, 2365-2377. &gt;https://doi.org/10.1007/s00705-004-0380-1 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref11">
    <label>11</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Harimalala, M., Chiroleu, F., Giraud‐Carrier, C., Hoareau, M., Zinga, I., Randriamampianina, J.A., et al. (2014) Molecular Epidemiology of Cassava Mosaic Disease in Madagascar. Plant Pathology, 64, 501-507. &gt;https://doi.org/10.1111/ppa.12277 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref12">
    <label>12</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Patil, B.L. and Fauquet, C.M. (2009) Cassava Mosaic Geminiviruses: Actual Knowledge and Perspectives. Molecular Plant Pathology, 10, 685-701. &gt;https://doi.org/10.1111/j.1364-3703.2009.00559.x 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref13">
    <label>13</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Harrison, B.D., Swanson, M.M. and Robinson, D.J. (1995) Second International Scientific Meeting of the Cassava Biotechnology Network, Bogor, Indonesia.
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref14">
    <label>14</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Dansou-Kodjo, K.A., Mivedor, A.S., Adjata, D.K., Duclercq J., Muller E. and Gumedzoe, Y.M.D. (2017) Diagnostic de Begomovirus associes aux systèmes de cultures à base du manioc (Manihot esculenta Crantz) par la PCR (polymerase chain reaction) au Togo. Journal de la Recherche Scientifique de l’Université de Lomé, 19, 73-84.
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref15">
    <label>15</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Adjata, K.D., Muller, E., Peterschmi, M., Aziadekey, M. and Gumedzoe, Y.M.D. (2010) Incidence of Cassava Viral Diseases and First Identification of East African Cassava Mosaic Virus and Indian Cassava Mosaic Virus by PCR in Cassava (manihot Esculenta Crantz) Fields in Togo. American Journal of Plant Physiology, 5, 94-101. &gt;https://doi.org/10.3923/ajpp.2010.94.101
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref16">
    <label>16</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ogbe, F.O., Thottappilly, G., Dixon, A.G.O., Atiri, G.I. and Mignouna, H.D. (2003) Variants of East African Cassava Mosaic Virus and Its Distribution in Double Infections with African Cassava Mosaic Virus in Nigeria. Plant Disease, 87, 229-232. &gt;https://doi.org/10.1094/pdis.2003.87.3.229 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref17">
    <label>17</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zhou, X., Robinson, D.J. and Harrison, B.D. (1998) Types of Variation in DNA-A among Isolates of East African Cassava Mosaic Virus from Kenya, Malawi and Tanzania. Journal of General Virology, 79, 2835-2840. &gt;https://doi.org/10.1099/0022-1317-79-11-2835 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref18">
    <label>18</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Sseruwagi, P., Sserubombwe, W.S., Legg, J.P., Ndunguru, J. and Thresh, J.M. (2004) Methods of Surveying the Incidence and Severity of Cassava Mosaic Disease and Whitefly Vector Populations on Cassava in Africa: A Review. Virus Research, 100, 129-142. &gt;https://doi.org/10.1016/j.virusres.2003.12.021 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref19">
    <label>19</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Kokou, K. (1998) Les mosaïques forestières au sud du Togo: Biodiversité, dynamique et activités humaines. Université de Montpellier II.
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref20">
    <label>20</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Afidegnon, D. (1999) Les mangroves et les formations associées du Sud-Est du Togo: Analyse éco-floristique et cartographie par télédétection spatiale. Université du Benin.
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref21">
    <label>21</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Pita, J.S., Fondong, V.N., Sangaré, A., Otim-Nape, G.W., Ogwal, S. and Fauquet, C.M. (2001) Recombination, Pseudorecombination and Synergism of Geminiviruses Are Determinant Keys to the Epidemic of Severe Cassava Mosaic Disease in Uganda. Journal of General Virology, 82, 655-665. &gt;https://doi.org/10.1099/0022-1317-82-3-655 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref22">
    <label>22</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Alabi, O.J., Ogbe, F.O., Bandyopadhyay, R., Dixon, A.G., Hughes, J. and Naidu, R.A. (2008) The Occurrence of African Cassava Mosaic Virus and East African Cassava Mosaic Cameroon Virus in Natural Hosts Other Than Cassava in Nigeria. Phytopathology, 97, S3-S3. 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref23">
    <label>23</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Fargette, D., Fauquet, C. and Thouvenel, J.-C. (1985) Field Studies on the Spread of African Cassava Mosaic. Annals of Applied Biology, 106, 285-294. &gt;https://doi.org/10.1111/j.1744-7348.1985.tb03118.x 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref24">
    <label>24</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Altschul, S. (1997) Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs. Nucleic Acids Research, 25, 3389-3402. &gt;https://doi.org/10.1093/nar/25.17.3389 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref25">
    <label>25</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rozas, J., Ferrer-Mata, A., Sánchez-DelBarrio, J.C., Guirao-Rico, S., Librado, P., Ramos-Onsins, S.E., et al. (2017) Dnasp 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Molecular Biology and Evolution, 34, 3299-3302. &gt;https://doi.org/10.1093/molbev/msx248 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref26">
    <label>26</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Kimura, M. (1980) A Simple Method for Estimating Evolutionary Rates of Base Substitutions through Comparative Studies of Nucleotide Sequences. Journal of Molecular Evolution, 16, 111-120. &gt;https://doi.org/10.1007/bf01731581 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref27">
    <label>27</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Tamura, K., Stecher, G. and Kumar, S. (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Molecular Biology and Evolution, 38, 3022-3027. &gt;https://doi.org/10.1093/molbev/msab120 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref28">
    <label>28</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Sét, A., Atass&amp;eacu, K., Kossikouma, D. and Simon Pita, J. (2019) Identification and Incidence of Cassava Mosaic Begomoviruses in Togo. Asian Journal of Plant Pathology, 14, 11-20. &gt;https://doi.org/10.3923/ajppaj.2020.11.20 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref29">
    <label>29</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Soro, M., Tiendrebeogo, F., Pita, J.S., Traore, E.T., Some, K., Tibiri, E.B., James, B., Neya, J., Mutuku, M., Simpore, J. and Kone, D. (2021) Epidemiological Assessment of Cassava Mosaic Disease in Burkina Faso. Plant Pathology, 70, 2207-2216. 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref30">
    <label>30</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Eni, A.O., Efekemo, O.P., Onile-Ere, O.A. and Pita, J.S. (2020) South West and North Central Nigeria: Assessment of Cassava Mosaic Disease and Field Status of African Cassava Mosaic Virus and East African Cassava Mosaic Virus. Annals of Applied Biology, 178, 466-479. &gt;https://doi.org/10.1111/aab.12647 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref31">
    <label>31</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Legg, J.P. and Thresh, J.M. (2000) Cassava Mosaic Virus Disease in East Africa: A Dynamic Disease in a Changing Environment. Virus Research, 71, 135-149. &gt;https://doi.org/10.1016/s0168-1702(00)00194-5 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref32">
    <label>32</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Were, H.K., Winter, S. and Maiss, E. (2004) Occurrence and Distribution of Cassava Begomoviruses in Kenya. Annals of Applied Biology, 145, 175-184. &gt;https://doi.org/10.1111/j.1744-7348.2004.tb00373.x 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref33">
    <label>33</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Chikoti, P.C., Ndunguru, J., Melis, R., Tairo, F., Shanahan, P. and Sseruwagi, P. (2013) Cassava Mosaic Disease and Associated Viruses in Zambia: Occurrence and Distribution. International Journal of Pest Management, 59, 63-72. &gt;https://doi.org/10.1080/09670874.2012.752887 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref34">
    <label>34</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Elegba, W. (2018) Engineering Cassava Mosaic Disease (CMD) Resistance in a Ghanaian Cassava Cultivar. Doctoral Thesis, ETH Zurich.
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref35">
    <label>35</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zinga, I., Chiroleu, F., Legg, J., Lefeuvre, P., Komba, E.K., Semballa, S., et al. (2013) Epidemiological Assessment of Cassava Mosaic Disease in Central African Republic Reveals the Importance of Mixed Viral Infection and Poor Health of Plant Cuttings. Crop Protection, 44, 6-12. &gt;https://doi.org/10.1016/j.cropro.2012.10.010 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref36">
    <label>36</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Torkpo, S.K., Offei, K., Danquah, E.Y. and Gafni, Y. (2017) Status of Cassava Mosaic Begomoviruses in Farmers’ Fields in Ghana. AIMS Agriculture and Food, 2, 279-289. &gt;https://doi.org/10.3934/agrfood.2017.3.279 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref37">
    <label>37</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Swanson, M.M. and Harrison, B.D. (1994) Properties, Relationships and Distribution of Cassava Mosaic Geminiviruses. Tropical Science, 34, 15-25.
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref38">
    <label>38</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     García-Arenal, F., Fraile, A. and Malpica, J.M. (2001) Variability and Genetic Structure of Plant Virus Populations. Annual Review of Phytopathology, 39, 157-186. &gt;https://doi.org/10.1146/annurev.phyto.39.1.157 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref39">
    <label>39</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Varanda, C.M.R., Nolasco, G., Clara, M.I. and Félix, M.R. (2013) Genetic Diversity of the Coat Protein of Olive Latent Virus 1 Isolates. Archives of Virology, 159, 1351-1357. &gt;https://doi.org/10.1007/s00705-013-1953-7 
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref40">
    <label>40</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Fraile, A., Malpica, J.M., Aranda, M.A., Rodríguez-Cerezo, E. and García-Arenal, F. (1996) Genetic Diversity in Tobacco Mild Green Mosaic Tobamovirus Infecting the Wild Plantnicotiana Glauca. Virology, 223, 148-155. &gt;https://doi.org/10.1006/viro.1996.0463
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref41">
    <label>41</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rubio, L., Ayllón, M.A., Kong, P., Fernández, A., Polek, M., Guerri, J., et al. (2001) Genetic Variation of Citrus Tristeza Virus Isolates from California and Spain: Evidence for Mixed Infections and Recombination. Journal of Virology, 75, 8054-8062. &gt;https://doi.org/10.1128/jvi.75.17.8054-8062.2001
    </mixed-citation>
   </ref>
   <ref id="scirp.135227-ref42">
    <label>42</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Adjata, K.D., Muller, E., Peterschmi, M., Traore, O. and Gumedzoe, Y.M.D. (2009) Molecular Evidence for the Association of a Strain of Uganda Variant of East African Cassava Mosaic Virus to Symptom Severity in Cassava (Manihot esculenta Crantz) Fields in Togo. American Journal of Biochemistry and Biotechnology, 5, 196-201. &gt;https://doi.org/10.3844/ajbbsp.2009.196.201
    </mixed-citation>
   </ref>
  </ref-list>
 </back>
</article>