After cleaning and aligning our forty-nine study sequences, they were analysed and a large number of mutations were identified. The tissues were preserved in 96% alcohol and brought to the laboratory where they were stored at 20˚C for subsequent molecular analysis.

Total DNA from the tissues was extracted using the Qiagen protocol, following the steps and protocol for using the kit. The sequences were amplified using primers 5’TGTTAAAAGTGCATACCGCCA3’and 5’AGCCATTTACCGTACATAGCACA3’ of DNA that bind specifically to a target of the DNA polymerase enzyme that copies the target DNA with dNTPs and Mg²⁺ ions. This process was repeated approximately 30 times to make the target more detectable. Sequencing uses a specific PCR reaction that, in addition to the usual compounds (template DNA, polymerase, primer, dNTPs and Mg²⁺), uses modified nucleotides called ddNTPs, that are coupled to fluorochromes (ddATP-green, ddTTP-red, ddCTP-blue and ddGTP-yellow) and have an OH group at the 3’ end of the deoxyribose. Sequencing involves randomly fragmenting the genome into pieces of DNA with a few thousand base pairs for easier manipulation. In this procedure, ddNTPs are incorporated by a polymerase to block elongation of the complementary DNA during copying, as the nucleotides cannot form phosphodiester bonds with each other due to the absence of a hydroxyl group on the 3’ carbon.

The sequences were cleaned and aligned using Bioedit version 7.1.9 [13] , which uses the Clustal W algorithm [14] . This software was used to check, correct and align the sequences, which is a crucial step in the analysis of these data. After cleaning and alignment in Bioedit, the file was imported into Geneious Prime [15] for output of the variants. Using Geneious Prime [15] , it was possible to identify similarities between sequences by finding the positions of likely insertion-deletions. Sequences from healthy and diseased individuals are compared to the Cambridge reference sequence NC_012920.1; [16] [17] to identify the different variants of Dloop in the ovary, and each variant found is considered a polymorphism. The MITOMAP database provides information on germline and somatic function, polymorphisms, and mutations associated with disease [18] , and variants not in the database are considered novel.

After cleaning, alignment, and elimination of certain sequences because they were not clean, 49 were analyzed and many mutations were identified. The reliability of the sequences was checked using nucleotide blasts with the Cambridge reference sequence number (NC_012920.1). On the portion of DNA studied, which extends from position 7 to position 16568, most mutations were found in the HV2 zones, with 21 variants (68T > C, 73A > T, 86A > G, 109G > A, 118C > T, 125T > A, 133T > G, 144C > G, 158C > T, 161A > GC, 167G > A, 168T > G, 170G > A, 176T > CG, 179G > T, 180C > AGT, 182T > C, 183G > A, and 212A > GC) and HV1 with 18 variants (16029G > T, 16030T > C, 16031G > A, 16032C > T, 16036A > G, 16052T > C, 16062A > G, 16063T > G, 16084T > G, 16129G > T, 16246G > A, 16277G > A, 16311G > T, 16344T > C, 16345G > A, 16347T > C, 16350A > G, and 16375G > C). Of the variants, 38 are new and these new mutations include heteroplasmic mutations. A high mutational frequency was noted in eight variants, namely 170G > A (24.15)%, 183G > A (22)%, 213G > A (22.65)%, 215G > A (24.15)%, 219A > G (20.36)%, 270T > G (20.16)%, 415G > A (22.65)%, and 16393C > T (22.53)%. For these variants with a high mutation frequency, most already exist except for three that are new (170G > A, 213G > A and 270T > G), and all are transitions except for one (270T > G). Among the heteroplasmy type variants, two have a mutation found on three alleles instead of two (180C > AGT, and 231C > AGT), which are located in HV2. ( Table 1 )

In order to check whether the control tissues are truly healthy, we have tried to see if there are mutations common to both types of tissues. Yielded the results listed in Table 2 below. The G183A, C180A, C222T and G39A variants are the most common in both tissue types. The G183A mutation is much more present in healthy tissues than in cancerous tissues, while the other three mutations (C180A, C222T and G39A) are present with practically the same frequency in both types of tissues.

Presently, many factors linked to the study of genetic predisposition to certain diseases remain unknown. Some of these diseases are complex because they result from a number of factors, such as the environment or a person’s lifestyle. Ovarian cancer is an example of pathological complexity due to several factors. This study focuses on the DNAmt D-loop gene, which is a specific region of

DNA present in mitochondria, the only cellular organelles to have DNA outside the nucleus in eukaryotes. Their central role in the cell is ensured by oxidative phosphorylation and the production of oxygen radicals. Mutations in DNAmt may lead to dysfunction that can promote the development of tumors [19] . DNAmt has a double strand of 16569 base pairs and contains a non-coding region called the regulatory region that is responsible for DNAmt transcription.

In this study of genetic characterization in ovarian cancer, we analyzed 49 nucleotide sequences from 28 healthy tissues and 21 cancerous tissues with a total of 559 base pairs. Mutations were identified, mainly in the HV region. The gene studied, called D-loop, is polymorphic. Genetic analysis revealed 96 mutations, 38 of which are novel. The study by [20] supports this finding. Some experts believe that many of the mutations that cause carcinomas are found in the D-loop region of DNAmt. DNAmt is a closed-loop molecule composed of two strands that contain the D-loop region, which plays a regulatory role in replication and transcription. Numerous studies have confirmed that the HV region of the D-loop concentrates most DNAmt mutations. Mutations in the HV region can lead to tumor aggressiveness because, as stated by [21] , the HV region may be responsible for the overproduction of reactive oxygen species (ROS), aberrant energy expenditure or the production of autoantigens, thus testifying to the malfunctioning of the mitochondria. This is supported by [22] who refer to the excess of ROS in mitochondria which can disrupt the multiple pathways involved in calcium homeostasis, mitochondrial permeability and cytochrome C release.

Our study confirms this finding, with 89% of mutations found in this same HV region. Our research on the D-loop region enabled us to detect 10 synonymous mutations in healthy and cancerous tissues. The C180G, G183A, C222T and T270G variants were found with high frequency in both types of tissue. This finding points to the hypothesis that breast-fed individuals are predisposed to ovarian cancer. Additionally, in terms of the mutations found, some are present in both types of tissue and at high frequencies, (e.g., the G183A, C180A, C222T, and G39A variants). There are mutations that appear in both tissues but are much more frequent in healthy tissues, (e.g., as G183A). This is what has enabled us to assert that the expansion of tumor cells reached most of the supposedly healthy tissues used in our study. [22] supports our claim by stating that, over time, cancer cells accumulate abnormalities and develop new properties for their growth. And these newly acquired properties can have an impact on cell meiosis, involving a disruption in multiplication and a blockage of apoptosis. As a result, within the surrounding healthy tissues, cells resulting from this meiosis begin to carry the genetic modifications that are the result of the accumulation of abnormalities. This is supported by [23] who speak of the acquisition of malignancy from normal cells as being the cumulative effect of multiple genetic modifications that accumulate during the evolution of a cell. If the damage caused by the excess cell multiplication is not limited, the mutations may reach other sites or organs. This is why the question of targeted treatment in the HV region seems to make sense. These abnormalities can progressively invade all the tissues of the organ of origin and spread to neighbouring tissues, making cancer invasive.