<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2024.146022</article-id><article-id pub-id-type="publisher-id">AiM-133768</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Fungi Associated with Sand and Plants from Marine Coastlines: Potential Relevance for Human Health
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Marina</surname><given-names>Carrasco-Acosta</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Pilar</surname><given-names>Garcia-Jimenez</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Biology, Universidad de Las Palmas de Gran Canaria, Campus de Tafira, Las Palmas, Spain</addr-line></aff><pub-date pub-type="epub"><day>06</day><month>06</month><year>2024</year></pub-date><volume>14</volume><issue>06</issue><fpage>303</fpage><lpage>316</lpage><history><date date-type="received"><day>27,</day>	<month>May</month>	<year>2024</year></date><date date-type="rev-recd"><day>10,</day>	<month>June</month>	<year>2024</year>	</date><date date-type="accepted"><day>13,</day>	<month>June</month>	<year>2024</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  The fungal community associated with beach sand and plants located along marine coasts are an under-studied area of research despite its potential relevance to human health. In this study, we isolated and identified the cultivable mycobiota associated with sand and plants collected along the coast of Gran Canaria (Spain) using culture-dependent and -independent methods. Clinically relevant species belonging to &lt;i&gt;Cryptococcus&lt;/i&gt; spp. and related genera such as &lt;i&gt;Naganishia&lt;/i&gt; and &lt;i&gt;Papilotrema &lt;/i&gt;were isolated and identified from shoreline plants. Moreover, &lt;i&gt;Candida&lt;/i&gt; &lt;i&gt;tropicalis&lt;/i&gt; was isolated from beach sand, and &lt;i&gt;A&lt;/i&gt;&lt;i&gt;s&lt;/i&gt;&lt;i&gt;pergillus fumigatus&lt;/i&gt; and &lt;i&gt;Aspergillus terreus&lt;/i&gt; strains were associated with both types of samples (&lt;i&gt;i.e.&lt;/i&gt;, plants and beach sand). We conclude that beach sand and shoreline plants are potential reservoirs of fungi of high clinical interest. We recommend including beach sand and plants from the environment when assessing the quality of marine coastal systems. Our results open a framework for studying the natural marine environment and its role in the epidemiology of infectious diseases in order to more accurately manage public health.
 
</p></abstract><kwd-group><kwd>Sand Beach</kwd><kwd> Shoreline Plants</kwd><kwd> Reservoir of Pathogenic Fungi</kwd><kwd> &lt;i&gt;Cryptococcus&lt;/i&gt;&lt;i&gt; &lt;/i&gt;spp.</kwd><kwd>&lt;i&gt; Aspergillus&lt;/i&gt;&lt;i&gt; &lt;/i&gt;spp.</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The importance of understanding which environmental fungi and yeasts could affect public health is growing every year [<xref ref-type="bibr" rid="scirp.133768-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref4">4</xref>] . In this context, the role of environmental mycobiota in disease-causing clinical samples, particularly in immunocompromised individuals, has been regularly reported [<xref ref-type="bibr" rid="scirp.133768-ref5">5</xref>] . Several articles have aimed to fill this knowledge gap regarding the identification of fungal pathogenic natural reservoirs and the clinical implications of these isolated fungi, such as environmental Aspergillus strains [<xref ref-type="bibr" rid="scirp.133768-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref7">7</xref>] ; environmental black yeast, including Aureobasidium spp. and Monilliela spp. [<xref ref-type="bibr" rid="scirp.133768-ref8">8</xref>] ; emerging environmental Candida spp. strains [<xref ref-type="bibr" rid="scirp.133768-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref10">10</xref>] ; and environmental Cryptococcus neoformans and Cryptococcus gattii strains [<xref ref-type="bibr" rid="scirp.133768-ref11">11</xref>] .</p><p>However, different environments require more in-depth research, such as sandy beaches, coastal marshes, rural and urban plants, and coastal shrubs and trees. In particular, the fungal flora of coastal beach sand and plants in the immediate vicinity of marine bathing areas is a neglected field of study, despite its potential impact on human health [<xref ref-type="bibr" rid="scirp.133768-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref4">4</xref>] . Therefore, the identification of environmental niches that act as potential fungal pathogenic reservoirs is crucial for the control of mycotic diseases that may be relevant to human health.</p><p>The aim of this paper is to isolate and identify the cultivable mycobiota associated with sandy beaches and plants from the marine coastal systems of Gran Canary Island (Canary Archipelago, Spain), through culture-dependent and -independent methods, with particular attention to isolating fungi that are of high clinical importance.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Description of the Study Area, Sample Collection, and Preparation</title><p>The Canary Islands are located in the southeastern sector of the North Atlantic Ocean, approximately between 27˚ to 29˚ N and 14˚ to 18 ˚W, and are closed to the occidental African coast (<xref ref-type="fig" rid="fig1">Figure 1</xref>(A)). These islands are a typical example of a “sun, sand, and sea” tourism international destination [<xref ref-type="bibr" rid="scirp.133768-ref12">12</xref>] . Specifically, Gran Canaria is the second largest island in the Canary Islands archipelago (1560 km<sup>2</sup>) and supports a large part of this international tourism, as well as local tourism and resident users, as its features make it perfect for recreational sea bathing.</p><p>Four sampling zones from Gran Canaria were selected along the east coast of the island (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)), according to their exposure to marine currents, anthropogenic activity pressure, periodicity of sand beach cleaning, and presence of plants along the coastline. Las Canteras beach is the northernmost sampling zone (<xref ref-type="fig" rid="fig1">Figure 1</xref>(C)), which is characterised by intense anthropogenic activity, exposure to ocean currents, and regular sand cleaning by the municipality of Las Palmas de Gran Canaria (the capital of the island). The second is the beach of San Crist&#243;bal, located in the southern part of Las Palmas de Gran Canaria (<xref ref-type="fig" rid="fig1">Figure 1</xref>(D)). It is characterised as a small and enclosed beach with scarce seawater renewal, as is protected by the breakwater of the port of San Crist&#243;bal. Its sand is cleaned only sporadically and the anthropogenic pressure is high. The third is Hoya del Pozo (<xref ref-type="fig" rid="fig1">Figure 1</xref>(F)), a beach with high anthropogenic pressure, which is exposed to moderate sea currents and subject to sporadic sand cleaning. Finally, the southernmost samplingzone is Playa del &#193;guila (<xref ref-type="fig" rid="fig1">Figure 1</xref>(E)), which is located in a shallow-current area. It is characterised by high anthropogenic activity andperiodic sand cleaning. Sampling was carried out prior to the beach sand cleaning works during the high tourist season in Gran Canaria in 2023 (July-August).</p><p>Two samples were harvested from each sampling zone, as shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>. Sand sampling was carried out through collecting 600 g of marine substrate (top 4 cm) using sterile polyethylene canisters. The canisters were immediately transported in a cool box (4˚C and darkness) to the laboratory for analysis. All samples were processed within a maximum time interval of 24 h. For analysis, 200 g of sand was placed in an orbital shaker at 300 rpm for 30 min with 0.9% NaCl (w/v) solution at a ratio of 1:1. The supernatants were collected and stored individually in sterile polyethylene canisters at 20˚C until use.</p><p>Four different plants and shrubs (hereafter referred to as plants) were harvested from the same sampling zones (<xref ref-type="fig" rid="fig1">Figure 1</xref>). One of them was Opuntia maxima, an invasive exotic species (<xref ref-type="fig" rid="fig1">Figure 1</xref>(C); <xref ref-type="fig" rid="fig2">Figure 2</xref>(A)); two others were Echiumdecaisnei (<xref ref-type="fig" rid="fig1">Figure 1</xref>(D); <xref ref-type="fig" rid="fig2">Figure 2</xref>(B)) and Kleinianeriifolia (<xref ref-type="fig" rid="fig1">Figure 1</xref>(E); <xref ref-type="fig" rid="fig2">Figure 2</xref>(D)), which are endemic shrubs from the Canary Islands; and the last was Lotus kunkelii, which is locally endemic to the Gran Canary east coast (<xref ref-type="fig" rid="fig1">Figure 1</xref>(F); <xref ref-type="fig" rid="fig2">Figure 2</xref>(C)).</p><p>Three plant specimens per each species were sampled using three sterile swabs for each specimen. A 3 cm<sup>2</sup> area of each plant specimen was scraped with each swab. The swabs were transported in a cool box to the laboratory and stored at 4 ˚C, as described previously. For analysis, prior to inoculation, each swab was placed in a tube containing 3 mL of 0.9% NaCl (w/v) solution, incubated at 25˚C for 20 minutes and finally homogenised by vortexing.</p></sec><sec id="s2_2"><title>2.2. Fungal Isolation and Identification</title><p>An aliquot of 1 mL of each supernatant from the sand sample and 1 mL of each homogenate from the plant sample was plated on Petri dishes (15 cm &#216;) containing the following culture media: Sabouraud Dextrose Agar, normally used for the cultivation of filamentous fungi and dermatophytes of clinical interest (SDA; 65.5 g; Sigma-Aldrich, St. Louis, MO, United States; in 1 L of ddH<sub>2</sub>O), or Staib Agar, used for the selective isolation and differentiation of Cryptococcus spp. and yeasts (SA; 68.5 g; Thermo Fisher Scientific, Waltham, Massachusetts, United States; in 1 L of ddH<sub>2</sub>O). Each medium was supplemented with antibiotics (Chloramphenicol 0.5 g L<sup>−1</sup> and Actidione 1 g L<sup>−1</sup>; Sigma-Aldrich, St. Louis, United States).</p><p>Three replicates were performed per medium and per sample. A total of 120 plates were incubated at 25˚C for 21 days. Colony-forming units per gram of sand dry weight (CFU g<sup>−1</sup>dw) and per cm<sup>2</sup>mL<sup>-1</sup> of homogenate plant sample (CFU cm<sup>2</sup>mL<sup>-1</sup>) were recorded. Fungal strains were isolated and maintained in pure culture.</p><p>Fungi were identified by combining morpho-physiological and molecular studies. Following the preliminary determination of genera according to macroscopic and microscopic features [<xref ref-type="bibr" rid="scirp.133768-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref15">15</xref>] , fungal isolates identified as being ofhigh clinical importance (i.e., groups Aspergillus spp., black yeasts, and Cryptococcus spp.) were transferred to the media recommended by the authors of these selected genus monographs [<xref ref-type="bibr" rid="scirp.133768-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref17">17</xref>] and identifiedto the species level using molecular techniques.</p></sec><sec id="s2_3"><title>2.3. Molecular Assessment of Isolated Fungi of Clinical Interest</title><p>DNA from the pure strains of each target fungus of high clinical importance was extracted using the CTAB procedure described by [<xref ref-type="bibr" rid="scirp.133768-ref18">18</xref>] and modified by [<xref ref-type="bibr" rid="scirp.133768-ref19">19</xref>] . Fresh mycelium of Aspergillus and black yeastsstrains were gently scraped from Malt Extract Agar (MEA; 33.6 g; Sigma-Aldrich, St. Louis, MO, United States; in 1 L of ddH<sub>2</sub>O) plates, Candida strain was harvested from CHROMagar Candida (ChCan; 47.7 g; CHROMagar™, St. Louis, Paris, France; in 1 L of ddH<sub>2</sub>O), and Cryptococcus spp. strains were scraped from Staib Chloramphenicol Agar (Sch; 68.5g; Thermo Fisher Scientific, Waltham, Massachusetts, United States; supplemented with 0.5g L<sup>−1</sup> of Chloramphenicol in 1 L of ddH<sub>2</sub>O). Fungal strains were individually homogenised in liquid nitrogenand separately transferred to a 2 mL microtube.</p><p>Next, the extraction buffer was prepared using CTAB 2% (w/v), PVPP 0.1% (w/v), TRIS-HCl 100 mMat pH 8.6, SDS 10%, EDTA 0.5 M at pH 8, NaCl 4 M, and β-Mercaptoethanol 2% (v/v). Next, 800 &#181;L of extraction buffer was added to each sample. The samples were then kept in a bath at 65˚C for 1 h and gently mixed via inversion three times, in addition to the incubation step. Later, 800 &#181;L of CIA (chloroform-isoamyl alcohol, 24:1 (v/v)) was added, and the samples were centrifuged for 20 min at 3000 rpm in a VWR Micro Star 17R centrifuge (VWR International Eurolab, BCN, Spain). Successive washes in CIA and centrifugations were carried out until the supernatant became whitish. To continue, 2/3 of isopropyl alcohol at −20˚C was added, and centrifugation at 15,000 &#215; g for 30 min was carried out. Afterwards, the isopropyl alcohol was removed and 20 &#181;L of ethanol (80%) was added. Finally, the samples were centrifuged at 15,000 &#215; g for 5 min. The supernatant was discarded and the pellets were re-suspended in 20 &#181;L of DNase-Free ddH<sub>2</sub>O and stored at −20˚C until further use. The yield and purity of genomic DNA were calculated from the A260/A280 ratio, measured using a Nano Drop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). DNA extraction was performed in triplicate for each fungal strain.</p><p>Molecular identification was conducted based on the partial sequences of specific molecular markers (<xref ref-type="table" rid="table1">Table 1</xref>) through amplification performed in a thermocycler MyCyclerTM (Biorad, Hercules, CA, USA). β-tubulin was amplified using Bt2a/Bt2b [<xref ref-type="bibr" rid="scirp.133768-ref20">20</xref>] , while the calmodulin gene was amplified using CL1/CL2A [<xref ref-type="bibr" rid="scirp.133768-ref21">21</xref>] . Both molecular markers were used for the identification of Aspergilluss trains. NL1/NL4 were used to amplify the D1/D2 region of the large subunit ribosomal ribonucleic acid (LSU rRNA) [<xref ref-type="bibr" rid="scirp.133768-ref22">22</xref>] to identify Cryptococcus and Candidas trains, together with amplification of the internal transcribed spacer, including the 5.8S rDNA gene (nrITS), amplified using the ITS1/ITS4 pair primer [<xref ref-type="bibr" rid="scirp.133768-ref23">23</xref>] . Moreover, ITS1/ITS4 was used to identify the strains belonging to the black yeast group.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Sequences of primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Target region</th><th align="center" valign="middle" >Primer names</th><th align="center" valign="middle" >Sequence (5’-3’)</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle" >Internal transcribed spacer</td><td align="center" valign="middle" >ITS1 ITS4</td><td align="center" valign="middle" >TCC GTA GGT GAA CCT TGC GG TCC TCC GCT TAT TGA TAT GC</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.133768-ref21">21</xref>]</td></tr><tr><td align="center" valign="middle" >β-tubulin</td><td align="center" valign="middle" >Bt2a Bt2b</td><td align="center" valign="middle" >ACCCTCAGTGTAGTGACCCTT GGTAACCAAATCGGTGCTGCT</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.133768-ref20">20</xref>]</td></tr><tr><td align="center" valign="middle" >Calmodulin gene</td><td align="center" valign="middle" >CL1 CL2A</td><td align="center" valign="middle" >AGCAAGTCTCCGAGTTCAAGG CTTCTGCATCATCAYCTGGACG</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.133768-ref21">21</xref>]</td></tr><tr><td align="center" valign="middle" >D1/D2</td><td align="center" valign="middle" >NL1 NL4</td><td align="center" valign="middle" >GCATATCAATAAGCGGAGGAA GGTCCGTGTTTCAAGACGG</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.133768-ref22">22</xref>]</td></tr></tbody></table></table-wrap><p>Each PCR reaction mixture contained 0.5 U Takara Ex Taq DNA polymerase (TaKaRa Shuzo Co., Shiga, Japan), 2.5 mM of each dNTP, 10 &#181;L Takara Ex Taq PCR buffer with MgCl2, 10 &#181;M forward and reverse primers (<xref ref-type="table" rid="table1">Table 1</xref>), and 90 - 95 ng DNA template. The PCR protocol consisted in an initial denaturation at 95˚C for 5 min, followed by 30 cycles at 94˚C for 45 s, 58˚C for 40 s min, and 72˚C for 1 min. The final elongation was carried out at 72˚C for 10 min. The PCR amplification products were checked through agarose (1%) electrophoresis at 75 V. The amplifications were carried out in triplicate.</p><p>PCR products were purified using the QIAEX agarose gel extraction kit (Qiagen Inc., Hilden, Germany) and sequenced at Sistemas Gen&#243;micos (SYNLAB Group, Valencia, Spain). The resulting ABI chromatograms were visually inspected, trimmed, and assembled to obtain consensus sequences using the Sequencer 5.0 software (Gene Codes Corporation, Ann Arbor, MI, United States). The newly generated sequences were compared through BLASTn analyses (default settings) with those available in public nucleotide databases provided by the NCBI (Bethesda MD, United States) and the Westerdijk Fungal Biodiversity Institute (Utrecht, The Netherlands). Similarity values ≥98% (e-value &gt; e-100) were accepted as indicating a credible identification.</p></sec><sec id="s2_4"><title>2.4. Data Analysis</title><p>Data analysis and visualisation were performed using the IBM&#174; SPSS&#174; Statistics v27.0 software (IBM, NY, USA). A Venn diagram was created to compare the proportion of isolated fungi of high clinical importance between beach sand and shoreline plant samples using the Venny 2.1.0 software (BioinfoGP Service, CNB-CSIC, Spain) [<xref ref-type="bibr" rid="scirp.133768-ref24">24</xref>] .</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><sec id="s3_1"><title>3.1. Fungal Identification and Taxonomic Distribution among Sampling Zones</title><p>All studied samples of beach sand and plants were colonised by fungi. Fungal growth per incubated plate ranged from 14 to 38 CFU g<sup>−1</sup> dw in sand samples and from 21 to 54 CFU cm<sup>2</sup><sup>−1</sup> in plant samples. Overall, 115 isolates belonging to three phyla were recovered from the 4 beach sand and 4 plant species samples (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p><p>As expected, the dominant phylum was Ascomycota (for sand beach min. 54.54% in Playa del &#193;guila to max. 100% in Las Canteras, <xref ref-type="fig" rid="fig3">Figure 3</xref>(A); for plants min. 47.37% in Echiumdecaisnei to max. 100% in Lotus kunkelii, <xref ref-type="fig" rid="fig3">Figure 3</xref>(B)), followed by Basidiomycota (for sand beach min. 0% Las Canterasto max. 27.27% in Playa del &#193;guila, <xref ref-type="fig" rid="fig3">Figure 3</xref>(A); for plants min. 0% in Lotus kunkelii to max. 52.63% in Echium decaisnei, <xref ref-type="fig" rid="fig3">Figure 3</xref>(B)). Mucororomycota were only detected in sand samples, ranging from 13.64 to 18.18% (<xref ref-type="fig" rid="fig3">Figure 3</xref>(A)). In total, 19 genera were isolated and identified through morpho-physiological studies (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p><p>For beach sand, the Aspergillus genus was dominant, followed by Penicillium. This result is consistent with the evidence reported for the Aspergillaceae family, which is commonly described in marine environments worldwide—probably due to its high adaptation to specific chemical-physical conditions [<xref ref-type="bibr" rid="scirp.133768-ref25">25</xref>] . Moreover, a Candida sp. strain was isolated from beach sand. The remaining isolated fungi taxa, which are the major part of the sand fungal community—except for San Crist&#243;bal, where Aspergillus genus species represented &gt;70% of the fungal community (<xref ref-type="fig" rid="fig4">Figure 4</xref>(A))—were identified as common saprophytes or plant pathogens from the mycobiota associated with beach sand, such as Fusarium spp. [<xref ref-type="bibr" rid="scirp.133768-ref4">4</xref>] .</p><p>To the contrary, for plant samples, the dominance of genera with potential high clinical importance was observed, namely, Aspergillus; Aureobasidium, and Cryptococcus and their related genera Naganishia and Papiliotrema (<xref ref-type="fig" rid="fig4">Figure 4</xref>). In particular, more than half of the mycobiota studied—with the exception of the fungal community associated with Opuntia maxima—were determined as potential human pathogens (<xref ref-type="fig" rid="fig4">Figure 4</xref>(B)). The remaining genera were identified as saprophytes (e.g., Stachybotrys spp. [<xref ref-type="bibr" rid="scirp.133768-ref26">26</xref>] ) or plant pathogens (e.g., Ganoderma spp. [<xref ref-type="bibr" rid="scirp.133768-ref27">27</xref>] ).</p></sec><sec id="s3_2"><title>3.2. Fungi of High Clinical Interest</title><p>A deeper study through molecular techniques was carried out to identify the isolates affiliated to Aspergillus, Aureobasidium, Candida, Cryptococcus, Naganishia, and Papiliotrema genera at species level, given that they are recognised etiological agents of human diseases [<xref ref-type="bibr" rid="scirp.133768-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref28">28</xref>] .</p><p>The molecular identification was performed by amplifying and sequencing the appropriate genetic marker for each taxon, as previously described [<xref ref-type="bibr" rid="scirp.133768-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref23">23</xref>] (<xref ref-type="table" rid="table1">Table 1</xref>), which allowed for the identification of seven species: Aspergillus fumigatus, Aspergillus terreus, Aureobasidium pullulans, Cryptococcus neoformans/gattii species complexes, Naganishia albida, Naganishia globosa, and Papiliotrema flavescens (<xref ref-type="table" rid="table2">Table 2</xref>).</p><p>In detail, more taxa with significant pathogenicity were found in plant samples in this study, including Cryptococcus neoformans/gattii species complexes, Naganishia albida, Naganishia globose, Papiliotrema flavescens, Aureobasidium pullulans, and two species belonging to Aspergillus genus (<xref ref-type="fig" rid="fig5">Figure 5</xref>). This result was observed for several reasons.</p><p>The first, Cryptococcus species have been described as the most common pathogenic yeasts associated with trees [<xref ref-type="bibr" rid="scirp.133768-ref8">8</xref>] . Moreover, the ability of Cryptococcus spp. to grow, mate, and produce infectious propagules in association with plants has been reported, maintaining their genetic diversity and virulence factors through these abilities [<xref ref-type="bibr" rid="scirp.133768-ref29">29</xref>] . In addition, these virulence factors make some Cryptococcus species, such as C. neoformans/gattii species complex, the predominant infectious agents of cryptococcosis—a leading cause of death in adults living with HIV [<xref ref-type="bibr" rid="scirp.133768-ref28">28</xref>] . However, clinical series have been published of infections caused by Naganishia and Papiliotrema species [<xref ref-type="bibr" rid="scirp.133768-ref30">30</xref>] . It has recently been reported that Papiliotrema flavescens (formerly Cryptococcus flavescens) could produce respiratory system infections that can coexist with lung cancer [<xref ref-type="bibr" rid="scirp.133768-ref31">31</xref>] . Additionally, Naganishia albida (formerly Cryptococcus albidus) has been reported as a causative agent of some skin infections [<xref ref-type="bibr" rid="scirp.133768-ref32">32</xref>] , as well as Naganishia globosa (formerly Cryptococcus saitoi), which has been described as an environmental yeast with potential opportunistic pathogenicity [<xref ref-type="bibr" rid="scirp.133768-ref33">33</xref>] .</p><p>Second, Aureobasidium pullulans is a dematiaceous fungus that is found mostly in plants, plant debris, and wood, which can cause opportunistic infections [<xref ref-type="bibr" rid="scirp.133768-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref8">8</xref>] . However, deeper research is required as its pathogenicity remains limited and infections are rare, which affect mainly immune-compromised hosts [<xref ref-type="bibr" rid="scirp.133768-ref34">34</xref>] .</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Fungal taxa isolated from beach sand and plants harvested along the coastline of Gran Canary Island (Spain)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Taxa</th><th align="center" valign="middle" >From beachsand<sup>a</sup></th><th align="center" valign="middle" >From plants<sup>b</sup></th></tr></thead><tr><td align="center" valign="middle" >Alternaria sp.</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >E; K</td></tr><tr><td align="center" valign="middle" >Aspergillus fumigatus*</td><td align="center" valign="middle" >SC</td><td align="center" valign="middle" >L</td></tr><tr><td align="center" valign="middle" >Aspergillus section Nigri</td><td align="center" valign="middle" >LC; SC; HP; PA</td><td align="center" valign="middle" >E; L; K</td></tr><tr><td align="center" valign="middle" >Aspergillus series Versicolores (section Nidulantes)</td><td align="center" valign="middle" >SC</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Aspergillus terreus*</td><td align="center" valign="middle" >SC; HP</td><td align="center" valign="middle" >L</td></tr><tr><td align="center" valign="middle" >Aureobasidium pullulans*</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >E; K</td></tr><tr><td align="center" valign="middle" >Bipolaris sp.</td><td align="center" valign="middle" >SC</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Candida tropicalis</td><td align="center" valign="middle" >HP</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Cladosporium sp.</td><td align="center" valign="middle" >PA</td><td align="center" valign="middle" >L</td></tr><tr><td align="center" valign="middle" >Cryptococcus neoformans/gattii species complexes*</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >E; O; K</td></tr><tr><td align="center" valign="middle" >Fusarium sp.</td><td align="center" valign="middle" >HP</td><td align="center" valign="middle" >E; L</td></tr><tr><td align="center" valign="middle" >Ganoderma sp.</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >E</td></tr><tr><td align="center" valign="middle" >Mucor sp.</td><td align="center" valign="middle" >HP; PA</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Naganishia albida*</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >K</td></tr><tr><td align="center" valign="middle" >Naganishia globosa*</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >K</td></tr><tr><td align="center" valign="middle" >Papiliotrema flavescens*</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >E</td></tr><tr><td align="center" valign="middle" >Penicillium sp.</td><td align="center" valign="middle" >LC; SC; HP; PA</td><td align="center" valign="middle" >E; L; O</td></tr><tr><td align="center" valign="middle" >Rhodotorula sp.</td><td align="center" valign="middle" >SC; HP; PA</td><td align="center" valign="middle" >E; K</td></tr><tr><td align="center" valign="middle" >Scopulariopsis sp.</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >L</td></tr><tr><td align="center" valign="middle" >Stachybotrys sp.</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >O</td></tr><tr><td align="center" valign="middle" >Trichoderma sp.</td><td align="center" valign="middle" >PA</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Trichosporon sp.</td><td align="center" valign="middle" >SC; HP; PA</td><td align="center" valign="middle" >E; O</td></tr><tr><td align="center" valign="middle" >Ulocladium sp.</td><td align="center" valign="middle" >LC</td><td align="center" valign="middle" >L</td></tr></tbody></table></table-wrap><p><sup>a</sup>Las Canteras (LC); San Crist&#243;bal (SC); Hoya del Pozo (HP); and Playa del &#193;guila (PA).</p><p><sup>b</sup>Echium decaisnei (E); Lotus kunkelii (L); Opuntia maxima (O); and Kleinia neriifolia (K).</p><p>-Not isolated from this matrix. *Molecularly identified.</p><p>Third, Aspergillus fumigatus is a ubiquitous pathogenic mould that causes various diseases, including mycotoxicosis, allergic reactions, and systemic diseases (invasive aspergillosis) [<xref ref-type="bibr" rid="scirp.133768-ref35">35</xref>] . Aspergillus terreus, for its part, is mostly isolated from plant material and soil, being the third-most common filamentous fungus in respiratory infections [<xref ref-type="bibr" rid="scirp.133768-ref6">6</xref>] . In line with this scientific evidence, A. fumigatus and A. terreus were also isolated from the beach sand samples studied in this paper (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p><p>On the other hand, it is notable that sand samples harboured fewer fungal species of high clinical interest, when compared to those of plant origin (<xref ref-type="fig" rid="fig5">Figure 5</xref>). Nonetheless, it is noteworthy that the only Candida strain (i.e., Candida tropicalis) was isolated from the sands of Hoya del Pozo beach, which is characterised by a high anthropogenic pressure and low sand cleanliness (<xref ref-type="fig" rid="fig1">Figure 1</xref>(F) and <xref ref-type="fig" rid="fig4">Figure 4</xref>(B)). In this regard, it has been widely reported that most species of Candida—both clinical and environmental—can produce candidemia, involving the presence of Candida species in the blood, which is the most common fungal bloodstream infection in hospitalised patients [<xref ref-type="bibr" rid="scirp.133768-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.133768-ref10">10</xref>] .</p></sec></sec><sec id="s4"><title>4. Conclusion</title><p>In this work, we detailed and compared the cultivable fungal community associated with sand and plants from the marine coastline of Gran Canary Island (Spain). Our results highlight the important role of plants in the immediate vicinity of marine bathing areas and beach sand as a natural reservoir for human pathogenic fungi. Clinically relevant species of Cryptococcus and their related genera, such as Naganishia and Papilotrema, were isolated from shoreline plants; strains of Candida were isolated from beach sand; and strains of Aspergillus fumigatus and Aspergillus terreus were isolated from both types of samples (i.e., plants and beach sand). Hence, the monitoring of beach sand and shoreline plants is recommended for inclusion in the assessment of the quality of marine coastal systems. Our results provide a framework to study the role of the natural marine environment in depth, including its significant role in the epidemiology of infectious diseases, as pathogens persist and evolve in environmental niches from which they can be transferred to new hosts.</p></sec><sec id="s5"><title>Author’s Contributions</title><p>M.C.-A. and P.G.-J. conceived, designed, and wrote the manuscript. M.C.-A. conducted the microbiological and molecular assays. All authors have read and approved the manuscript.</p></sec><sec id="s6"><title>Acknowledgements</title><p>M.C.-A. thanks the European Social and the Gobierno de Canarias-Consejer&#237;a de Econom&#237;a, Conocimiento y Empleo for the financing of the Catalina Ruiz Programme-ULPGC contract.</p></sec><sec id="s7"><title>Funding</title><p>This work was partially funded by TED2021-129249B-I00 of the Ministerio de Ciencia e Innovaci&#243;n.</p></sec><sec id="s8"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest.</p></sec><sec id="s9"><title>Cite this paper</title><p>Carrasco-Acosta, M. and Garcia-Jimenez, P. (2024) Fungi Associated with Sand and Plants from Marine Coastlines: Potential Relevance for Human Health. Advances in Microbiology, 14, 303-316. https://doi.org/10.4236/aim.2024.146022</p></sec></body><back><ref-list><title>References</title><ref id="scirp.133768-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Biedunkiewicz, A., Sucharzewska, E., Kulesza, K., Nowacka, K. and Kubiak, D. (2019) Phyllosphere of Submerged Plants in Bathing Lakes as a Reservoir of Fungi&amp;#8212;Potential Human Pathogens. &lt;i&gt;Microbial Ecology&lt;/i&gt;, 79, 552-561. &lt;br&gt;https://doi.org/10.1007/s00248-019-01447-y</mixed-citation></ref><ref id="scirp.133768-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Akinbobola, A.B., Kean, R., Hanifi, S.M.A. and Quilliam, R.S. (2023) Environmental Reservoirs of the Drug-Resistant Pathogenic Yeast &lt;i&gt;Candida auris&lt;/i&gt;. &lt;i&gt;PLOS Pathogens&lt;/i&gt;, 19, e1011268. &lt;br&gt;https://doi.org/10.1371/journal.ppat.1011268</mixed-citation></ref><ref id="scirp.133768-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Bonifaz, A., Garc&amp;#237;a-Salazar, E. and Fr&amp;#237;as-De-Le&amp;#243;n, M.G. (2024) Climate Change Exacerbating Fungal Disease Disparities. &lt;i&gt;Current Fungal Infection Reports&lt;/i&gt;, 18, 1-12. &lt;br&gt;https://doi.org/10.1007/s12281-023-00479-9</mixed-citation></ref><ref id="scirp.133768-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Gangneux, J.-P., Brandao, J., Segal, E., Arikan-Akdagli, S., Barac, A., Bertout, S., &lt;i&gt;et al&lt;/i&gt;. (2024) Knowledge and Regulation on Fungal Contamination of Sand and Water: Progress Report and Perspectives. &lt;i&gt;Medical Mycology&lt;/i&gt;, 62, Article myad137. &lt;br&gt;https://doi.org/10.1093/mmy/myad137</mixed-citation></ref><ref id="scirp.133768-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Magoye, E., N&amp;#228;geli, L., B&amp;#252;hlmann, A., Hilber-Bodmer, M., Keller, P., M&amp;#252;hlethaler, K., &lt;i&gt;et al&lt;/i&gt;. (2023) Clinical &lt;i&gt;Aureobasidium&lt;/i&gt; Isolates Are More Fungicide Sensitive than Many Agricultural Isolates. &lt;i&gt;Microbiology Spectrum&lt;/i&gt;, 11, e05299-22. &lt;br&gt;https://doi.org/10.1128/spectrum.05299-22</mixed-citation></ref><ref id="scirp.133768-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Dietl, A.-M., Vahedi-Shahandashti, R., Kandelbauer, C., Kraak, B., Lackner, M., Houbraken, J., &lt;i&gt;et al&lt;/i&gt;. (2021) The Environmental Spread of &lt;i&gt;Aspergillus terreus&lt;/i&gt; in Tyrol, Austria. &lt;i&gt;Microorganisms&lt;/i&gt;, 9, Article 539. &lt;br&gt;https://doi.org/10.3390/microorganisms9030539</mixed-citation></ref><ref id="scirp.133768-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Liu, F., Zeng, M., Zhou, X., Huang, F. and Song, Z. (2024) &lt;i&gt;Aspergillus fumigatus&lt;/i&gt; Escape Mechanisms from Its Harsh Survival Environments. &lt;i&gt;Applied Microbiology and Biotechnology&lt;/i&gt;, 108, Article No. 53. &lt;br&gt;https://doi.org/10.1007/s00253-023-12952-z</mixed-citation></ref><ref id="scirp.133768-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Nouraei, H., Gharechahi, F., Zareshahrabadi, Z., Zomorodian, K., Gharavi, A., Khodadadi, H., Ansari, S., Amirzadeh, N. and Pakshir, K. (2024) Molecular Characterization of Non-&lt;i&gt;Cryptococcus&lt;/i&gt; Yeasts Communities Isolated from &lt;i&gt;Eucalyptus&lt;/i&gt; Trees. &lt;i&gt;Current Medical Mycology&lt;/i&gt;, 10, e2024.345184.1500.</mixed-citation></ref><ref id="scirp.133768-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Vogel, C., Rogerson, A., Schatz, S., Laubach, H., Tallman, A. and Fell, J. (2007) Prevalence of Yeasts in Beach Sand at Three Bathing Beaches in South Florida. &lt;i&gt;Water Research&lt;/i&gt;, 41, 1915-1920. &lt;br&gt;https://doi.org/10.1016/j.watres.2007.02.010</mixed-citation></ref><ref id="scirp.133768-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Arora, P., Singh, P., Wang, Y., Yadav, A., Pawar, K., Singh, A., &lt;i&gt;et al&lt;/i&gt;. (2021) Environmental Isolation of &lt;i&gt;Candida auris&lt;/i&gt; from the Coastal Wetlands of Andaman Islands, India. &lt;i&gt;mBio&lt;/i&gt;, 12, e03181-20. &lt;br&gt;https://doi.org/10.1128/mbio.03181-20</mixed-citation></ref><ref id="scirp.133768-ref11"><label>11</label><mixed-citation publication-type="book" xlink:type="simple">Mitchell, T.G., Casta&amp;#241;eda, E., Nielsen, K., Wanke, B. and Laz&amp;#233;ra, M.S. (2010) Environmental Niches for &lt;i&gt;Cryptococcus neoformans&lt;/i&gt; and &lt;i&gt;Cryptococcus gattii&lt;/i&gt;. In: Heitman, J., Kozel, T.R., Kyung, J., Kwon-Chung, J.R. and Perfect, A.C., Ed., &lt;i&gt;Crypt&lt;/i&gt;&lt;i&gt;o&lt;/i&gt;&lt;i&gt;coccus&lt;/i&gt;:&lt;i&gt; From Human Pathogen to Model Yeast&lt;/i&gt;, American Society for Microbiology Press, 235-259. &lt;br&gt;https://doi.org/10.1128/9781555816858.ch18</mixed-citation></ref><ref id="scirp.133768-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Cirer Costa, J.C. (2023) Creation of Mass Sun-and-Beach Tourism in Spain: The Definition of the Tourist Product through Architecture. &lt;i&gt;Journal of Historical R&lt;/i&gt;&lt;i&gt;e&lt;/i&gt;&lt;i&gt;search in Marketing&lt;/i&gt;, 16, 71-95. &lt;br&gt;https://doi.org/10.1108/jhrm-06-2023-0020</mixed-citation></ref><ref id="scirp.133768-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Domsch, K.H., Gams, W. and Anderson, T.H. (1980) Compendium of Soil Fungi. Academic Press.</mixed-citation></ref><ref id="scirp.133768-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Von Arx, J.A. (1981) The Genera of Fungi Sporulating in Pure Culture. Cramer.</mixed-citation></ref><ref id="scirp.133768-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Kiffer, E. and Morelet, M. (1997) Les Deuteromycetes: Classification et cles d&amp;#8217;Identification Generique. INRA Editions.</mixed-citation></ref><ref id="scirp.133768-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Walsh, T.J., Hayden, R.T. and Larone, D.H. (2018) Larone&amp;#8217;s Medically Important Fungi: A Guide to Identification. American Society for Microbiology.&lt;br&gt;https://doi.org/10.1128/9781555819880</mixed-citation></ref><ref id="scirp.133768-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Kidd, S., Halliday, C. and Ellis, D. (2022) Descriptions of Medical Fungi. CABI.&lt;br&gt;https://doi.org/10.1079/9781800622340.0000</mixed-citation></ref><ref id="scirp.133768-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Murray, M.G. and Thompson, W.F. (1980) Rapid Isolation of High Molecular Weight Plant DNA. &lt;i&gt;Nucleic Acids Research&lt;/i&gt;, 8, 4321-4326. &lt;br&gt;https://doi.org/10.1093/nar/8.19.4321</mixed-citation></ref><ref id="scirp.133768-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Garcia-Jimenez, P., Carrasco-Acosta, M., Pay&amp;#225;, C.E., L&amp;#243;pez, I.A., Rodr&amp;#237;guez, J.R.B. and Meli&amp;#225;n, J.A.H. (2019) Composition and Molecular Identification of Bacterial Community in Seawater Desalination Plants. &lt;i&gt;Advances in Microbiology&lt;/i&gt;, 9, 863-876. &lt;br&gt;https://doi.org/10.4236/aim.2019.910053</mixed-citation></ref><ref id="scirp.133768-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Glass, N.L. and Donaldson, G.C. (1995) Development of Primer Sets Designed for Use with the PCR to Amplify Conserved Genes from Filamentous Ascomycetes. &lt;i&gt;Applied and Environmental Microbiology&lt;/i&gt;, 61, 1323-1330. &lt;br&gt;https://doi.org/10.1128/aem.61.4.1323-1330.1995</mixed-citation></ref><ref id="scirp.133768-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Peterson, S.W. and Sigler, L. (2002) Four New &lt;i&gt;Penicillium&lt;/i&gt; Species Having &lt;i&gt;Thys&lt;/i&gt;&lt;i&gt;a&lt;/i&gt;&lt;i&gt;nophora&lt;/i&gt;-Like Melanized Conidiophores. &lt;i&gt;Mycological Research&lt;/i&gt;, 106, 1109-1118. &lt;br&gt;https://doi.org/10.1017/s0953756202006433</mixed-citation></ref><ref id="scirp.133768-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Kurtzman, C.P. and Robnett, C.J. (1997) Identification of Clinically Important Ascomycetous Yeasts Based on Nucleotide Divergence in the 5&amp;#8217; End of the Large-Subunit (26S) Ribosomal DNA Gene. &lt;i&gt;Journal of Clinical Microbiology&lt;/i&gt;, 35, 1216-1223. &lt;br&gt;https://doi.org/10.1128/jcm.35.5.1216-1223.1997</mixed-citation></ref><ref id="scirp.133768-ref23"><label>23</label><mixed-citation publication-type="book" xlink:type="simple">White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplifcation and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J., Eds., &lt;i&gt;PCR Protocols&lt;/i&gt;:&lt;i&gt; A&lt;/i&gt;&lt;i&gt; Guide Methods Applications&lt;/i&gt;, Academic Press, 315-322. &lt;br&gt;https://doi.org/10.1016/B978-0-12-372180-8.50042-1</mixed-citation></ref><ref id="scirp.133768-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Oliveros, J.C. (2024) Venny. An Interactive Tool for Comparing Lists with Venn&amp;#8217;s Diagrams. &lt;br&gt;https://bioinfogp.cnb.csic.es/tools/venny/  </mixed-citation></ref><ref id="scirp.133768-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Raghukumar, S. (2017) Fungi in Coastal and Oceanic Marine Ecosystems: Marine Fungi. Springer. &lt;br&gt;https://doi.org/10.1007/978-3-319-54304-8</mixed-citation></ref><ref id="scirp.133768-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Li, S., Hartman, G.L., Jarvis, B.B. and Tak, H. (2002) A &lt;i&gt;Stachybotrys&lt;/i&gt;&lt;i&gt; &lt;/i&gt;&lt;i&gt;chartarum&lt;/i&gt; Isolate from Soybean. &lt;i&gt;Mycopathologia&lt;/i&gt;, 154, 41-49. &lt;br&gt;https://doi.org/10.1023/A:1015297907991</mixed-citation></ref><ref id="scirp.133768-ref27"><label>27</label><mixed-citation publication-type="book" xlink:type="simple">Bhansali, R.R. (2011) &lt;i&gt;Ganoderma&lt;/i&gt; Diseases of Woody Plants of Indian Arid Zone and Their Biological Control. In: Michel M&amp;#233;rillon, J. and Gopal Ramawat, K., Eds., &lt;i&gt;Plant Defence&lt;/i&gt;:&lt;i&gt; Biological Control&lt;/i&gt;,&lt;i&gt; &lt;/i&gt;Springer, 209-239.</mixed-citation></ref><ref id="scirp.133768-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Hurtado, J.C., Castillo, P., Fernandes, F., Navarro, M., Lovane, L., Casas, I., &lt;i&gt;et al&lt;/i&gt;. (2019) Mortality Due to &lt;i&gt;Cryptococcus neoformans&lt;/i&gt; and &lt;i&gt;Cryptococcus gattii&lt;/i&gt; in Low-Income Settings: An Autopsy Study. &lt;i&gt;Scientific Reports&lt;/i&gt;, 9, Article No. 7493. &lt;br&gt;https://doi.org/10.1038/s41598-019-43941-w</mixed-citation></ref><ref id="scirp.133768-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Springer, D.J., Mohan, R. and Heitman, J. (2017) Plants Promote Mating and Dispersal of the Human Pathogenic Fungus &lt;i&gt;Cryptococcus&lt;/i&gt;. &lt;i&gt;PLOS ONE&lt;/i&gt;, 12, e0171695. &lt;br&gt;https://doi.org/10.1371/journal.pone.0171695</mixed-citation></ref><ref id="scirp.133768-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">de Souza Oliveira, L.S., Pinto, L.M., de Medeiros, M.A.P., Toffaletti, D.L., Tenor, J.L., Barros, T.F., &lt;i&gt;et al&lt;/i&gt;. (2021) Comparison of &lt;i&gt;Cryptococcus Gattii&lt;/i&gt;/&lt;i&gt;neoformans&lt;/i&gt; Species Complex to Related Genera (&lt;i&gt;Papiliotrema&lt;/i&gt; and &lt;i&gt;Naganishia&lt;/i&gt;) Reveal Variances in Virulence Associated Factors and Antifungal Susceptibility. &lt;i&gt;Frontiers in Cellular and Infection Microbiology&lt;/i&gt;, 11, Article 642658. &lt;br&gt;https://doi.org/10.3389/fcimb.2021.642658</mixed-citation></ref><ref id="scirp.133768-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, S., Wang, L., Han, Q., Sun, A., Liu, X. and Xue, L. (2022) Lung Cancer Coexisting with &lt;i&gt;Papiliotrema flavescens&lt;/i&gt; Infection Diagnosed by Next-Generation Sequencing: A Case Report. &lt;i&gt;BMC Infectious Diseases&lt;/i&gt;, 22, Article No. 684. &lt;br&gt;https://doi.org/10.1186/s12879-022-07591-0</mixed-citation></ref><ref id="scirp.133768-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Aghaei Gharehbolagh, S., Nasimi, M., Agha Kuchak Afshari, S., Ghasemi, Z. and Rezaie, S. (2017) First Case of Superficial Infection Due to &lt;i&gt;Naganishia albida&lt;/i&gt; (Formerly &lt;i&gt;Cryptococcus albidus&lt;/i&gt;) in Iran: A Review of the Literature. &lt;i&gt;Current Medical Mycology&lt;/i&gt;, 3, 33-37. &lt;br&gt;https://doi.org/10.29252/cmm.3.2.33</mixed-citation></ref><ref id="scirp.133768-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Pakshir, K., Fakhim, H., Vaezi, A., Meis, J.F., Mahmoodi, M., Zomorodian, K., &lt;i&gt;et al&lt;/i&gt;. (2018) Molecular Epidemiology of Environmental &lt;i&gt;Cryptococcus&lt;/i&gt; Species Isolates Based on Amplified Fragment Length Polymorphism. &lt;i&gt;Journal de Mycologie M&amp;#233;d&lt;/i&gt;&lt;i&gt;i&lt;/i&gt;&lt;i&gt;cale&lt;/i&gt;, 28, 599-605. &lt;br&gt;https://doi.org/10.1016/j.mycmed.2018.09.005</mixed-citation></ref><ref id="scirp.133768-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Alami, S., Sekkal, I., Aoufi, S., Lyagoubi, M., Benzekri, L. and Senouci, K. (2022) Subcutaneous Phaeohyphomycosis Caused by &lt;i&gt;Aureobasidium pullulans&lt;/i&gt; in an Immunocompetent Carpenter. &lt;i&gt;Medical Mycology Case Reports&lt;/i&gt;, 36, 1-4. &lt;br&gt;https://doi.org/10.1016/j.mmcr.2022.02.003</mixed-citation></ref><ref id="scirp.133768-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Mikulska, M., Furfaro, E., Dettori, S., Giacobbe, D.R., Magnasco, L., Dentone, C., &lt;i&gt;et al&lt;/i&gt;. (2022) &lt;i&gt;Aspergillus&lt;/i&gt;-PCR in Bronchoalveolar Lavage-Diagnostic Accuracy for Invasive Pulmonary Aspergillosis in Critically Ill Patients. &lt;i&gt;Myc&lt;/i&gt;&lt;i&gt;oses&lt;/i&gt;, 65, 411-418. &lt;br&gt;https://doi.org/10.1111/myc.13428</mixed-citation></ref></ref-list></back></article>