The aim of our study was to use a biosurfactant produced by Bacillus and Lactobacillus isolates as an antiseptic in the formulation of local soap. A total of 60 isolates were characterized by microbiological techniques (30 Bacillus and 30 Lactobacillus) and the ability to produce biosurfactants was demonstrated by a hydrocarbon emulsification index (E24). The emulsification indexes (E24) varied from 9% to 100% for Bacillus and from 33% to 100% for Lactobacillus as well. The antagonistic assay showed that biosurfactants were able to inhibit the formation of biofilms and growth of pathogens such as Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, Bacillus cereus, Salmonella typhirium, Shigella boydii and Proteus mirabilis. The biosurfactant consortium (BioC) from Bacillus consortium and from Lactobacillus was able to inhibit biofilm formation and the pathogens growth. The BioC was stable to alkaline pH and the temperatures stability of Biosurfactant was ranging from 50°C to 90°C. The soap was made by the cold saponification process using one biosurfactant consortium formulated. This soap has a pH of 10 and showed good cleaning power and good foam stability. Similarly, the soap showed good antiseptic power and disinfection power against all pathogens tested. Handwashing is critical to preventing disease transmission. The persistence of pathogens in waste water was evaluated. The BioS produced showed good disinfection power against all pathogens tested. The valor of reduction on the hands and in the waste water was significantly more than compared to the control soaps used. This soap could be used in the prevention, fighting, and treatment of bacterial and viral infections.
Biological surfactants are part of key biomolecules that mark the 21st century, with many scientific investigations as to their interest in the industrial world [
In addition to their wetting, emulsification, surface tension reduction, and detergency functions [
Many reviews have focused on biosurfactant production, their characterization and application in the fields of environmental protection, oil refinery, food and agriculture [
The representative foods and beverages used in this study are: Nsamba (palm wine), Ntoba mbodi (fermented cassava leaves), mbamvou (banana wine), poto-poto (fermented maize), bikedi (fermented roots cassava), mokiki (fermented roots cassava tamised), pili-pili (fermented caspis fructens fruits) and Wilde honey. Samples were collected in five markets in different districts (Bacongo, Talangai, NKombo, Makélekéle, and Moungali).
10 g of each collected sample from fermented foods and beverages was aseptically sampled into a sterile falcon tube. Using sterile physiologic water (0, 85%), the sample was homogenized and distributed into ten flacon sterile tubes. Dilutions were done and the bacterial suspension was streaked on Mossel agar medium supplemented with 4.2 mL of polymyxin B for the growth of Bacillus species and on MRS (De Man Rogosa Sharpe) for isolement of Lactic acid bacteria. Enumeration of colonies was done in triplicate on each medium. The plates were incubated at 37˚C for 24 h to 48˚C in aerobic and anaerobic conditions in the incubator.
In order to characterize the isolates, most cultural and biochemical tests were performed by using microbiological and biochemical standard methods. Each colony from Mossel and MRS, of different appearances, was separately isolated. Purification of the isolates was rigorously done by successive and alternating subcultures. The shape, size, and color of bacterial colonies were studied. The morphological characterization has been done using a light microscope (OPTIKA, Italie). The Gram status of the bacterial isolates has been determined using 3% potassium hydroxide (KOH). A sporulation test was conducted to determine the ability of isolates to form endospores. Oxidase and catalase tests were also conducted for all bacterial strains. Further, all these purified isolated cultures were stored at - 20˚C in Luria Broth and MRS broth containing 20% (v/v) glycerol.
The extraction and purification of isolate genomic DNA were performed according to the NucleoSpin Microbial DNA (Macherey-NAGEL) kit. Isolates were grown in 5 mL of LB broth for 24 h at 37˚C with stirring. The DNA purity was assessed by electrophoresis on an agarose gel and by the ratio of optical densities of 260/280nm. 5 μL of each amplification product was mixed with 2 μL of loading buffer (BIOKE). Mixtures were subjected to electrophoresis on 1% agarose gel (w/v). The 10 kb 2-Log (BIOKE) was used as a molecular weight marker.
The identification of Bacillus species was done by the method developed by Kaya Ongoto et al. 2019. B. amyloliquefaciens, B. subtilis, B. pumilus, B. licheniformis, B. altitudinis, B. mojavensis, B. safensis, and B. atrophaeus have all been identified through amplification of the fibE gene, which encodes the fibrinolytic enzyme.
The method developed by Song et al. (2006) was used in this study with a few modifications. For example, 50 μL of a reaction solution for PCR amplification was composed of 1 U Taq DNA polymerase (Promega Corporation, Madison, WI, USA), 25 μL of Master Mix (dNTPs, MgCl2, enzyme buffer), 10 pmol of primer (
The emulsifying activity of a biosurfactant is its capability of retaining the emulsion of hydrocarbons or oils in water. 5 mL of a washing cell and 5 mL of acellular supernatant of each isolate were poured into a test tube containing 5 mL (v/v) of gasoline or fuel. The mixture was vigorously shaken for 3 minutes using a vortex mixer (VELP Scientifica, Italy). The tubes were then incubated at room temperature for 24 hours. The height of the emulsion layer and the total height of the mixture were then measured. All the experiments were performed in triplicates and the emulsification index (E24%) was calculated using the standard formula E24% (He/Ht) 100, with He being the emulsion height, Ht the total height of the mixture, and E24% the emulsification percentage after 24 h.
The extracellular biosurfactant was extracted by the method developed by Kinouani Kinavouidi et al. 2020 has been performed in this study [
Briefly one volume of supernatant was added with an equal volume of chloroform (v/v). The mixture is strongly agitated by a vortex. After centrifugation at
| Oligos names | Sequences 5'…3' | size pb | Groupes of species |
|---|---|---|---|
| Ldel-7 (F) | ACAGATGGATGGAGAGCAGA | 450 pb | Groupe II-1 |
| Lac-2 (R) | CCTCTTGCTCGCCGCTACT | ||
| LU-5 (F) | CTAGCGGGTGCGACTTTGTT | 400 pb | Groupe II-2 |
| Lac-2 (R) | CCTCTTGCTCGCCGCTACT | ||
| LU-3P (F) | AAACCGAGAACACCGCGTT | 350 pb | Groupe III |
| Lac-2 (R) | CCTCTTGCTCGCCGCTACT | ||
| LU-1P (F) | ATTGTAGAGCGACCGAGAAG | 300 pb | Groupe IV |
| Lac-2 (R) | CCTCTTGCTCGCCGCTACT | ||
| Oligos names | Sequences | species | Target species |
| LU-5 (F) | CTAGCGGGTGCGACTTTGTT | 113 pb | L. rhamnosus |
| RhaII (R) | GCGATGCGAATTTCTATTATT | ||
| Laci-1 (F) | TGCAAGTGGTAGCGTAAGC | 210 pb | L. acidophilus |
| 23-10C (R) | CCTTTCCCTCACGGTACTG | ||
| Ljen-3 (F) | AAGAAGGCACTGAGTACGGA | 700 pb | L. jensenii |
| 23-10C (R) | CCTTTCCCTCACGGTACTG | ||
| Lcri-3 (F) | AGGATATGGAGAGCAGGAAT | 522 pb | L. crispatus |
| Lcri-2 (R) | CAACTATCTCTTACACTGCC | ||
| Lgas-3 (F) | AGCGACCGAGAAGAGAGGAGA | 360 pb | L. gasseri |
| Lgas-2 (R) | TGCTATCGCTTCAAGTGCTT | ||
| Lfer-3 (F) | ACTAACTTGACTGATCTACGA | 192 pb | L. fermentum |
| Lfer-4 (R) | TTCACTGCTCAAGTAATCATC | ||
| Lpla-3 (F) | ATTCATAGTCTAGTTGGAGGT | 350 pb | L. plantarum |
| Lpla-2 (R) | CCTGAACTGAGAGAATTTGA | ||
| Lreu-1 (F) | CAGACAATCTTTGATTGTTTAG | 303 pb | L. reuteri |
| Lreu-4 (R) | GCTTGTTGGTTTGGGCTCTTC | ||
| Lsal-1 (F) | AATCGCTAAACTCATAACCT | 411 pb | L. salivarius |
| Lsal-2 (R) | CACTCTCTTTGGCTAATCTT | ||
| LU-5 (F) | CTAGCGGGTGCGACTTTGTT | 411 pb | L. paracasei |
| Lpar-4 (R) | GGCCAGCTATGTATTCACTGA |
6000 rpm for 10 min, the non-aqueous phase is recovered. The solvent was allowed to evaporate completely only without heating above 40˚C. The residue is dissolved in a PBS buffer. In terms of ammonium sulfate an overnight culture has been fuged at 13,000 rpm for 15 minutes to separate supernatant and pellet. Then 15 mL of supernatant were mixed with ammonium sulfate (80%) for 15 minutes. And finally this has been incubated in overnight. Mix has been fuged at 6000 rpm for 30 minutes. Pelet has been hommogenized by using PBS buffer. For both extractions (chloroform and ammonium sulfate) the emulsifying activity is tested in comparison with the supernatant at the start.
The antibacterial activity of the produced biosurfactant extract was tested against seven pathogenic strains (Proteus mirabilis, Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli, Salmonella tiphimurium, Shigella flexineri 5a M90T, and Bacillus cereus) as recently demonstrated by Bokamba Moukala et al. 2020. The antimicrobial activity was evaluated by the agar well diffusion method with some modifications. The antimicrobial activity was done on plate count agar. Wells were aseptically prepared in the Petri dish. The microorganism to be tested was inoculated into the gel. A volume of 75 µl of the biosurfactant extract was deposited onto wells. After an incubation period of 24 hours at 37˚C, the diameter of the inhibition zones was measured. The average of the three measurements was taken to ensure that the results were reproducible. The specific pathogen strain antibiotics were used as positive controls, and the B4 negative biosurfactant producing strain was used as a negative control.
The anti-adhesive activity of the crude biosurfactant extracted from bacilli and lactobacilli isolates against seven microbial strains (Proteus mirabilis, Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli, Salmonella tiphirium, Shigella boydii 5a M90T, and Bacillus cereus) was evaluated according to the procedure described by Goma, 2013 with some modifications. Briefly, the wells of a sterile 96-well flat-bottomed polystyrene microtiter plate were filled with 30 µl of the crude biosurfactant. Control wells contained PBS (1X) buffer only. An aliquot of 200 µl of a washed bacterial suspension (108 CFU/mL) was added and incubated in the wells for 24 h at 37˚C. Unattached microorganisms were removed by washing the wells three times with PBS. The adherent microorganisms were fixed with 200 µl of 30% methanol per well, and after 15 min, the plates were emptied and left to dry. Then the plates were stained for 5 min with 200 µl of 2% crystal violet used for Gram staining per well. Excess stains were rinsed out by placing the plate under running tap water. Subsequently, the plates were air dried, and the activity of each biosurfactant was analyzed. The average of the three measurements was taken to ensure that the results were reproducible [
· Constitution of consortium.
During this study, two consortia of biosurfactants was established using 25 mg of each biosurfactant extract. Con1 was constituted to Bacillus strains biosurfactants (FO1, FO2, FO3, FO4, FO5 and FO6) and Con2 contained Lactobacillus strains biosurfactants (FO7, FO8, FO9, FO10, FO11, FO12, FO13, FO14).
The antimicrobial activity, antiadhesive activity and stability of the consortium at pH (10), temperature (50˚C and 90˚C) and during the time were carried out.
· Cold saponification [
61.25 g of drinking water was weighed and put in a clean basin, and 23.2 g of sodium hydroxide was subsequently added. The mixture was homogenized using a whisk until completely dissolved. Then this mixture was cooled at room temperature until the temperature was pleasant to the touch. While mixing, 100 g of peanut oil and 75 g of olive oil were successively added. The mixture was subjected to a strong homogenization, always using a whip until the appearance of the trace. At this stage, 10 mL of the consortium of biosurfactants was added. This mixture was molded and dried at room temperature until it solidified, then it was unmolded and stored to carry out the rest of the work. In the study we used four total soaps (made soap, ordinary soap, acid salicylic soap, and one commercialized medicated soap Santex).
Physicochemical Properties of Soap· pH
In essay tubs, 2 g of each soap were measured and transferred separately in 20 mL of distilled water. Melanges were homogenised and allowed to stay for 12 hours. The pH was determined using a pH-mètre. [
· Foaming stability
1% of each soap solution was prepared and transferred separately in the essay. Each solution was vigorously homogenised for 1 minute and kept for 5 minutes. Finally, foaming height was measured. Foaming stability has been evaluated for 20 min. [
· Cleaning propeties
One drop of diesel, blood, and bile salt were separately deposed on a filter paper disc. After drying, discs were placed in 1% of each soap solution. The melange was homogenised and incubated at room temperature for 2 minutes. Each disc was retired and rinsed in water, and after drying the disc, the cleaning power of each soap was appreciated [
The effectiveness of the soap developed has been tested on seven (7) pathogens. To do this, 5 g of each soap was individually transferred into different bottles containing 10 mL of peptone water. The mixtures thus obtained were vigorously homogenized. Then, series of double dilutions were carried out to obtain, respectively, 500 mg, 250 mg, and 125 mg of the concentration for each soap. 75 μL of each concentration was introduced into the wells of an agar previously inoculated with the pathogen to be tested. The dishes were left for 1 hour at room temperature to allow diffusion and then incubated at 37˚C. for 24 hours, and the zones of inhibition were measured in mm [
To test the disinfection ability of elaborated soap, hand decontamination tests were conducted on seven reference strains (P. mirabilis, P. aeruginosa, S. aureus, E. coli, S. tiphirium, S. boydi 5a M90T, and B. cereus) [
· Prepare Organisms
Prepare the organism to be used for testing at a concentration greater than 10 × 108 CFU/mL for bacteria.
One day before the start of the experiment, pick a single colony from the plate and inoculate 10 mL of LB broth using a sterile loop. Incubate overnight at 37˚C with shaking. In the morning of the experiment, start a fresh culture by adding 1 mL of the overnight culture to 20 mL of fresh LB broth. Incubate for approximately 2.5 h to achieve a cell density greater than 108 CFU/mL.
Use a spectrophotometer to estimate the concentration of the culture.
· Preparing Volunteers for the Experiment
Before beginning testing, confirm that the volunteers remain eligible by verbally verifying that they adhered to the seven days, antimicrobial washout period and by visually confirming that they have not developed any breaks or abnormalities on their skin. Using a random number generator, assign each volunteer to use either their right or left hand for sampling on this day of testing. Assign an order in which the handwashing conditions will be performed. Perform a “cleansing wash” once at the start of testing to strip the skin of dirt and oils so that each subsequent test is conducted under equivalent conditions.
To do a cleansing wash, run through each step of the experiment using a blank inoculate (LB broth or PBS only) and take a sample without handwashing.
· Experimental Procedure
To test the pH of the skin of each volunteer (to control for variation), place a flat-tipped skin pH probe on the palmar surface of the skin and the web space between the pointer and middle finger. Ensure that the electrode is flat against the skin. Record the pH reading.
· Spike the hands.
Have the volunteers cup both hands together. Spike the hands with 1.5 mL of the inoculate by carefully pipetting 750 µL slowly into each palm. Have the volunteers gently rub their hands together until all surfaces of the hands are coated with the inoculate, while subjecting the hands to as little friction as possible.
Have the volunteers hold their hands still and away from their bodies for an additional 30 seconds to allow the inoculate to dry. The inoculate may not dry completely.
- Wash the hands
For all the following wash steps, capture the rinse water from the hands in a large sample collection bag.
After inoculation, wash the hands with the next method in the designated order.
For Control A, do not perform a handwashing step and move directly to hand rinse.
For Control B, wash the hands with only sterile water at room temperature through a funnel with a known flow rate. For handwashing with soap, wet the hands with 10 mL of sterile water. Have the volunteers lather their hands with soap and then rub their hands together for an additional 20 seconds. Rinse their hands by pouring 500 mL of sterile water at room temperature.
- Hand rinse using a modified glove juice procedure
After handwashing, immediately place each volunteer’s hand (i.e., the hand (right or left) selected for testing in into a sample bag containing 75 mL of eluent (PBS) up to the wrist. Hold the top of the bag tightly around the wrist. Have the volunteers gently rub their hands in the solution for 30 seconds, taking care to reach in between the fingers and underneath the fingernails. Massage the hand from outside the bag gently for 30 seconds to ensure that the entire hand is rinsed thoroughly in the eluent, all the way up to the wrist. Seal the bag and process it according to the appropriate assay.
- Decontamination.
Before repeating the process with each handwashing method, have the volunteers wash their hands thoroughly in a sink with soap and warm water. Spray the volunteers’ hands with 70% ethanol until they are coated on both sides. Allow them to dry. Repeat all steps for each handwashing condition, only using the hand randomly selected.
- Quantification
The quantification of each oeganism was done by simple enumeration. After counting the plates, record the estimated CFU/mL for each test for the analyses.
- Analysis
The log reduction value of organisms on the hands, for each organism and for each subject and handwashing method, was calculated. For handwashing efficacy, compare the concentration of bacteria in each handwashing sample to control A (no handwashing). For rinse water persistence, compare each rinse water sample to control B (washing with water only). Use the following standard formula:
LogReduction ( handwashing ) = log1 0 ( CFU / mL withouthandwashing CFU / mL selectedhandwashingmethod )
LogReduction ( rinsewater ) = log1 0 ( CFU / mL handwashingwithwateronly CFU / mL selectedhandwashingmethod )
One-way repeated measures analysis of variance (ANOVA) to assess the significant differences in the calculated log reduction values between handwashing methods and a post-hoc Tukey’s HSD test for significant models to pairwise assess significant differences (p < 0.05) were used.
Isolation on Mossel and MRS media has been used to highlight the presence of bacteria from the genera Bacillus and Lactobacillus. Thus, 60 isolates were obtained, screened, and purified from raw material: palm wine (5), Ntoba Mbodi (5), Mbamvu(4), honey (9), Bikedi (4), Mokiki (9), Pili pili (9), Ginger wine (5), and Poto poto(10). These isolates have been the subject of various microbiological issues, biochemistry, and molecular biology. The purified isolates were macroscopically and microscopically characterized (data not shown). Sixty (60) isolates were characterized 45 of the 60 isolates are round, and 15 are oval. All isolates retained are gram-positive bacteria. All isolates are sticks. Of the 100% isolates, 50% are mobile and 50% are not. 50% of the isolates are catalase positive and 50% are catalase negative. 20% have a dry texture against 60% creamy and 20% pasty. According to Bergey’s manual, the morphological and biochemical characterization of the isolates, 50 were studied and were suspected to be Bacillus (30) and Lactobacillus (30) species. The sixty isolates were used for molecular identification.
The purified isolates were the subject of genomic DNA extraction. Six (6) pairs of primers targeting genes encoding for fibrinolytic enzyme amplified and discriminated against Bacillus species, while twenty-two (22) ITS (ARNr 16S-23S) primers amplified and discriminated against Lactobacillus species. 870 PCRs were performed with all primer pairs used. As a result, amplifications enable the identification of Bacillus isolates FO1 and FO2, which are assigned to B. safensis; FO3, FO4, FO5, and FO6 were assigned to B. subtilis (
Using the ITS regions, FO7, FO8, FO9, FO10, FO11, FO12, FO13 and F014 isolates were identified as L. plantarum; FO15 and FO16 as L. paracasei; FO17 as L. gasseri; and FO18 as L. salivarius (
To highlight the production of biosurfactant, we performed the emulsification test on strains by using acellular supernatant. This study shows that all 18 strains produced biosurfactants with an emulsification index (EI24) ranging from 68.28% to 94.11% after 24 hours (
All tested strains produced biosurfactants when they were used for extraction. All strains showed a precipitate at the bottom of the tube (
| Isolates | Origin samples | Strains |
|---|---|---|
| FO1 | Ntoba Mbodi | Bacillus. sanfensis |
| FO2 | Ginger wine | |
| FO3 | Ntoba Mbodi | Bacillus. subtilis |
| FO4 | Mokiki | |
| FO5 | honey | |
| FO6 | palm wine | |
| FO7 | Mbamvu | Lactobacillus plantarum |
| FO8 | Poto poto | |
| FO9 | Bikedi | |
| FO10 | Mbamvu | |
| FO11 | Mbamvu | |
| FO12 | Pili pili | |
| FO13 | Pili pili | |
| FO14 | Ntoba Mbodi | |
| FO15 | Pili pili | Lactobacillus. paracasei |
| FO16 | Poto poto | |
| FO17 | Poto poto | Lactobacillus gasseri |
| FO18 | Poto poto | Lactobacillus salivarius |
precipitation, suspended in PBS, was able to emulsify gasoline with 100% of EI24 (
The biosurfactants extracted from strains allowed the inhibition tests to be performed against seven pathogenic strains, both gram positive strains (S. aureus and B. cereus) and Gram negative strains (Proteus mirabilis, P. aeruginosa, E. coli, S. typhimirium, and S. flexneri 5a M90T). In addition, the diameters of inhibition of all isolates have been measured. We discovered that all biosurfactant extracts inhibited the target pathogen strains (
The diameters of inhibitions obtained made it possible to mount the graph below (
The consortiums have been tested. We found that the consortia inhibited the growth of pathogenic bacteria. However, the inhibition was much better when the biosurfactants were combined. (
In order to test the anti-adhesive activity of the consortium on their ability to form biofilms, the crystal violet assay has been experimented (
In this study, soap was made using a cold saponification process mixed first with
consortia. One biosurfactant soap has been formulated using a biosurfactant consortium (Cons 1 and Cons 2) (
The biosurfactant consortium showed considerable activity against all target strains, and the inhibition halo diameters ranged from 5 to 17 mm. The biosurfactant consortium used showed good stability to pH, temperature and during the store time (p > 0.05). All biosurfactants conserved all biologic activities after all treatment. A biosurfactant consortium demonstrated potent anti-cell adhesion activity against E. coli, B. cereus, S. aureus, P. mirabilis, S. typhimurium, and S. flexineri (Data no shown).
In order to carry the antibacterial potential of formulated biosurfactant soap, the antibacterial activity was investigated against P. mirabilis, P. aeruginosa, S. aureus, Escherichia coli, S. tiphirium, S. flexineri 5a M90T, and Bacillus cereus. The result shows that BCS was able to inhibit all target strains (
The handwashing property of manufactured soap has been investigated.
Here, the protocol was completed with volunteers, who were each tested using both the 7 reference strains. Significant differences were found between handwashing results with all strains (
water only (red log = 4.342 p < 0.009). In the rinse water, the biosurfactant soap resulted in a greater log reduction of E. coli persisting in the rinse water than an ordinary soap and salicylic acid soap (red log = 1.257 p < 0.001). In the case of B. cereus compared to handwashing with only water or with ordinary soap and salicylic acid soap, handwashing with biosurfactant soap demonstrated a high reduction of organisms during handwashing (red log = 3.926 p < 0.05) and in rinse water (red log = 1.537 p < 0.05). The same pattern was found with Proteus mirabilis, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella tiphimurium, and Shigella boydii 5a M90T. Handwashing using the biosurfactant soap shows a greater significant log reduction of organisms than handwashing using control soaps or with only water. On the hands, the log reduction value of target strains ranged from 4.505 for Staphylococcus aureus to 4.807 for Salmonella typhirium, 4.788 for Shigella boydii, 5.283 for Proteus mirabilis, and 4.03 for Pseudomonas
aeruginosa (p < 0.05). In rinse water, biosurfactant soap resulted in a greater log reduction than all other soaps used (p < 0.05). The result shows a considerable diminution of the persistence of all strains in a biosurfactant rinse water (
The valor of log reduction of target strains on the hands ranged from 0.413 for Staphylococcus aureus, 1.396 for Salmonella typhirium, 1.217 for Shigella boydii, 1.113 for Proteus mirabilis, and 0.545 for Pseudomonas aeruginosa.
In this work, the main goal was to show more benefits from using biosurfactants. The role of biosurfactants should be considered again. Indeed, in many departments
of the Republic of Congo, Congolese are consumers of fermented beverages and sometimes seek new tastes, novel sensations, and good protective beverages [
In this work, 60 isolates (Lactobacillus and Bacillus) were found using local foods. Previous studies have reported that bacteria of the genera Lactobacillus and Bacillus are isolated from local and fermented foods [
Direct identification by housekeeping genes PCR has been used to identify isolates. L. plantarum (66,66%) was associated with CMBM2, CMP7, VC4, CMBVOU1, M19, CO2, CMNS4 and TM13 for Lactobacillus isolates, and B. subtilis (50%) was associated with 43, 4, G7, and NM23 for Bacillus isolates. The use of the fibE gene for Bacillus identification [
In this work, we have clearly shown the ability of Lactobacillus and Bacillus isolates to produce biosurfactants through an emulsification test with gasoline. Emulsification indexes (E24) ranged from 64.28% to 100% and from 33.33% to 100% were obtained from the cell culture and the Lactobacillus supernatant, respectively. We also showed the ability of Bacillus to produce biosurfactants whose emulsification index (E24) varied from 20% to 94.11% for the culture and from 9.09% to 100% for the supernatant. Previous work shows that bacteria are able to produce two types of biosurfactants; extracellular biosurfactants and cell membrane-bound biosurfactants [
The biosurfactants extracted with HCl are able to inhibit the cell adhesion and the growth of pathogenic bacteria, including Proteus mirabilis, Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli, Salmonella tiphirium, Shigella boydii 5a M90T, and Bacillus cereus. Moukala and Elenga have respectively shown the potential of Bacillus and Lactobacillus biosurfactants to inhibit pathogens [
The ability of microorganisms to secrete and the presence of biosurfactants in the extracellular medium may account for the absence of pathogenic bacteria in the same fermented foods [
The consortium of biosurfactants was established in this study and biological activities were investigated. The results showed that the biosurfactant consortium was easily able to inhibit the growth and biofilm formation of pathogens. Some studies have reported that biosurfactants can be associated with acting in synergy [
Using the cold saponification process, the biosurfactant consortium soap was made. Some physico-chemical parameters of madding soap were investigated, like pH, foaming stability, and cleansing properties. The pH of all soaps in this study was 10, and the biosurfactant soap produced showed a strong, stable foam compared to the control soaps used (ordinary soap and salicylic soap). The product soap possesses good activity to remove blood, bile salt, and diesel dirt. A study reported that the pH of kindly soaps is comprised of a range of 7 to 10 [
The antiseptic property of biosurfactant soap was researched against Proteus mirabilis, Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli, Salmonella tiphirium, Shigella boydi 5a M90T, and Bacillus cereus.
The biosurfactant soap inhibited more pathogens than the control soaps (ordinary soap, salicylic acid soap, and medicated santex soap). The minimal inhibitory (MIC) concentration was found to be 125 mg/mL for Pseudomonas aeruginosa, Escherichia coli, Proteus mirabilis, Staphylococcus aureus and 250 mg/mL for Salmonella tiphirium, Bacillus cereus, and Shigella boydii 5a M90T. It’s important to note that ordinary soap and salicylic acid soap showed inhibit activity against some pathogens, but this activity was less than biosurfactant soap. This potential could be assigned to biosurfactants by possessing antimicrobial activity [
Biosurfactants can be versatile in their interactions with pathogenic bacteria being variously beneficial, neutral or antagonistic in their effect. This would go a long way in making biosurfactants a commercially successful compound of the current century. In addition, the ability to decontaminate the hands of the soap produced was evaluated on seven (7) pathogens as well as their ability to persist in rinsing water. The results obtained show that the soap with biosurfactant extracts was able to effectively reduce the microorganisms on the hands of the volunteers compared to the control soaps (p < 0.001). This observation was the same for the persistence of pathogenic microorganisms in the rinse water for all the microorganisms tested compared to ordinary soap and soap with salicylic acid (p < 0.001). Our results are similar to those of Janice et al. in 2008, who showed that antiseptic soaps were able to reduce the contamination of pathogens like Shigella flexneri and Escherichia coli on the hands [
Handwashing is essential for disease prevention [
This present work has contributed to the valorization of biosurfactants produced by bacteria of the Bacillus and Lactobacillus genera isolated from different foods in the Republic of Congo.
This study demonstrated that biosurfactants can be secreted directly into the extracellular medium. Lactobacillus and Bacillus were isolated from local foods in this study. The biosurfactant extracts with HCl are able to inhibit biofilm formation and the growth of pathogenic bacteria such as Proteus mirabilis, Pseudomonas aeruginosa, Staphylococcus aureus, Escherichia coli, Salmonella tiphirium, Shigella boydii 5a M90T, and Bacillus cereus.
The consortium of biosurfactants was established in this study and biological activities were investigated. The results showed that the biosurfactant consortium was easily able to inhibit the growth and biofilm formation of pathogens. Some studies have reported that biosurfactants can be associated with acting in synergy. The stability of biosurfactants consortium to temperature (50˚C and 90˚C), pH (10) and during the conservation (2 months). The consortium tested has conserved the biological activities after all treatments. Biosurfactants can resist higher temperatures and alkaline pH. Biosurfactants are produced under various growth and environmental conditions and are reported to be mainly involved in increasing the solubility and availability of various water-immiscible substrates.
The soap produced showed an antiseptic power directed against all the pathogens tested. Similarly, the results of the hand decontamination test for this soap are very encouraging. In addition, the soap is able to significantly reduce the persistence of microorganisms in the rinse water. This promising soap could be used in households, in the prevention of diarrheal diseases related to dirty hands in children from 0 to 5 years old, and in the cleaning of hands and equipment in clinical and hospital settings. In addition, the biosurfactants produced could be applied as biopreservatives, biocontrol agents, and why not in the prevention of transmission of covid-19. Finally, eight strains of Bacillus were identified based on DNA technology targeting genes encoding fibrinolytic enzymes like B. safensis, B. subtilis, and B. pumilus. On the other hand, 10 Lactobacillus strains were identified using PCR of the ITS regions of 16S-23S rDNA such as L. plantarum and L. paracasei.
This work also constitutes a scientific support, a reference tool and a source of information that may be of interest to future scientists and researchers who would like to deepen the analysis.
This work was supported by International Atomic Energy Agency (AIEA). Through the project INT0098, the IAEA had provided a package that includes detection equipment, namely real-time RT-PCR and kits, together with reagents and laboratory consumables, as well as biosafety supplies such as personal protection equipment and laboratory cabinets for the safe handling and analysis of samples. This equipment was also essential for detecting, tracking and studying the coronavirus that causes COVID-19 disease.
The authors declare no conflicts of interest regarding the publication of this paper.
Okouakoua, F.Y., Kayath, C.A., Mokémiabeka, N.S., Elenga, V.B.N., N’goma-Mona, D.N., Lambi, N.N., Wilson, S.P.E., Malanda, C.D.B., Tsana, R., Bissoko, J.P.S., Kaya-Ongoto, M.D., Kinavouidi, D.J.K. and Nguimbi, E. (2024) Antiseptic Efficacy of A Soap Made from Biosurfactants Isolated from Bacillus and Lactobacillus against Pathogenic Bacteria. Advances in Microbiology, 14, 31-58. https://doi.org/10.4236/aim.2024.141004