<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OALibJ</journal-id><journal-title-group><journal-title>Open Access Library Journal</journal-title></journal-title-group><issn pub-type="epub">2333-9705</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/oalib.1111005</article-id><article-id pub-id-type="publisher-id">OALibJ-130301</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Business&amp;Economics</subject><subject> Chemistry&amp;Materials Science</subject><subject> Computer Science&amp;Communications</subject><subject> Earth&amp;Environmental Sciences</subject><subject> Engineering</subject><subject> Medicine&amp;Healthcare</subject><subject> Physics&amp;Mathematics</subject><subject> Social Sciences&amp;Humanities</subject></subj-group></article-categories><title-group><article-title>
 
 
  A Breakthrough to the Meaning of the Fine Structure Numbers with Nucleotide Bases as Regards to Quantum Perspective Model?
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tahir</surname><given-names>&amp;Ouml;lmez</given-names></name><xref ref-type="aff" rid="aff1"><sub>1</sub></xref></contrib></contrib-group><aff id="aff1"><label>1</label><addr-line>Social Sciences Department, Sel&amp;amp;ccedil;uk University, Konya, Türkiye</addr-line></aff><pub-date pub-type="epub"><day>04</day><month>12</month><year>2023</year></pub-date><volume>10</volume><issue>12</issue><fpage>1</fpage><lpage>23</lpage><history><date date-type="received"><day>18,</day>	<month>November</month>	<year>2023</year></date><date date-type="rev-recd"><day>26,</day>	<month>December</month>	<year>2023</year>	</date><date date-type="accepted"><day>29,</day>	<month>December</month>	<year>2023</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  As pertaining to Quantum Perspective Model, this paper attempts to express the number of Fine Structure Constant numbers with chemical nucleotide bases (A T, G, C and U) especially between the atomic weight of electron and Planck’s numbers and the velocity of light numbers of the electromagnetic field, by the Formula (4πε0hcα = e2). Its numerical value is approximately 0.0072973525693 ≅ 1/137.035999084, the recommended value of α is; α = e2/4πε0hc. At first, the equation of Quantum Field Theory’s law is converted to genetic codes. (Because, frequency of first significant digit of physical constants plotted against Benford’s law is very nearly closed). Secondly, the variables of fine structure constant are squared twice (The fourth power is taken). Thirdly, this formula’s numbers are converted to binary number base system (2). Fourthly, the outcomes of these numbers are converted to binary base system to decimal number base system (10). (Just like as seen in DNA 5’ to 3’ translation REVERSE direction and RNA 3’ to 5’ forward direction). Fifthly, the outcomes of these numbers are summed one by one. Sixthly, the consequence of this addition processes corresponds to nucleotide bases [Adenine (A), Thymine (T), Guanine (G), Cytosine (C) and Uracil (U)]. Seventhly, as pertaining to fine structure constant; the square number of fine structure constant equals to “CTUU” and the square number of electric constant equals to “GTU”. Ninthly, furthermore, the conclusion of this genetic sequence “UTAUTAUGTUAACCATAUUTU” also is corrected by NCBI Blast Results. So, this “affirmation of this variable” can be regarded as both numeric values of this formulas and the expression of this variables, too. As a result, this article revealed the expression of the atomic weight of electron can be related to “Uracil(U)” nucleotide base, according to exact value number of electron. Interestingly, the quarter of “Uracil(U)” has the same total atomic weight of numeric value as the [“Cysteine” (UGU/UGC)] amino acid chemical formula “64” (C
  <sub>3</sub>H
  <sub>7</sub>NO
  <sub>2</sub>S) which is very significant for hair strength. Even, the common explanation of Pi numbers and the expression of electron as genetic codes are the same NCBI Blast result as in “
  Danio rerio”, “BOMBYX MANDARINA” and “human genom of ARGININE”. Eleventhly, the other NCBI results are the ARGININE amino acid for human being genetic sequence and Drosophila immigrants which can be very well excellent sample to understand the how viruses evolves with hosts. Lastly, the fine structure constant number can also be expressed as “Reduced Planck constant” in shortly. (h ≈ α) with the “one (1) hydrogen lack of atom” less than the numerical value in denominator. = [1/2*(UTA)] or [1/(α - “1 = Hydrogen”)] (Let alone, The Fine structure constant numeric value is approximately the ratio of one (1) and 137 (one hundred thirty seven) that is nearly to the ratio of “(1/137)”. Moreover, not only the number of Fine Structure Constant Number consists of the number of “137” but also the chemical molecular formula of “Chlorophyll” [(C
  <sub>55</sub>H
  <sub>72</sub>MgN
  <sub>4</sub>O
  <sub>5</sub>); and its total elements are even “137” (55 + 72 + 1 + 4 + 5:137)]. That is to say, the total number of “
  Chlorophyll” is “137” too. Lastly, after searching this sequence “UTAUTAUGTUAACCATAUUTU” in the NCBI (The National Center for Biotechnology Information) database, there is a genetic link between Fibonacci sequences in Mathematics, Euler numbers and fine structure numbers. As a result, the expression of fine structure number of “137” with genetic codes as “Uracil (U)” and the square number of electric constant equals to “GTU”, As a result, the “Reduced Planck constant” conclusion of this genetic sequence reaches a striking meaningful result that will shed light on the Quantum Perspective Model, which may be a novel method and parameter and paradigm for many Sciences.
 
</p></abstract><kwd-group><kwd>Biology</kwd><kwd> Mathematics</kwd><kwd> Nucleotide Bases</kwd><kwd> Quantum Physics</kwd><kwd> Quantum Perspective Model</kwd><kwd> The Fine Structure Constant number</kwd><kwd> Reduced Planck Constant Number</kwd><kwd> NCBI (The National Center for Biotechnology Information)</kwd><kwd> Vacuum Permittivity</kwd><kwd> Chlorophyll</kwd><kwd> Fibonacci Sequence</kwd><kwd>  Golden Ratio</kwd><kwd> Corona Virus (Covid-19) and Bat Coronavirus</kwd><kwd> &lt;i&gt;Danio rerio&lt;/i&gt;</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>In physics, the fine-structure constant, also known as the Sommerfeld constant, commonly denoted by α, is a fundamental physical constant which quantifies the strength of the electromagnetic interaction between elementary charged particles. It is a dimensionless quantity, independent of the system of units used, which is related to the strength of the coupling of an elementary charge e with the electromagnetic field, by the formula 4πε<sub>0</sub>ħcα = e<sup>2</sup>. Its numerical value is approximately 0.0072973525693 ≅ 1/137.035999084, with a relative uncertainty of 1.5 &#215; 10<sup>−10</sup>.</p><p>α = e<sup>2</sup>/ 4πε<sub>0</sub>ħc = 0.0072973525693. This has a relative standard uncertainty of 1.5 &#215; 10<sup>−10</sup>. 1) The fine structure constant, denoted by α (alpha), is a fundamental constant in physics that characterizes the strength of the electromagnetic interaction between elementary charged particles. It is dimensionless and approximately equal to (1/137). The value of the fine structure constant is determined through experimental measurements and is not derived from any specific formula. However, I can provide you with an overview of how the fine structure constant arises in certain physical theories. In Quantum Electrodynamics (QED), which is the quantum field theory describing the electromagnetic interaction, the fine structure constant appears as a coupling constant. It relates the strength of the electromagnetic force between charged particles to the charge of the particles and the exchange of virtual photons. In QED, the fine structure constant is given by:</p><p>α = e<sup>2</sup>/ 4πε<sub>0</sub>ħc; where: (e) is the elementary charge,</p><p>(ε<sub>0</sub>) is the vacuum permittivity,</p><p>(h) is the reduced Planck constant, and</p><p>(c) is the speed of light in a vacuum.</p><p>The value of the fine structure constant can be experimentally determined through various methods, such as precision measurements of the electron’s magnetic moment or measurements of atomic spectra. It’s important to note that the fine structure constant is a dimensionless quantity and does not depend on any specific unit system. Its value is approximately 1/137, but it is known to have a very small, but non-zero, deviation from this value due to quantum corrections and renormalization effects. The value of the fine structure constant can be experimentally determined through various methods, such as precision measurements of the electron’s magnetic moment or measurements of atomic spectra. It’s important to note that the fine structure constant is a dimensionless quantity and does not depend on any specific unit system. Its value is approximately (1/137), but it is known to have a very small, but non-zero, deviation from this value due to quantum corrections and renormalization effects. In summary, the fine structure constant is determined experimentally and does not have a specific formula that directly derives its value. It arises naturally in the framework of quantum electrodynamics and is related to the fundamental constants of nature. [<xref ref-type="bibr" rid="scirp.130301-ref1">1</xref>] As a result, this paper attempts to express the fine structure constant numbers (especially, the number of “137”) with chemical nucleotide bases (A T, G, C and U) as regards to Quantum Perspective Model.</p></sec><sec id="s2"><title>2. Methods</title><p>According to “Quantum Perspective Model”, at first K. K&#214;KL&#220; tries to explain the approximate numeric value of Pi numbers (22/7) [<xref ref-type="bibr" rid="scirp.130301-ref2">2</xref>] as genetic codes. Secondly, she was again at the way of searching the links between the velocity of light numbers [<xref ref-type="bibr" rid="scirp.130301-ref3">3</xref>] and genetic codes. Thirdly, with regards to Quantum Perspective Model, T. &#214;LMEZ was expressed not only the some irrational numbers, but also expressed the some irrational numbers as chemical formulas of nucleotide bases. Some of this irrational numbers are Pi [<xref ref-type="bibr" rid="scirp.130301-ref4">4</xref>] , Euler’s [<xref ref-type="bibr" rid="scirp.130301-ref5">5</xref>] , golden ratio numbers [<xref ref-type="bibr" rid="scirp.130301-ref6">6</xref>] , and the square root of square root of two [<xref ref-type="bibr" rid="scirp.130301-ref7">7</xref>] , square root of three [<xref ref-type="bibr" rid="scirp.130301-ref8">8</xref>] , square root of five [<xref ref-type="bibr" rid="scirp.130301-ref9">9</xref>] , square root of seven [<xref ref-type="bibr" rid="scirp.130301-ref10">10</xref>] , square root of ten [<xref ref-type="bibr" rid="scirp.130301-ref11">11</xref>] and Fibonacci numbers [<xref ref-type="bibr" rid="scirp.130301-ref12">12</xref>] also Even the Euler Identity [<xref ref-type="bibr" rid="scirp.130301-ref13">13</xref>] and the extended golden ratio numbers [<xref ref-type="bibr" rid="scirp.130301-ref14">14</xref>] were also published by Tahir &#214;LMEZ. In summary, the codes of all these irrational numbers explained by a genetic sequence (mentioned below) can be found in this diagram. (Please, See, <xref ref-type="table" rid="table1"><xref ref-type="table" rid="table">Table </xref>1</xref>). The representation of nucleotide bases (A, T, G, C, and U) according to the Quantum Perspective Model is explained by chemical formulas. Regarding these chemical formulas, it was calculated according to the fine-structure constant numbers and the atomic masses of the elements. However, this article aims to investigate the relationship between numbers (Please, See <xref ref-type="table" rid="table1"><xref ref-type="table" rid="table">Table </xref>1</xref>) and nucleotide bases. In summary, the purpose of this research article is to explore the relationships between atomic weights, number base systems, and chemical formulas of nucleotide bases of the fine-structure constant numbers and the vacuum permittivity numbers. Basically, the chemical structures of nucleotide bases consist of Carbon (C), Nitrogen (N), Oxygen (O) and Hydrogen (H) (Please, See, <xref ref-type="table" rid="table1"><xref ref-type="table" rid="table">Table </xref>1</xref>). For the representation of nucleotide bases (A, T, C, G and U) in chemical atoms; (Please, See <xref ref-type="table" rid="table2"><xref ref-type="table" rid="table">Table </xref>2</xref>). Let alone previous explanations, some of the Constant Numbers can also be defined as Nucleotide Bases, too. (Please, See <xref ref-type="table" rid="table3"><xref ref-type="table" rid="table">Table </xref>3</xref>).</p></sec><sec id="s3"><title>3. Calculation of the Fine-Structure Constant and Electric Constant Numbers via Nucleotide Bases</title><p>In physics, the fine-structure constant (α), is a fundamental physical constant which quantifies the strength of the electromagnetic interaction between elementary charged particles.</p><p>It is a dimensionless quantity, independent of the system of units used, which is related to the strength of the coupling of an elementary charge e with the electromagnetic field, by the formula</p><p>4πε<sub>0</sub>ħcα = e<sup>2</sup>. Its numerical value is approximately 0.0072973525693 ≅ 1/137.035999084</p><p>n terms of other fundamental physical constants, α may be defined as:</p><p>where</p><p>• e is the elementary charge (1.602176634 &#215; 10<sup>−19</sup> C); (The expression of the atomic weight of electron is Uracil (U)</p><p>• h is the Planck constant (6.62607015 &#215; 10<sup>−3</sup> J∙Hz<sup>−1</sup>); (The expression of the atomic weight of Planck constant number is Uracil (U). Even the “Reduced Planck constant” [<xref ref-type="bibr" rid="scirp.130301-ref17">17</xref>] “ħ” = (h/2*pi) = “U”/“UTA” = 1/“TA” = 1/(70 + 66) = 1/136 = 0007329412 ≈ α.</p><p>• To sum up; Reduced Planck constant is almost the same value as the fine structure constant number (ħ ≈ α) with the “one (1) hydrogen lack of atom” less than the numerical value in denominator. = [1/2*(UTA)] or [1/(α − “1 = Hydrogen”)]</p><p>• c is the square of the (299,792,458 m⋅s<sup>−1</sup>) speed of light numbers; c<sup>2</sup> (89875517873681764 (The expression of the atomic weight of is c<sup>2</sup>; “AUC or TAG”</p><p>• ε<sub>0</sub> is the electric constant [(8.8541878128(13) &#215; 10<sup>−12</sup> F∙m<sup>−1</sup>]. [<xref ref-type="bibr" rid="scirp.130301-ref21">21</xref>]</p><p>• The expression of approximate Pi numbers (π) (22/7 = 3.1428571… forever cyclic “428571”…) as genetic codes (22/7 = forever UTA’s). [<xref ref-type="bibr" rid="scirp.130301-ref2">2</xref>]</p><p>4*(64*64*64*64) = 16*(2*194) [α<sup>2</sup>*( ε 0 2 )]*(2*70)*(580),</p><p>67,108,864 = 6208 * [α<sup>2</sup>*( ε 0 2 )]*(81,200)</p><p>67,108,864 = [α<sup>2</sup>*( ε 0 2 )]*(81,200)</p><p>[α<sup>2</sup>*( ε 0 2 )] = 0.13312884</p><p>α<sup>2</sup>*( ε 0 2 ) ≅ 1331/10^3</p><p>α*(ε<sub>0</sub>) = 0.365270810452434... with infinite fraction without repeating and can not expressed as finite decimal = 365*10^−4 + 27*10^−5 = [Almost as the same time of world cycling duration around the sun with 365 days and six hours (365 days*24 hours/6 hours = 0.00068 ≈ 0.0007 = 7*10<sup>−</sup><sup>4</sup>]. Namely, the consequence of time cycling of hours (6 hours) is with magic number of seven (7), too. Let alone, the meaning of ten power of minus “four” can be stemmed from the losing weight from the atomic mass of one “Adenine = 70 nucleotide base to Thymine = 66 nucleotide base” 70 − 66 = 4”.</p><p>(Remember ,this digits are the third row of Pascal’s Binom Triangle digits (1, 3, 3, 1) and even total sum of digits (1 + 3 + 3 + 1 = 8 = 2^3) are the third power of DUAL one number (1) digits as also seen at the sequence of Fibonacci Sequence (0, 1, 1, 2, 3, … and so on). Let alone this dual palindromic numbers (13, 31) and besides this dual palindromic numbers also seen at the location of golden ratio numbers at the sequence of Fibonacci Sequence (0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, …). Namely, the first palindromic number exists in the ELEVENTH (11th) location with the numbers of (55/34). But as regards to cyclic Numbers of Pi numbers and the similar cyclic numbers are also multiplied by the ELEVEN number (11). For instance: [22(11*2)/7:3, 1428571… with infinite cyclic “428571” and even [1/7:0, 1428571… with again forever “428571” cyclic numbers] and [55(5*11)/(3*11):1.666667... and even 144/88:1.636363… with forever “63”’s and let alone the sum of this palindromic numbers of (“63” is “36”) equals to “99” = nearly the power of three (10^3) with the lack of reoccurrence “one (1)” number as seen at the beginning Fibonacci Sequence with twin one numbers, too. Moreover, at the Pascal Binom Triangle, the sum of the fifth power of ELEVEN numbers (1 + 5 + 10 + 10 + 5 + 1 = 22) with the numeric value of “twenty-two” at the sixth row as the same approximate ratio of pi numbers to the infinite sums to the infinity; can be regarded as an origin of this research method, too]</p><p>e<sup>2</sup> = 4πε<sub>0</sub>ħcα</p><p>e<sup>4</sup> = 16π<sup>2</sup>α<sup>2</sup>ε<sub>0</sub><sup>2</sup>ħ<sup>2</sup>c<sup>2 </sup></p><p>[With the consideration of dual actin of atoms with particle and wave, the consequence of derivative becomes “particle” and the integral function becomes an “area”/“wave”, too].</p><p>4*(e) = 16*π<sup>2</sup>*[α<sup>2</sup>*(ε<sub>0</sub><sup>2</sup>)]*h<sup>2</sup>*c<sup>2</sup> =</p><p>4*(UUUU) = 16*[(UTA)*(UTA)]*[α<sup>2</sup>*( ε 0 2 )]*(A*A)*[(CCATAUUTU)] =</p><p>4*(64*64*64*64) = 16[2*194]*[α<sup>2</sup>*( ε 0 2 )]*[2*70]*[<xref ref-type="bibr" rid="scirp.130301-ref580">580</xref>]</p><p>67108864 = 6208*81200*[α<sup>2</sup>*( ε 0 2 )]</p><p>[α<sup>2</sup>*( ε 0 2 )] = 0.1331288406; ( ε 0 2 ) = “GTU” and “(78 + 66 + 64 = 208)” then,</p><p>0.1331288406 /208 = 0.0006400425,</p><p>α = 0.025 = 25/1000 = 5^2/10^3 = 1/40. (Even, just like the three dimension coordinate system’s origin begins at the origin of (0, 0, 0) even the start codon of genetic codes also begins encoding the amino acid with the start codon of “AUG” (Methionine; C<sub>5</sub>H<sub>11</sub>NO<sub>2</sub>S) [<xref ref-type="bibr" rid="scirp.130301-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.130301-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.130301-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.130301-ref26">26</xref>] . Also, while converting “Adenine (A)” nucleotide base with “Uracil (U).” in the Methionine’s nucleotide base sequence from “AUG” to “UAG” (Namely, meanwhile replacing/cycling from at the first one digit position “Adenine (A)” to the at the second position and for the “Uracil (U)” from at the second position of codon to the at the first digit position which becomes “UAG” (STOP codon) [<xref ref-type="bibr" rid="scirp.130301-ref23">23</xref>] .</p><p>The chemical formula of Methionine has twenty (20) atoms and total atomic mass of Methionine [(6*5 + 1*11 + 1*7 + 2*8 + 1*16 = 80; Remember the expression of fine structure constant number is even (1/40) with the dual numbers of “40” too (40*2 = 80); just like as in DUAL base pairs of nucleotide bases [(AU)/(CG)].</p><p>Thus, at three “3” dimension cartesian coordinate system (cubic shape at decimal number system which uses ten different notations that are the digits between zero (0) and nine (9) numbers just like as in three “3” power of ten “10”), the fine structure constant may be both α<sup>2</sup>*( ε 0 2 ) ≅ 1331/10^3 numeric value and also “(GTU) (U)” nucleotide base sequences too. Even while searching this sequence at NCBI Blast Database.</p><p>Vacuum permittivity, commonly denoted ε<sub>0</sub> is the value of the absolute dielectric permittivity of classical vacuum. It may also be referred to as the permittivity of free space, the electric constant, or the distributed capacitance of the vacuum.</p><p>ε<sub>0</sub> = 88541878176 &#215; 10<sup>−13</sup> F∙m<sup>−1</sup> (farads per meter),</p><p>ε 0 2 = 783949789370304 &#215; 10<sup>−26</sup> F∙m<sup>−1 </sup></p><p>After converting “( ε 0 2 ) = 783949789370304 &#215; 10<sup>−52</sup> F∙m<sup>−1</sup>”; 78 39 49 78 93 70 30 4 &#215; 10<sup>−52</sup> F∙m<sup>−1</sup>”<sup> </sup></p><p>( ε 0 2 ) = 101(5); 1001000(72); 1(1) = 5 + 72 + 1 = 78; Guanine (G);</p><p>1(1); 111111(63); 1(1); 1(1) = 1 + 63 + 1 + 1 = 66; Thymine (T);</p><p>1000(8); 1000(8); 101(5); (1011)(11); (1100)(12); (101)(5); (1111)(15) = 8 + 8 + 5 + 11 + 12 + 5 + 15 = 64;</p><p>Uracil (U). In sum, the expression of the electric constant can be defined as “GTU”</p><p>( ε 0 2 ) = (5 + 72 + 1 = 78); (1 + 63 + 1 + 1 = 66); (8 + 8 + 5 + 11 + 12 + 5 + 15 = 64) = “GTU” [Guanine (G), Thymine (T), Uracil (U)]</p><p>Furthermore, while calculating “the equation of Quantum Field Theory” instead of the “Reduced” Planck constant = (h/2*pi) = “1/136”) value is very nearly to the fine structure constant number of “1/137” too. So the expression of “Reduced Planck constant” may be also almost as the same as the fine structure constant number Namely “Reduced Planck constant” may be the same value’s as the fine structure constant value with the lacking of “1 (one) hydrogen atom = 1” (137 − 1 = 136!!!).<sup> </sup></p></sec><sec id="s4"><title>4. Results</title><p>Before this study; Kevser K&#246;kl&#252; has published articles on the Quantum Perspective Model, not only about the square of the speed of light [<xref ref-type="bibr" rid="scirp.130301-ref3">3</xref>] , but also about the nucleotide-based Pi numbers [<xref ref-type="bibr" rid="scirp.130301-ref2">2</xref>] . In addition to these; Pi numbers once again extended version [<xref ref-type="bibr" rid="scirp.130301-ref4">4</xref>] , golden ratio numbers [<xref ref-type="bibr" rid="scirp.130301-ref6">6</xref>] , Euler numbers [<xref ref-type="bibr" rid="scirp.130301-ref5">5</xref>] , square root of two [<xref ref-type="bibr" rid="scirp.130301-ref7">7</xref>] , square root of three [<xref ref-type="bibr" rid="scirp.130301-ref8">8</xref>] , square root of five [<xref ref-type="bibr" rid="scirp.130301-ref9">9</xref>] , square root of seven [<xref ref-type="bibr" rid="scirp.130301-ref10">10</xref>] , square root of ten [<xref ref-type="bibr" rid="scirp.130301-ref11">11</xref>] and Fibonacci numbers [<xref ref-type="bibr" rid="scirp.130301-ref12">12</xref>] were also published by Tahir &#214;LMEZ [<xref ref-type="bibr" rid="scirp.130301-ref23">23</xref>] . Even the Euler Identity [<xref ref-type="bibr" rid="scirp.130301-ref13">13</xref>] and the extended golden ratio numbers [<xref ref-type="bibr" rid="scirp.130301-ref14">14</xref>] and imaginary numbers [<xref ref-type="bibr" rid="scirp.130301-ref15">15</xref>] were also calculated. In summary, the codes of all these irrational numbers explained by a genetic sequence (mentioned above) can be found in this diagram. (Please, See <xref ref-type="table" rid="table1"><xref ref-type="table" rid="table">Table </xref>1</xref>).</p><p>According to Quantum Perspective Model, prior to this article, the relationship between the square of the speed of light (c&#178;) [<xref ref-type="bibr" rid="scirp.130301-ref3">3</xref>] by K. K&#246;kl&#252; and Planck’s constant numbers [<xref ref-type="bibr" rid="scirp.130301-ref16">16</xref>] , Avogardo’s Number [<xref ref-type="bibr" rid="scirp.130301-ref18">18</xref>] , the atomic weight of proton [<xref ref-type="bibr" rid="scirp.130301-ref18">18</xref>] , the atomic weight of electron [<xref ref-type="bibr" rid="scirp.130301-ref18">18</xref>] , the atomic weight of neutron [<xref ref-type="bibr" rid="scirp.130301-ref18">18</xref>] , the Boltzmann constant [<xref ref-type="bibr" rid="scirp.130301-ref19">19</xref>] The Bohr magneton constant [<xref ref-type="bibr" rid="scirp.130301-ref19">19</xref>] genetic codes were studied by T. &#214;lmez [<xref ref-type="bibr" rid="scirp.130301-ref23">23</xref>] . (Please, See <xref ref-type="table" rid="table3"><xref ref-type="table" rid="table">Table </xref>3</xref>). At first, the calculation of the exact formula of (4πε<sub>0</sub>ħcα = e<sup>2</sup>) the electromagnetic field was written at below. Secondly, the variables of fine structure constant are squared twice (The fourth power is taken). Thirdly, this formula’s numbers are converted from decimal (10) number base system to binary number base system (2) Fourthly, this expression of fine structure constant numbers and other coefficients (π, ε<sub>0</sub>, ħ, c, α) were converted from binary number base system (2) to decimal (10) number base system repeatedly and sequencely. Fifthly, this reevaluated decimal numbers summed nucleotide bases one by one, respectively. Sixthly, the expression of the “e” electric constant numbers may equal to “GTU” [Guanine (G), Thymine (T), Uracil (U)]. Besides, as regards to Quantum Perspective Model, the expression of fine structure constant may be equaled to [URACIL (U)]. Even, the result of this general formula of the equation of Quantum Field Theory’s law; corresponds to “UTAUTAUGTUAACCATAUUTU” nucleotide bases. Thus, with the expression of the fine structure constant number as nucleotide bases, can be expressed as genetic codes [Adenine (A), Thymine (T), Guanine (G), Cytosine (C) and Uracil (U)] (Please, See <xref ref-type="table" rid="table2"><xref ref-type="table" rid="table">Table </xref>2</xref>). Seventhly, after searching for this sequence in the NCBI (National Center for Biotechnology Information) database, the NCBI search results were very similar to bony fish “Danio rerio” [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] /“Danio Kyathit” (Please, See <xref ref-type="table" rid="table4"><xref ref-type="table" rid="table">Table </xref>4</xref>) and (Please, See, Figures 1-5).</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1"><xref ref-type="table" rid="table">Table </xref>1</xref></label><caption><title> The summary of some irrational numbers and nucleotide bases</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Irrational Numbers</th><th align="center" valign="middle" >Nucleotide Bases</th></tr></thead><tr><td align="center" valign="middle" >2 [<xref ref-type="bibr" rid="scirp.130301-ref7">7</xref>]</td><td align="center" valign="middle" >GGATGTUTATTGAGTGAUAA</td></tr><tr><td align="center" valign="middle" >3 [<xref ref-type="bibr" rid="scirp.130301-ref8">8</xref>]</td><td align="center" valign="middle" >GGATGAUTAUGGGTTTAGAAA</td></tr><tr><td align="center" valign="middle" >5 [<xref ref-type="bibr" rid="scirp.130301-ref9">9</xref>]</td><td align="center" valign="middle" >ATTTATTUAATAUATAAUUUUATTGA</td></tr><tr><td align="center" valign="middle" >7 [<xref ref-type="bibr" rid="scirp.130301-ref10">10</xref>]</td><td align="center" valign="middle" >GATTCUUUACTAGAGTTACTAGTTTGATT</td></tr><tr><td align="center" valign="middle" >10 [<xref ref-type="bibr" rid="scirp.130301-ref11">11</xref>]</td><td align="center" valign="middle" >ATAAGTCATAAGTGTATTAGTTTAAAACTG</td></tr><tr><td align="center" valign="middle" >Pi Numbers (as a 22/7) [<xref ref-type="bibr" rid="scirp.130301-ref2">2</xref>]</td><td align="center" valign="middle" >CTA [Cytosine (C), Thymine (T), Adenine (A)]; (Instead of “U”; “C” is used owing to not only absence of “Uracil” in DNA, but also its specialties with the smallest nucleotide base among the others)</td></tr><tr><td align="center" valign="middle" >Pi Numbers (as an extended form) [<xref ref-type="bibr" rid="scirp.130301-ref4">4</xref>]</td><td align="center" valign="middle" >TUGATTATAUTGGTTGGTTGTTAAUGGTAU</td></tr><tr><td align="center" valign="middle" >Euler’s Identity [<xref ref-type="bibr" rid="scirp.130301-ref13">13</xref>]</td><td align="center" valign="middle" >AAAGGCUUGCCCAACAAGCCAAACCCAGGC</td></tr><tr><td align="center" valign="middle" >Euler’s Numbers [<xref ref-type="bibr" rid="scirp.130301-ref5">5</xref>]</td><td align="center" valign="middle" >ACGCCGACACTAACUATU</td></tr><tr><td align="center" valign="middle" >Golden Ratio Numbers (only “618”) [<xref ref-type="bibr" rid="scirp.130301-ref6">6</xref>]</td><td align="center" valign="middle" >CAAT Box “GGCCAATCT”; TATA Box “TATAAAA”</td></tr><tr><td align="center" valign="middle" >Golden Ratio Numbers (Extended form) [<xref ref-type="bibr" rid="scirp.130301-ref14">14</xref>]</td><td align="center" valign="middle" >ACATCC</td></tr><tr><td align="center" valign="middle" >The square of imaginary number “i2” [<xref ref-type="bibr" rid="scirp.130301-ref15">15</xref>]</td><td align="center" valign="middle" >“AATGGGCCCUUGAAGAACUUUAAGTTTGGG”.</td></tr></tbody></table></table-wrap><table-wrap id="table2" ><label><xref ref-type="table" rid="table2"><xref ref-type="table" rid="table">Table </xref>2</xref></label><caption><title> The representation of nucleotide bases (A, T, C, G and U) in chemical atoms</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >ATOMS/NUCLEOTIDE BASES</th><th align="center" valign="middle" >C = 6</th><th align="center" valign="middle" >H = 1</th><th align="center" valign="middle" >O = 8</th><th align="center" valign="middle" >N = 7</th><th align="center" valign="middle" >SUM</th></tr></thead><tr><td align="center" valign="middle" >ADENINE: C<sub>5</sub>H<sub>5</sub>N<sub>5</sub></td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >70</td></tr><tr><td align="center" valign="middle" >THYMINE: C<sub>5</sub>H<sub>6</sub>N<sub>2</sub>O<sub>2</sub></td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >66</td></tr><tr><td align="center" valign="middle" >CYTOSINE: C<sub>4</sub>H<sub>5</sub>N<sub>3</sub>O<sub>1</sub></td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >58</td></tr><tr><td align="center" valign="middle" >GUANINE: C<sub>5</sub>H<sub>5</sub>N<sub>5</sub>O<sub>1</sub></td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >78</td></tr><tr><td align="center" valign="middle" >URACIL : C<sub>5</sub>H<sub>4</sub>N<sub>2</sub>O<sub>2</sub></td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >64</td></tr></tbody></table></table-wrap><p>The fine structure constant numeric value (137 = 4^2 + 11^2) is approximately the ratio of one (1) and 137 (one hundred thirty seven) atoms that is nearly to the ratio of “(1/137)”. Moreover, Not only the number of Fine Structure Constant Number consists of the number of “137” but also the chemical molecular formula of “Chlorophyll” [(C<sub>55</sub>H<sub>72</sub>MgN<sub>4</sub>O<sub>5</sub>); [<xref ref-type="bibr" rid="scirp.130301-ref27">27</xref>] and its total elements are even “137” (55 + 72 + 1 + 4 + 5:137)]. Let alone; According to structure of DNA and its basic crucial role of DNA transcription/replication at the location of nucleus, mitochondria and CHLOROPLAST [<xref ref-type="bibr" rid="scirp.130301-ref28">28</xref>] (Even; The total the sum of atom numbers of Chlorophyll is “137” “C<sub>55</sub>H<sub>72</sub>Mg<sub>1</sub>N<sub>4</sub>O<sub>5</sub>” with 137 atoms as in Fine Structure Constant Numbers (1/137). Furthermore, DNA functions with the 5’ to 3’ REVERSE direction (Please, See, <xref ref-type="fig" rid="fig6">Figure 6</xref>). Let alone, just</p><p>like in DNA (REVERSE) direction via 5’ to 3’/RNA (FORWARD) direction via 3’ to 5’ during gene regulations; even while the reading of the number of fine structure constant number of “137” in forward direction and “731” in reverse direction and their total numeric sum can be a palindromic number (137 + 731 = 868) too. [Remember; the approximate existence of golden ratio numbers (55/33) and its origin of Pascal’s Binom Triangle [<xref ref-type="bibr" rid="scirp.130301-ref29">29</xref>] also stemmed from the palindromic number of “ELEVEN = 11” and its Powers to the infinity, too. Moreover, unchanged appearance of golden ratio number digits (55/34 = 1, “618”)</p><p>Furthermore, even when, the reoccurrence of golden ratio (55/34 = 1.618) number “55” (Let alone, while multiplying of both the number of “5” with “11” equals to “55”, too) [<xref ref-type="bibr" rid="scirp.130301-ref6">6</xref>] . At the Fibonacci sequence can be detected as “TEN</p><p>TIMES” by converting the Euler’s Numbers [<xref ref-type="bibr" rid="scirp.130301-ref5">5</xref>] to the binary base system [<xref ref-type="bibr" rid="scirp.130301-ref6">6</xref>] . As a result, the mathematical measurement units of digits as basic numbers are very likely to “quantum” particles of photons and “dots” as “ONE” digit! But the “particles of lights” as named as “photons” acts as both “particle” and “wave”. This DUAL phenomenon of photons (particle/wave) can be also seen at the imaginary numbers as seen its DUAL digits of (−1 and +1), too. Because, When you square it using the above rule of multiplication, you get (0, 1) (0, 1) = ((0)(0) − (1)(1), (0)(1) + (1)(0)) = (−1, 0) (THE RESULT IS MINUS ONE ‘−1’) [<xref ref-type="bibr" rid="scirp.130301-ref15">15</xref>] . This dual phenomenon infinite sum photon/electron particles and One (1) particle can be stemmed from both mathematical imaginary numeric digits [(maybe, it is as assumed as “the fifth dimension” as in TRIPLET digits of imaginary numbers; (−1, 0, 1) variables at imaginary coordinate system and “superposition” of photons /electrons as regards to “Quantum Physics”].</p></sec><sec id="s5"><title>5. Discussion</title><p>At first, the exact formula Quantum Field Theory [<xref ref-type="bibr" rid="scirp.130301-ref30">30</xref>] of (4πε<sub>0</sub>ħcα = e<sup>2</sup>) the electromagnetic field was written at below. It is the mathematical law of the phenomenon used in detecting errors and fraud in examining data obtained from nature or containing numbers such as accounting records. As an example: this law states: Separate and count the first digits of all values such as amount, money, size, length, air temperature in the pile of information containing numbers, wherever it is collected. The number of numbers starting with one (1) is 30.10 percent of the total number of numbers. The number of numbers starting with two (2) is 17.6 percent of the total number of numbers. The number of numbers starting with three (3) is 12.5 percent of the total number of numbers. In this decreasing ratio, the ratio of numbers up to 9 gives a total of 100%. Namely, every data set complies with these ratios, orders, planets, etc. that we do not know in nature. Benford’s Law [<xref ref-type="bibr" rid="scirp.130301-ref31">31</xref>] tends to be most accurate when values are distributed across multiple orders of magnitude, especially if the process generating the numbers is described by a power law Secondly, the variables of fine structure constant are squared twice (The fourth power is taken). Thirdly, this formula’s numbers are converted to binary number base system (2). Fourthly, the outcomes of these numbers are converted to binary base system to decimal number base system (10). Fifthly, the calculations of this formula’s coefficients expressed as nucleotide bases one by one. Besides, while calculating the fine structure constant number (α) at this exact formula “(4πε<sub>0</sub>ħcα = e<sup>2</sup>)” Sixthly, the expression of fine structure constant is equal to [URACIL (U)] and, the expression of electic constant “(ε0)” is equal to “GTU” [Guanine (G), Thymine (T), Uracil (U)]. (Please, See <xref ref-type="table" rid="table2"><xref ref-type="table" rid="table">Table </xref>2</xref>) [<xref ref-type="bibr" rid="scirp.130301-ref32">32</xref>] . Thus, these numbers can be expressed as genetic codes, too. [Adenine (A), Thymine (T), Guanine (G), Cytosine (C) and Uracil (U)] (Please, See <xref ref-type="table" rid="table2"><xref ref-type="table" rid="table">Table </xref>2</xref>). Seventhly, general formulas of the electromagnetic field can also be expressed as “UTAUTAUGTUAACCATAUUTU”. Eighthly, fine structure constant number can also be expressed as “Reduced Planck constant” [<xref ref-type="bibr" rid="scirp.130301-ref17">17</xref>] in shortly. (ħ ≈ α) with the “one (1) hydrogen lack of atom” less than the numerical value in denominator. Namely; Reduced Planck constant “ħ” equals to [(h/2*pi) = 1/136) and so, [1/2*(UTA) [<xref ref-type="bibr" rid="scirp.130301-ref2">2</xref>] .] with nucleotide bases or [1/(α − “1 = Hydrogen”)] with the ’one Hydrogen (1) exception in the denominator section’. (Let alone, The Fine structure constant numeric value is approximately the ratio of one (1) and 137 (one hundred thirty seven) that is nearly to the ratio of “(1/137)” After searching for these sequences in the NCBI (National Center for Biotechnology Information) database [<xref ref-type="bibr" rid="scirp.130301-ref25">25</xref>] , the NCBI search result was similar to bony fish “Danio rerio” [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] , /“Danio kyathit”. Even, let’s not forget that some irrational numbers (Please, See <xref ref-type="table" rid="table4"><xref ref-type="table" rid="table">Table </xref>4</xref>)/some Universal constants (Please, See <xref ref-type="table" rid="table3"><xref ref-type="table" rid="table">Table </xref>3</xref>) [in the gene database are very similar kind of bony fishes to Danio rerio and DANIO KYATHIT and “which are most significance excellent samples for genetic researchments. Besides, the other NCBI results are the ARGININE amino acid [<xref ref-type="bibr" rid="scirp.130301-ref33">33</xref>] for human being genetic sequence and Drosophila immigrants which can be very well excellent sample to understand the how viruses evolves with hosts. and Bombyx Mandarına” (Please, See <xref ref-type="fig" rid="fig2">Figure 2</xref>)]</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3"><xref ref-type="table" rid="table">Table </xref>3</xref></label><caption><title> The summary of some constant numbers and nucleotide bases</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  colspan="2"  >SOME CONSTANT NUMBERS</th><th align="center" valign="middle" >NUCLEOTIDE BASES</th></tr></thead><tr><td align="center" valign="middle"  colspan="2"  >The square of the speed of light (c&#178;) [<xref ref-type="bibr" rid="scirp.130301-ref3">3</xref>]</td><td align="center" valign="middle" >AUC or CCATAUUTU/CCACAUUTU</td></tr><tr><td align="center" valign="middle"  colspan="2"  >Planck’s constant numbers ‘h’ [<xref ref-type="bibr" rid="scirp.130301-ref16">16</xref>] Reduced Planck constant ‘ħ’ [<xref ref-type="bibr" rid="scirp.130301-ref17">17</xref>] ” [(h˚/2*pi) = 1/136”)</td><td align="center" valign="middle" >‘h’ = [{Adenine (A) or Thymine] (T); Owing to absence of Thymine (T)in RNA; Thus, ‘h’ = Adenine (A)} ‘ħ’ = 1/2*(UTA) OR {1/(137 − 1)} = [1/(α − “1 = Hydrogen”)]</td></tr><tr><td align="center" valign="middle"  colspan="2"  >Avogardo’s Numbers [<xref ref-type="bibr" rid="scirp.130301-ref18">18</xref>]</td><td align="center" valign="middle" >Uracil (U)</td></tr><tr><td align="center" valign="middle"  colspan="2"  >The atomic weight of proton [<xref ref-type="bibr" rid="scirp.130301-ref18">18</xref>]</td><td align="center" valign="middle" >Guanine (G)</td></tr><tr><td align="center" valign="middle"  colspan="2"  >The atomic weight of electron [<xref ref-type="bibr" rid="scirp.130301-ref18">18</xref>]</td><td align="center" valign="middle" >Uracil (U)</td></tr><tr><td align="center" valign="middle"  colspan="2"  >The atomic weight of neutron [<xref ref-type="bibr" rid="scirp.130301-ref18">18</xref>]</td><td align="center" valign="middle" >Adenine (A) or Thymine (T)</td></tr><tr><td align="center" valign="middle" >The Boltzmann constant [<xref ref-type="bibr" rid="scirp.130301-ref19">19</xref>]</td><td align="center" valign="middle"  colspan="2"  >Guanine (G)</td></tr><tr><td align="center" valign="middle" >The Bohr magneton constant [<xref ref-type="bibr" rid="scirp.130301-ref19">19</xref>]</td><td align="center" valign="middle"  colspan="2"  >Thymine (T)</td></tr><tr><td align="center" valign="middle" >The Faraday’s constant numbers [<xref ref-type="bibr" rid="scirp.130301-ref20">20</xref>]</td><td align="center" valign="middle"  colspan="2"  >Uracil (U) and Guanine (G) “UG” OR Adenine (A) and Guanine (G) “AG”</td></tr><tr><td align="center" valign="middle" >The square number of electric constant [<xref ref-type="bibr" rid="scirp.130301-ref21">21</xref>]</td><td align="center" valign="middle"  colspan="2"  >“GTU” [Guanine (G); Thymine (T); and Uracil (U)]</td></tr><tr><td align="center" valign="middle" >The Fine Structure Constant Number [<xref ref-type="bibr" rid="scirp.130301-ref1">1</xref>] The square number of fine structure constant ‘α2’</td><td align="center" valign="middle"  colspan="2"  >“1/(Adenine (A) and Thymine (T) − 1);” = 1/AT − 1 [the square number of fine structure constant “α2” equals to “T or U” but mostly as to numeric calculations because of NOT “existence of “Thymine (T)” in DNA, then it may be only be existed with “Uracil (U)” in DNA]”. Thus, “α2” = “Uracil (U)” at all. Namely, Uracil (U) may be twin cubics with the edge of with the numeric value of “two” number [(2^3)^2]!!!</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><p>and “human genom of ARGININE” and other some creatures. Lastly, Bombyx Mandarina (females) and Bombyx Mori (males) [<xref ref-type="bibr" rid="scirp.130301-ref33">33</xref>] are very closed relative of silkworms as regards to origin of silk moths were very enigmatic as related to while B. Mandarina can not fly but B. Mori can fly. Finally, B. Mandarina is able to hybridize with B. Mori and releases pheromones and wait for the hybridization to breed and mate which can be very vital role in the evolution of coral species for non-vailibility genes of pre or post selection for fertility reproduction isolation and fertilization mechanisms. Let alone, biologists identified very few genes that causes reproductive isolation(speciation genes)if this genes detected at the level of DNA sequences, it may be possible to bring a powerful set of molecular population genetic toos to reach the origin of species just like as researched in both Drosophila melanogaster and D. simulans in search for hybrid inviabity “OdsH and Hmr” genes which plays a vital role in transcriptional region that related to x chromosome of its much more faster evolution of hybrid male sterility during meiotic drive theory of postzygotic isolation in molecular evolutions [<xref ref-type="bibr" rid="scirp.130301-ref34">34</xref>] .</p><p>Let alone, on the condition of expressing the Euler’s numbers [<xref ref-type="bibr" rid="scirp.130301-ref5">5</xref>] . Phi numbers/Pi numbers as genetic codes [Adenine (A), Thymine (T), Guanine (G), Cytosine (C) and Uracil (U)] as a infinite sequences of nucleotide bases which have deep association with the especially Bony fishes of Danio rerio (Zebra fish) [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] . And Danio Kyathit an even with associated Bat Coronavirus (Please, See <xref ref-type="table" rid="table4"><xref ref-type="table" rid="table">Table </xref>4</xref>). Gene sequences (Just like, as seen in specifically in Euler’s Numbers) [<xref ref-type="bibr" rid="scirp.130301-ref5">5</xref>] . [(By the way, at first, as to the first fifteen digit of numbers sequence were lined up in respectively. Secondly, as regards to “Quantum Perspective Model” to “the first fifteen digits of Euler’s numbers start with the magic number of “SEVEN-7” with paved the corner milestone to the some of infinite summed numbers mentioned at past. (At first glance, Maybe, it appears to be approximately not exact value of Pi numbers due to Curved ?Space Time dimension coordinate systems of Universe but in fact, it can be very nearly to the ratio of “22/7 with” infinite Cyclic and palindromic unchanged infinite Numbers of “142857”, too) like as i the approximately serration of “718281828459045” were substracted with the ten power of fourteen (10*<sup>14</sup>) can be also resulted in the unchanged TRIPLET (As in triplet codons of genetic codes) numbers of Golden Ratio numbers of “618”, too (618281828459045). (Remember, the acid base ratio scale in Chemistry also even between the interval of Zero (0) and fourteen (14) too. Let alone, while expressing the approximate number of Pi [<xref ref-type="bibr" rid="scirp.130301-ref2">2</xref>] . (With the ratio of 22/7 = 3.1428571… with infinite Cyclic and palindromic unchanged infinite Numbers of “142857” were calculated by each fourteen digits of numbers after comma, too. As a result of the equilibrium of Universe-Matter-Numbers as related to the ratio of the number of “618” and “14” even resulted in infinite Cyclic and palindromic unchanged Numbers of “142857 to forever”, repeatedly again and again, at all (618/14 = 44.142857] [<xref ref-type="bibr" rid="scirp.130301-ref6">6</xref>] . Finally, while searching this gene sequence in NCBI databases, One of the results of this NCBI consequence is “Danio rerio” [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] which can be an excellent vertebrate organism in scientific researches of gene sequences and Biomedicine, medical researches, Neurosciences and drug developments.</p><p>This novel scientific research interpretation and analysis of genetic research method/tool methodologies discoveries in Molecular Biology, Biochemistry, Genetics and genomics and etc… to investigate to understand infinite fractions of this widespread “CORONA VIRUS/COVİD-19” [<xref ref-type="bibr" rid="scirp.130301-ref26">26</xref>] . Like epidemic health issues and their reflection on other scientific developments/discoveries in “Philosophy of Sciences” only concept of The Chaos Theory as in respect Quantum Perspective Model fractals previously researched in expressing of Pi numbers as genetic codes [<xref ref-type="bibr" rid="scirp.130301-ref2">2</xref>] , chemical formulas, nucleotide bases, elements and their chemical bonds of elements. Besides, this novel perspective to may sciences can shed lights to dark sides of undiscovered Iceberg’s of many scientific phenomenon events/paradigmas as related to Butterfly Effect’s as in Cause-Affect of “quantum participles” (just like as in digits of numbers, atoms, electrons, chemical elements, genetic codes, chemical formulas, nucleotide bases and… etc.</p><table-wrap id="table4" ><label><xref ref-type="table" rid="table4"><xref ref-type="table" rid="table">Table </xref>4</xref></label><caption><title> The NCBI (National Biotechnology Information Center) [<xref ref-type="bibr" rid="scirp.130301-ref25">25</xref>] summary and genetic sequences of some irrational numbers</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Numbers (Irrational, complex)</th><th align="center" valign="middle" >NCBI Results</th></tr></thead><tr><td align="center" valign="middle" >i (imaginary number) [<xref ref-type="bibr" rid="scirp.130301-ref15">15</xref>]</td><td align="center" valign="middle" >Danio rerio (Zebra fish) [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] , Danio aesculapii, Bony fish</td></tr><tr><td align="center" valign="middle" >2 [<xref ref-type="bibr" rid="scirp.130301-ref7">7</xref>]</td><td align="center" valign="middle" >Danio rerio [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] , Timema, Bony fish</td></tr><tr><td align="center" valign="middle" >3 [<xref ref-type="bibr" rid="scirp.130301-ref8">8</xref>]</td><td align="center" valign="middle" >Denticle Herring, Bony fish, Bats</td></tr><tr><td align="center" valign="middle" >5 [<xref ref-type="bibr" rid="scirp.130301-ref9">9</xref>]</td><td align="center" valign="middle" >Danio rerio (Zebra fish) [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] , Bony fish</td></tr><tr><td align="center" valign="middle" >7 [<xref ref-type="bibr" rid="scirp.130301-ref10">10</xref>]</td><td align="center" valign="middle" >Danio rerio [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] , Danio aesculapii, Bony fish</td></tr><tr><td align="center" valign="middle" >10 [<xref ref-type="bibr" rid="scirp.130301-ref11">11</xref>]</td><td align="center" valign="middle" >Danio kyathit, Danio aesculapii, Bony fish</td></tr><tr><td align="center" valign="middle" >Pi Numbers (as a 22/7) [<xref ref-type="bibr" rid="scirp.130301-ref2">2</xref>]</td><td align="center" valign="middle" >Danio rerio (Zebra fish) [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] , Bony fish</td></tr><tr><td align="center" valign="middle" >Pi Numbers (as an extended form) [<xref ref-type="bibr" rid="scirp.130301-ref4">4</xref>]</td><td align="center" valign="middle" >Danio rerio (Zebra fish) [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] , Bony fish, Timema, Danio kyathit</td></tr><tr><td align="center" valign="middle" >Euler’s Identity [<xref ref-type="bibr" rid="scirp.130301-ref13">13</xref>]</td><td align="center" valign="middle" >Danio kyathit, Danio rerio (Zebra fish) [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] , Bony fish, Timema</td></tr><tr><td align="center" valign="middle" >Euler’s Numbers [<xref ref-type="bibr" rid="scirp.130301-ref5">5</xref>]</td><td align="center" valign="middle" >Danio rerio (Zebra fish [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] ), Bony fish, bat coronavirus [<xref ref-type="bibr" rid="scirp.130301-ref26">26</xref>]</td></tr><tr><td align="center" valign="middle" >Golden Ratio Numbers [<xref ref-type="bibr" rid="scirp.130301-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.130301-ref14">14</xref>]</td><td align="center" valign="middle" >Bony fishes (Symphodus melops, Xyrauchen texanus)</td></tr></tbody></table></table-wrap><p>Finally, these mixed research methods, where both inductive and deductive methods are used together, can open many closed doors of these undiscovered infinite or near-infinite events, just like the constantly increasing and multiplying unknown events in irrational numbers. After a transition to Newton’s laws to Einstein’s General ve Special Relativity Theory, many current sciences are evaluated to reassess their fundamentals according to the development of Quantum Physics and Artificial Intelligence. This new developing sciences are sheds lights on Heisenberg’s Uncertainty Principal and Machine Learning systems. So, the previous admitted postulates of sciences can be invalid in the future Sciences. Thus the searching of novel variables and theorems leads to interrelationship of Sciences.</p></sec><sec id="s6"><title>6. Conclusion</title><p>This paper tries to shed lights on the relationships between some constant numbers (Please, See <xref ref-type="table" rid="table3"><xref ref-type="table" rid="table">Table </xref>3</xref>) just like as the fine structure constant number and nucleotide bases[Adenine (A), Thymine (T) Guanine (G), Cytosine (C) and Uracil (U)]. According to Quantum Perspective Model, the chemical formulas of nucleotide bases [Adenine (A), Thymine (T) Guanine (G), Cytosine (C) and Uracil (U)] consist of Carbon (C), Nitrogen (N), Oxygen (O) and Hydrogen (H) [<xref ref-type="bibr" rid="scirp.130301-ref1">1</xref>] . This sparkling and surprising relations are with the numbers of Mathematics (Especially in the core of Fibonacci Sequence and The Pascal’s Binom Triangle’s (Please, See <xref ref-type="fig" rid="fig7">Figure 7</xref>) with the power of number ELEVENS (11’s) mentioned</p><p>and even other some irrational numbers as mentioned in previous articles as to Euler’s [<xref ref-type="bibr" rid="scirp.130301-ref5">5</xref>] . /Phi/Pi numbers and 2 , 3 , 5 , 7 , 10 and imaginary numbers and Euler’s Identity and the square of the speed of light numbers, and …etc and theirs reflections in Biology [(as seen in Bony Fishes (especially Danio rerio [<xref ref-type="bibr" rid="scirp.130301-ref24">24</xref>] , and Danio aesculapii in NCBI (Please, See <xref ref-type="table" rid="table1"><xref ref-type="table" rid="table">Table </xref>1</xref>, <xref ref-type="table" rid="table3"><xref ref-type="table" rid="table">Table </xref>3</xref> and <xref ref-type="table" rid="table4"><xref ref-type="table" rid="table">Table </xref>4</xref>) [<xref ref-type="bibr" rid="scirp.130301-ref25">25</xref>] as regarded to sequences of nucleotide bases (A, T, C, G and U). For example, the square root of negative numbers as seen in to the square root of minus one [ − 1 ); (imaginary unit)] equals to “AATGGGCCCUUGAAGAACUUUAAGTTTGGG”. Also, these were very associated with each others in Physics with the square of velocity of light numbers [<xref ref-type="bibr" rid="scirp.130301-ref3">3</xref>] . And some unchanged Universal Constant Numbers as researched previously (For instance, Planck’s constant numbers, the atomic weight of electron, proton and so on…), besides, in Biochemistry with the chemical element’s specialties at the Periodic table as regarded to their total atomic numeric of masses and their usage in chemical formula of nucleotide bases (especially with C, H, O, N and P) and their molecular structure of various compounds in genetic researches. Moreover, these surprising relationships between some (ir)/rational numbers and some constant numbers are seen in the “Butterfly Effect” in Chaos Theory; as in, it can lead to a “turning spotlight shining” on scientific research of epidemic health diseases (such as Covid-19; and so on…). (As mentioned with Cyclic numbers “428571” in approximate Pi numbers (22/7 = 3.‘142857’ with infinite UTA’s by K. K&#246;kl&#252;) [<xref ref-type="bibr" rid="scirp.130301-ref2">2</xref>] .</p><p>This article tries to reevaluate the best well-known dogma steps of “ad-hocs” “staircase” scientific research methodologies for the time of being now. As until now, although undefined meanings of so many some irrational numbers that located at three dimension Cartesian coordinate system at past and even moreover, the ambiguousness of dimensionless constant of the fine structure constant numbers cant being able to be understood. In order to thaw this “deep dark side of iceberg” of irrational mathematical numbers and the number of fine structure constant number (137) seemed to be appearing just a “sequence” only digit of numbers; but in reality they take their “values” not just the visible to outside appearing of their meanings with infinite sole digits; but also, these numbers are not only one values as related to only one sole scientific discipline but also, most of them very deep associated and integrated and even conjugated meanings with each others. Maybe, they can be resembled to infinite stars of Cosmos which can able to give the basic elements of life just like as in the appearance of many basic elements (C, H, O, N and P, ...and etc) at the blast of stars just like as in the some infinite irrational numbers. Namely, all the Stars give the necessities of life forms with the cost of their “deaths (blasts)” without any exception almost nearly to infinite values of digits! [<xref ref-type="bibr" rid="scirp.130301-ref35">35</xref>] . Within this novel “Quantum Perspective Model” to define the coefficients and variables of the fine structure constant numbers (Please, See <xref ref-type="table" rid="table1"><xref ref-type="table" rid="table">Table </xref>1</xref> and <xref ref-type="table" rid="table4"><xref ref-type="table" rid="table">Table </xref>4</xref>) may not be related to three dimensional Curved Space Time Cosmos! But, In contrast to previous observation and paradigms and postulates with the “Observation Errors” that the meaning of this “dimensionless fine structure constant numbers” can only be valid in the infinite space cluster which have infinite unit elements to utilize as an “measurement unit” but NOT like in number set elements in finite numbers!). Namely, In order to reach either infinite digits of numbers (just like as in π, e, Φ, 2 , 3 , 5 , 7 , 10 … etc.) or dimensionless fine structure constant number [<xref ref-type="bibr" rid="scirp.130301-ref1">1</xref>] “α” needs to be dimensionless “measurement units” as in the genetic codes and even with its molecular structures and their total chemical atomic elements’ numbers as in usage reoccurrences at the Periodic <xref ref-type="table" rid="table">Table </xref>and with this similar specialties with the some irrational numbers at the Pascal’s Binom Triangle (Please, See <xref ref-type="fig" rid="fig8">Figure 8</xref>) [with TRIPLET CORNERS (3) [as consisted with the infinite power of ELEVEN (11) digits, forever]. Besides the common feature of these genetic codes with triplet nucleotide bases specialties and some of the irrational numbers can take on values in a various infinite number of ways. Moreover, the other feature of this TWIN VARIABLES (genetic codes and fine structure constant numbers are at the dimensionless infinite coordinate system whether one of them is at the decimal number base system with ten digits and the other one is at ternary base system with same three basic nucleotide bases and with [(C, G, A, (“T” in DNA) or (“U” in RNA)]. Let alone the other infinite light numbers can also TRIPLET (3) colors with “Red Green Blue (3)” just like as in the TRIPLET nucleotide base pairs. Furthermore, Not only numbers are categorized as TWIN (2; odd or even) digits but also unlikely to genetic codes are categorized as one (1) single stranded with RNA but also likely to twin stranded double helixes, with DUAL base pairs of DNA (AU; GC). Similarly, the common feature of fine structure constant number “137” has also TRIPLET digits of (1, 3, 7), too. Even, the approximate value of Pi numbers as (22/7 = 3.1428571… with starting the number of “3” infinite “428571” numbers and twin couples of “428 + 571 = 999 very closed to the three power of ten number “999” = “(10^3-1)” and its expression of twin couples of “428 and 571” as infinite “UTA’s with triplet (3) nucleotide bases. Thus, the existence of Pascal’s Binom Triangle (Remember, it includes the powers number of ELEVEN “11”) also originated from the Fibonacci Sequence Numbers, too.</p><p>[Even, it iniatates and consists of DUAL ONE’S (1, 1)] to the infinity sequences (Just like as in infinite TRIPLET nucleotide bases of genetic codes). Besides, Meanwhile the observing of light with naked eyes without any measurement units or observation vehicles, it may seems to have an ONLY ONE (1) color of white, But in reality, unlikely to this event occasion of “-de facto-” “observation ERROR” of research phenomenon as to the first observation appearances. The only realism of this case, but not truth in time intervals, may not depends on just with the current methots and perspective of observators but also it depends on with different multi dimensional aspects of research methots! That may be the case of Philosophy of Science Paradoxes. Because, the truth about the phenomenon of dispersion may vary on many various parametres like as in the either the length of waves and density of its medium/circumstances… etc. What if, even “the uncertainty of how many colors does light consists” may vary on the interval of measurement units at the macro/micro level multi dimensions even at the dimensionless of observator’s point! (As an instance, Just like as in the number of one (1) with white color and as in the number of zero (0) with the black/DARK’ color. Even either with the number of three (3) within―TRIPLET “3”―“Red and Green and Blue colors” or with the number of seven (7) within the colors of rainbows? Perhaps, the mystery of what can be the color of existence/absence may be depends on not within the cycling/changing space time curvative Universe, but may be also depends on within the “DUALITY” Principal Of Quantum Mechanism which may even leads the validity of dimensionless number of fine structure constant numbers. In RNA with 3’ to 5’ forward direction of transcription on the phosphate backbone of temporary knowledge/DATA/information memory within the sequence of one (1) single stranded string of which consisting five nucleotide bases. As to DNA with 5’ to 3’ reverse direction of translation on the phosphate backbone of infinite unchanged knowledge/DATA/information memory within double stranded strings of five nucleotide bases, at micro quantum level systems. But unfortunately, while comparing the DUAL parameters of Time and Stars system may lead a paradox at the Space time curved spiral like Universe seemed to be rotate/cycle in the counter-clockwise direction exception of clockwise direction of time with the point of obervator’s perspectives. That’s way, perhaps, this controversial direction phenomenon itself of time and galaxy systems and Cosmos may be leads to “observatory’s ERRORS” depends on dilemma of time directions-as Einstein even declared. Moreover, even it can be also be controversial phenomenon about whether on which step/(s) of staircase- at the Double (DNA)/single (RNA) stranded- of DATA are being recorded by OBSERVATOR’s are still unknown paradox. Namely, this phenomenon can be reevaluated/summarized by just asking questions about “The development of philosophy many sciences” from the past to till now and to the future? (just like as in the observator’s multi-dimensional coordinates of at the time of being viewed the Cosmos either which directional and dimensional direction with 5’ to 3’ direction and vice versa- and even whether at which direction(s) and angle(s) of the Observator’s views the cloudy of DATA was still an undiscoverable paradox like an “questioning about” whether “Does the chicken come from the egg OR Does the egg come from the chicken? Though, this uncertainty” of “de facto” paradoxes with the infinite/affinity to infinite articles/waves/parameters/paradigms and formulas may not absolute enough for “persona non gratas”. Namely, this “Quantum Perspective Model” may be a “breakthrough” to the interrelationships of the Sciences. As a last word to an infinity, The fine structure constant may be either not related with the dimension numbers as a “measurement unit” for the ruler’s “observation ERROR” and “ZERO ERROR” [<xref ref-type="bibr" rid="scirp.130301-ref36">36</xref>] , or any either parameters may be related to finite measurement tools for repeated research methodologies with observatory’s ERRORS for previous centuries. That’s to say, It can be only possible to evaluate the fine structure constant value with the affinity to infinite set of variables not from the “ad hoc’s” but with “ceteris paribus” (even itself) before and after a thunder lightning ruler observation “time interval to infinite endless doorway parameters”-without the exception of dogma “ad hoc’s” with a cloudy phenomenon perspective eyeglasses to many familiar parameters especially for Carbon based organisms! In conclusion, With respect to “Quantum Perspective Model” inferences may shed lights on new paradigms and perspectives to desperate scientific phenomena’s just like as in the expression of fine structure constant numbers for undiscovered mysteries of sciences!</p></sec><sec id="s7"><title>Acknowledgments</title><p>The author would like to express sincere gratitude to my best friend M. Ali SONOK for his valuable comments and unwavering support. Special thanks are also extended to my exceptional boss İsa DİRLİK and the other contributors. Among them, I would like to acknowledge the immense contribution of my son Kadir &#214;LMEZ and the unconditional love and support from my mother Hafize &#214;LMEZ. Additionally, I would like to extend my heartfelt appreciation to the “GURU” of the “QUANTUM PERSPECTIVE MODEL THEORY,” Dr. KEVSER K&#214;KL&#220;, who has been my best teacher. Lastly, I express my gratitude to my beloved son’s mother, Esra YILMAZ (Tahir Esra Kadir).</p></sec><sec id="s8"><title>Conflicts of Interest</title><p>The author declares no conflicts of interest.</p></sec><sec id="s9"><title>Cite this paper</title><p>&#214;lmez, T. (2023) A Breakthrough to the Meaning of the Fine Structure Numbers with Nucleotide Bases as Regards to Quantum Perspective Model? Open Access Library Journal, 10: e11005. https://doi.org/10.4236/oalib.1111005</p></sec></body><back><ref-list><title>References</title><ref id="scirp.130301-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">https://en.wikipedia.org/wiki/Finestructure_constant</mixed-citation></ref><ref id="scirp.130301-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">K&amp;ouml;klü, K. (2019) A Quantum Perspective Model to Genetic Codes through Various Sciences. Neuroquantology, 17, 15-18. https://doi.org/10.14704/nq.2019.17.3.1974 
https://en.wikipedia.org/wiki/Fine-structure_constant</mixed-citation></ref><ref id="scirp.130301-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">K&amp;ouml;klü, K. (2019) Is Relativity Theory Also Valid in Biogenetics and Mathematics? NeuroQuantology, 17, 53-58. https://doi.org/10.14704/nq.2019.17.3.1999</mixed-citation></ref><ref id="scirp.130301-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2021) According to Quantum Perspective Model, Are the Numbers of Pi Also Meaningful in Biochemistry? International Journal of Natural Sciences: Current and Future Research Trends (IJNSCFRT), 11, 1-10. 
https://www.researchgate.net/publication/355038899_According_to_Quantum_Perspective_Model_are_the_Numbers_of_Pi_Also_Meaningful_in_Biochemistry</mixed-citation></ref><ref id="scirp.130301-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2020) With Respect to Quantum Perspective Model, Can Euler Numbers Be Related to Biochemistry? Global Journal of Science Frontier Research, 20, 7-14.  
https://doi.org/10.34257/GJSFRFVOL20IS9PG7</mixed-citation></ref><ref id="scirp.130301-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2020) Is There an Aesthetics in Golden Ratio as Regards to the Common Cis-Regulatory Elements versus to Atomic Numbers of Elements with Respect to Quantum Perspective Model? Neurology and Neuroscience Reports, 3, 1-4.  
https://doi.org/10.15761/NNR.1000119</mixed-citation></ref><ref id="scirp.130301-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2021) According to the Binary Number Base System, Are the Square Roots of Two Numbers Also Significant in Biochemistry? Open Access Library Journal, 8, e7122. https://doi.org/10.4236/oalib.1107122</mixed-citation></ref><ref id="scirp.130301-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2021) What Is the Meaning of the Square Root of the Number Three in Biochemistry? Open Access Library Journal, 8, e7123.  
https://doi.org/10.4236/oalib.1107123</mixed-citation></ref><ref id="scirp.130301-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2021) Can Irrational Numbers (Such as Square Root of the Number Five) Be Reached by Analysis of Genetic Sequences? Open Access Library Journal, 8, e7104.</mixed-citation></ref><ref id="scirp.130301-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2022) Are Irrational Numbers (Like the Square Root of the Number Seven) Applicable to Genetic Sequences? Open Access Library Journal, 9, e8513.</mixed-citation></ref><ref id="scirp.130301-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2022) Can the Irrationality in Mathematics Be Explained by Genetic Codes Expressed in the Square Root of the Number Ten? In: Novel Research Aspects in Mathematical and Computer Science, Vol. 4, BP International Press, London, 17-25. https://doi.org/10.9734/bpi/nramcs/v4/2120B</mixed-citation></ref><ref id="scirp.130301-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2021) Is There a Similarity between Fibonacci Sequence and Euler’s Number with Respect to Quantum Perspective Model? Global Journal of Science Frontier Research, 20, 33. https://doi.org/10.34257/GJSFRFVOL20IS9PG35</mixed-citation></ref><ref id="scirp.130301-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2021) According to Quantum Perspective Model, Is Euler’s Identity Also Meaningful in Biochemistry? International Journal of Natural Sciences: Current and Future Research Trends, 9, 23-28. 
https://ijnscfrtjournal.isrra.org/index.php/Natural_Sciences_Journal/article/view/1037</mixed-citation></ref><ref id="scirp.130301-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2023) Can the Golden Ratio Numbers in Biochemistry and Mathematics Have a Common Explanation with Nucleotide Bases? Open Access Library Journal, 10, e9716. https://doi.org/10.4236/oalib.1109716</mixed-citation></ref><ref id="scirp.130301-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2023) What Is the Meaning of Imaginery Number with Nucleotide Bases as Regards to Quantum Perspective Model?  
https://www.amazon.com.tr/Quantum-Perspective-Model-Relationship-Between/dp/6203581801</mixed-citation></ref><ref id="scirp.130301-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2022) Is There Any Meaning of Planck’s Constant Numbers as Regards to Quantum Superposition via the Chemical Atomic Masses of Nucleotide Bases? Open Access Library Journal, 9, e9482. https://doi.org/10.4236/oalib.1109482</mixed-citation></ref><ref id="scirp.130301-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Reduced Planck Constant Numbers. https://www.wikidata.org/wiki/Q2115969</mixed-citation></ref><ref id="scirp.130301-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2022) Is There Any Explanation for the Chemical Atomic Weights of Protons, Neutrons and Electrons through the Genetic Codes Attributed to Quantum Superposition? Open Access Library Journal, 9, e9650.</mixed-citation></ref><ref id="scirp.130301-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2023) Can the Boltzmann and Bohr Magneton Constants Be Expressed as Nucleotide Bases via Quantum Superposition? Open Access Library Journal, 10, e9653. https://doi.org/10.4236/oalib.1109653</mixed-citation></ref><ref id="scirp.130301-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;lmez, T. (2023) What Is the Relationship between the Faraday’s Constant Numbers and Silk Worms as Regards to Quantum Perspective Model? Open Access Library Journal, 10, e732. https://doi.org/10.4236/oalib.1109732</mixed-citation></ref><ref id="scirp.130301-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Electric Constant Number. https://en.wikipedia.org/wiki/Vacuum_permittivity</mixed-citation></ref><ref id="scirp.130301-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Methionine. https://en.wikipedia.org/wiki/Methionine</mixed-citation></ref><ref id="scirp.130301-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Stop Codons. https://en.wikipedia.org/wiki/Stop_codon</mixed-citation></ref><ref id="scirp.130301-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Danio rerio (Zebra Fish). https://en.wikipedia.org/wiki/Zebrafish</mixed-citation></ref><ref id="scirp.130301-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Basic Local Alignment Search Tool. https://blast.ncbi.nlm.nih.gov/Blast.cgi</mixed-citation></ref><ref id="scirp.130301-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Corona Virus. https://en.wikipedia.org/wiki/Coronavirus</mixed-citation></ref><ref id="scirp.130301-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Chlorophyll. https://en.wikipedia.org/wiki/Chlorophyll</mixed-citation></ref><ref id="scirp.130301-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Choloroplast. https://en.wikipedia.org/wiki/Chloroplast</mixed-citation></ref><ref id="scirp.130301-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Pascal’s Binom Triangle.  
https://en.wikipedia.org/w/index.php?search=pascal+binom+triangle&amp;title=Special%3ASearch&amp;ns0=1</mixed-citation></ref><ref id="scirp.130301-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Quantum Physics. https://en.wikipedia.org/wiki/Quantum_mechanics</mixed-citation></ref><ref id="scirp.130301-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Benford’s Law. https://en.wikipedia.org/wiki/Benford%27s_law</mixed-citation></ref><ref id="scirp.130301-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Lodish, H., Berk, A., Zipursky, S.L., Matsudaira, P., Baltimore, D. and Darnell, J. (2018) Molecular Cell Biology. 6th Edition, Translation: Ge?kil, H., &amp;Ouml;zmen, M., Yesilada, &amp;Ouml;., Palme Publishing, New York, 294-302. </mixed-citation></ref><ref id="scirp.130301-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Arginine. https://en.wikipedia.org/wiki/Arginine</mixed-citation></ref><ref id="scirp.130301-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Drosophila Melanogaster Reproductive Isolation during Meiotic Drive Theory of Postzygotic Isolation in Molecular Evolution.</mixed-citation></ref><ref id="scirp.130301-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Gedzelman, S.D. (2013) Calculus: Your Royal Road to Genius. Stanley David Gedzelman Books, New York, 107-118.</mixed-citation></ref><ref id="scirp.130301-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">ZeroError. https://www.google.com/search?q=zero+paradox%2C&amp;client=opera-gx&amp;hs=is4&amp;sca_esv=586607062&amp;sxsrf=AM9HkKkE3MPWWH31Ra8MbR16x5CzuTm4SA%3A1701346183935&amp;ei=h3toZZbaONzjxc8P4tu1mAI&amp;ved=0ahUKEwjWubu32OuCAxXccfEDHeJtDSMQ4dUDCBA&amp;uact=5&amp;oq=zero+paradox%2C&amp;gs_lp=Egxnd3Mtd2l6LXNlcnAiDXplcm8gcGFyYWRveCwyBBAAGEcyBBAAGEcyBBAAGEcyBBAAGEcyBBAAGEcyBBAAGEcyBBAAGEcyBBAAGE-dIiR5Q2BVYgB5wAXgCkAEAmAEAoAEAqgEAuAEDyAEA-AEBwgIKEAAYRxjWBBiwA-IDBBgAIEGIBgGQBgg&amp;sclient=gws-wiz-serp#ip=1</mixed-citation></ref></ref-list></back></article>