Background and Prupose: Antibiotic resistance is a major global health concern. In addition to the existing data on the prevalence of bacterial resistance to antibiotics, there are patchy data on bacterial resistance to aminoglycosides in Burkina Faso. In this study, we determined the prevalence of aminoglycoside resistance genes in E. coli, including aac(3)- IIc, aac(6)- Ib and armA in Ouagadougou, and determined which antibiotics in this class are most affected by resistance. Material and Methods: This study was conducted on 216 E. coli strains collected from the biomedical analysis laboratories of Saint Camille and Schiphra hospitals. E. coli strains were isolated from pus and urine samples collected between September 2018 and January 2019. Antibiotic susceptibility testing was performed using aminoglycosides, β-lactams, fluoroquinolones, and sulfonamides. Aminoglycoside resistance genes were detected in strains with at least one aminoglycoside resistance gene using conventional/multiplex PCR. Results: Aminoglycoside resistance was observed in 46.8% (101/216) of strains. The resistance rates were respectively 45.37% for Tobramycin, 32.40% for Gentamicin, 14.81% for Kanamycin, 2.31% for Netilmicin, 1.84% for Neomycin, and 0.46% for Amikacin. PCR showed that 86 strains (85.15%) possessed the aac(3)- IIc gene, 71 strains or 70.30%) possessed the aac(6’)- Ib gene, and nine strains (8.91%) possessed the armA gene. Conclusion: Aminoglycoside resistance in pathogenic E. coli strains is mainly due to the presence of the aac(3’)- IIc and aac(6’)- Ib genes. The presence of armA was first reported in Burkina Faso. Netilmicin, Neomycin and Amikacin are good therapeutic options for treating urinary tract and pus-forming infections.
E. coli is the most common bacterial species in human pathology. It is responsible for more than 80% of tract infections [
The aminoglycoside-modifying enzyme (AME) is the most important mechanism for resistance to aminoglycosides [
This study was approved by the institutional ethics committee of Hôpital Saint Camille de Ouagadougou (HOSCO) under its reference N˚ 2018-09-016.
The present study was performed on 216 E. coli strains collected from September 2018 to February 2019 in the biomedical analysis laboratories of Saint Camille and Schiphra hospitals in the city of Ouagadougou. E. coli strains were obtained from urine (206/216) and pus (10/216) cultures. After collection of the strains, the plating was performed on Muller Hinton (MH) agar medium at 37˚C for 24 h to obtain pure strains. Antibiotic susceptibility testing was then performed using the disc diffusion method on Mueller Hinton (MH) agar medium following the 2018 recommendations of the Antibiogram Committee of the French Society of Microbiology [
A double synergy test was performed to identify the ESBL-producing bacteria. The presence of strains presenting the ESBL phenotype was determined using the agar disk diffusion method in the presence of a synergistic image (champagne cork) between the AUG and CRO or CFM disks. Strains resistant to Amoxicillin + Clavulanic Acid, Ceftriaxone and Cefixime, but which did not show an ESBL phenotype in susceptibility testing, were transferred to an MH medium supplemented with cloxacillin at a concentration of 250 mg/L to inhibit cephalosporinase production and to show synergy when the bacterium produces ESBL.
A few colonies of E. coli with similar morphology were picked from MH Petri dishes and mixed with sterile distilled water (0.5 mL) in an Eppendorf tube. Bacterial DNA was extracted by thermolysis by heating the Eppendorf tubes in a water bath at 100˚C for 10 min. After cooling to room temperature, samples were centrifuged at 13,000 rpm for 5 min. Supernatants containing DNA were collected and frozen at −20˚C for further use.
The aminoglycoside resistance genes, aac(3)-IIc and aac(6)-Ib, tested in this study, were detected by chain reaction using a ready-to-use master mix (5× HOT FIREPol@ Blend Master Mix with 10 mM MgCl2, Solisbiodyne), and the armA gene was searched using Taq Maximo with the GeneAmp System PCR 9700 thermal cycler (Applied Biosystems, California, USA). The primers used and their sequences and amplicon sizes are listed in
Statistical analyses were performed using Microsoft Excel 2019 and Epi Info 7.2.2.16. Descriptive analyses were performed, and the results are presented as frequencies and percentages.
Antibiotic susceptibility testing showed that all the families of antibiotics tested in this study were affected by resistance.
Among the aminopenicillin classes, 94.91% (205/216) of E. coli strains were resistant to amoxicillin and 50.93% (100/216) were resistant to Amoxicillin + Clavulanic acid. E. coli strains were active against the cephalosporins Ceftriaxone and Cefixime at 46.30% (100/216) and 44.91% (97/216), respectively. Imipenem was the most active antibiotic, although 3.24% (7/216) of strains were susceptible to high-dose (intermediate) imipenem. Among the fluoroquinolones, 72.69% were resistant to ciprofloxacin, and 73.61% were resistant to ofloxacin. The strains exhibited 84.72% resistance to trimethoprim/sulfamethoxazole.
Among the aminoglycoside classes, E. coli strains were more resistant to tobramycin (45.37%) and gentamicin (32.40%), whereas amikacin remained the most active antibiotic and was therefore the least affected by resistance (0.46%). The kanamycin, Netilmicin and Neomycin resistance rates were 14.81% (32/216), 2.31% (5/216), and 1.84% (4/216), respectively. Strains with at least one resistance to the aminoglycosides tested numbered 101 (46.75%) and the cumulative frequency of resistance of E. coli strains was 46.8%.
| Primer | Sequence (5’→3’) | Reference | Size (bp) |
|---|---|---|---|
| aac(3)-IIc | F: ATATCGCGATGCATACGCGG R: GACGGCCTCTAACCGGAAGG | [ | 877 |
| aac(6’)-Ib | F: TTGCGATGCTCTATGAGTGGCTA R: CTCGAATGCCTGGCGTGTTT | [ | 472 |
| armA | F: ATT CTG CCT ATC CTA ATT GG R: ACC TAT ACT TTA TCG TCG TC | [ | 315 |
Antibiotic susceptibility testing of E. coli strains revealed 92 ESBL-producing strains (42.59%). Among β-lactamase-producing strains, the percentages of resistance observed for tobramycin were 33.33% and 22.68% for gentamicin, 11.57% for kanamycin, 1.84% for netilmicin, 0.46% for neomycin, and 0.00% for amikacin. Seventy-seven (77) strains among the 92 ESBL-producing strains (83.69%) showed at least one resistance to aminoglycosides and fifteen strains were susceptible to the aminoglycosides tested. Among the 124 non-β-lactamase producing E. coli strains (57.41%), the resistance rates were 12.03% for Tobramycin, 9.72% for Gentamicin, 1.38% for Neomycin, 0.46% for Netilmicin and 0.46% for Amikacin, respectively. The overall results of the antibiotic susceptibility tests are summarized in
Polymerase chain reaction PCR for the identification of aac(3)-IIc and aac(6)-Ib (
The frequencies of resistance of the 216 E. coli strains to aminoglycosides were 45.37% (98/216) for tobramycin, 32.40% (70/216) for gentamicin, 14.81% (32/216) for kanamycin, 2.31% (5/216) for netilmicin, 1.84% (4/216) for neomycin, and 0.46% (1/216) for amikacin. These results show that in Burkina Faso, resistance to aminoglycosides was mainly due to Tobramycin and Gentamicin.
| β-Lactams | Aminoglycosides | Sulf. | FQ | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| AML n (%) | AMC n (%) | IMI n (%) | CRO n (%) | CFM n (%) | TOB n (%) | K n (%) | CN n (%) | N n (%) | NET n (%) | AK n (%) | SXT n (%) | CIP n (%) | OFX n (%) | |
| S | 11 (5.09) | 90 (41.67) | 209 (96.76) | 116 (53.70) | 119 (55.09) | 103 (47.69) | 180 (83.33) | 180 (66.67) | 212 (98.15) | 206 (95.37) | 208 (96.30) | 32 (14.81) | 57 (26.39) | 52 (24.07) |
| I | - | 16 (7.41) | 7 (3.24) | 1 (0.46) | - | 15 (6.94) | 4 (1.85) | 2 (0.93) | - | 5 (2.31) | 7 (3.24) | 1 (0.46) | 2 (0.93) | 5 (2.31) |
| R | 205 (94.91) | 110 (50.93) | - | 99 (45.83) | 97 (44.91) | 98 (45.69) | 32 (14.81) | 70 (32.41) | 4 (1.85) | 5 (2.31) | 1 (0.46) | 183 (84.72) | 157 (72.69) | 159 (73.61) |
Legend: S, susceptible; I, intermediate; R, resistant; Sulf, sulfonamides; FQ, fluoroquinolones; Amoxicillin AMC, amoxicillin + clavulanic acid; IMI, imipenem; CRO, ceftriaxone; CFM, cefxime; TOB, tobramycin; K, kanamycin; CN, gentamicin; N, neomycin; NET, netilmicin; AK, amikacin; SXT, trimethoprim/sulfamethoxazole; CIP, ciprofloxacin; OFX, ofloxacin.
| Genes of resistance | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| aac3iic | aac6ib | Arma | aac3Xaac6 | aac3Xarma | aac6Xarma | aac3Xaac6Xarma | ||||||||
| n | % | n | % | N | % | n | % | n | % | n | % | n | % | |
| Amikacin | 2 | 1.09* | 3 | 1.85 | 0 | 0.00 | 2 | 1.48* | 0 | 0 | 0 | 0 | 0 | 0 |
| Gentamicin | 61 | 33.33* | 56 | 34.57* | 9 | 40.91* | 45 | 33.33* | 4 | 26.67* | 5 | 46.67* | 3 | 20.00 |
| Tobramycin | 75 | 40.98* | 63 | 38.89* | 9 | 40.91* | 52 | 38.52* | 7 | 46.67* | 7 | 46.67* | 3 | 20.00 |
| Kanamycin | 35 | 19.13 | 30 | 18.52 | 4 | 18.18 | 27 | 20.00 | 4 | 26.67 | 3 | 20.00 | 3 | 20.00 |
| Netilmicin | 7 | 3.83 | 7 | 4.32 | 0.00 | 0.00 | 6 | 4.44 | 0 | 0.00 | 0 | 0.00 | 0 | 0.00 |
| Neomycin | 3 | 1.64 | 3 | 1.85 | 0.00 | 0.00 | 3 | 2.22 | 0 | 0.00 | 0 | 0 | 0 | 0 |
| TOTAL | 2 | 1.09 | 3 | 1.85 | 0 | 0.00 | 2 | 1.48 | 0 | 0 | 0 | 0 | 0 | 0 |
The cumulative prevalence gave a resistance of 46.8% to aminoglycosides. In 2011, resistance to gentamicin was also observed in Kumasi, Ghana, where 28% of E. coli strains isolated from urine were found to be resistant to this antibiotic [
The highest rate of resistance of Enterobacteriaceae to antibiotics at the Sidi Bel Abbes University Hospital in Algeria was 42.1% for tobramycin, 38.6% for gentamicin, and 35% for Kanamycin [
Among the non-β-lactamase producing E. coli strains at 57.40% (124/216), the resistance rates were 20.97% (26/124) for Tobramycin; 16.94% (21/124) for Gentamicin; 2.42% (3/124) for Neomycin; 0.81% (1/124) for Netilmicin and 0.81% for Amikacin (1/124), respectively. Our results are similar to those obtained in Poland for 44 strains of non-ESBL E. coli isolated from hospitalized patients. Resistance was 13.6% for tobramycin, 59% for gentamicin, and 4.6% for Netilmicin [
Among β-lactamase-producing strains, 92 (42.59%) were resistance observed in the 216 strains (33.33% Tobramycin, 22.68% Gentamicin, 11.57%, Kanamycin 1.84% Netilmicin, 0.46%), and amikacin (0%).
Among the 92 ESBL-producing E. coli strains (92), resistance rates were 78.26% (72/92), 53.26% (49/92), 27.17% (25/92), 4.35% (4/92), 1.09% (1/92), and 0% (0/92), respectively to tobramycin, gentamicin, kanamycin netilmicin and neomycin. Sensitivity rates were observed for Neomycin, 98.91% for Amikacin at 94.57% and Netilmicin at 91.30% for netilmicin. Aminoglycoside resistance was also investigated by Ebongue et al. 30 who tested ESBL-producing E. coli clinical isolates (105) and found high rates of resistance to gentamicin (80.6%), netilmicin (89.4%), and tobramycin (94%) [
This accumulation of resistance mechanisms indicates the coexistence of multiple resistance mechanisms (β-lactams associated with aminoglycosides). The use of cephalosporins and Amoxicillin + Clavulanic Acid would have favored the increase in aminoglycoside resistance among ESBL strains because this resistance is often conditioned by the presence of plasmids carrying multiple resistance determinants that are transferable to other gram-negative bacteria [
The results of this study showed that Amikacin was the most susceptible antibiotic among the aminoglycoside. The high sensitivity of amikacin (96.30%) has been confirmed by previous studies on 91 E. coli ESBL strains in Togo, of which 97% were amikacin. In Norway, a low rate of resistance to amikacin (6%) was observed in E. coli strains isolated from urine and hemoculture [
All strains that showed at least one resistance to aminoglycosides were subjected to PCR for the aac(3)-IIc, aac(6’)-Ib and armA genes (
The frequencies of aminoglycoside-resistant strains carrying the aac(3’)-IIc gene were 95.35% (82/86) for tobramycin, 74.42% (64/86) for gentamicin, 30.23% (26/86) for kanamycin, 4.65% (4/86) for netilmicin, 3.49% (3/86) for neomycin and 1.16% (1/86) for amikacin. The high prevalence of aac(3)-IIc might explain the high frequency of resistance to Tobramycin, Gentamicin and Kanamycin and Netilmicin. The AAC(3)-II enzyme confers a common resistance mechanism to gram-negative bacteria and was also found to be resistant to Tobramycin, Gentamicin and Netilmicin [
The frequencies of aminoglycoside-resistant strains carrying the aac(6’)-Ib gene were 98.59% (70/71) for tobramycin, 63.38% (45/71) for gentamicin, 38.03% (27/71) for kanamycin, 5.62% (4/71) for netilmicin, 1.41% (1/71) for amikacin, and 0% for neomycin. The AAC(6)-I group was resistant to Amikacin, Tobramycin, Netilmicin and Kanamycin [
Aminoglycoside resistance is primarily due to the aac3IIc and aac6Ib genes. As shown in
Of the strains tested by PCR, 8.91% (9/101) harbored armA. To the best of our knowledge, this is the first time this gene has been identified in Burkina Faso. Methylase genes confer high resistance to aminoglycosides. Despite the low rate of the armA methylase gene in this study (19%) compared with that of acetyl aminoglycosides (aac), it appears that the presence of the armA gene is linked to resistance to Tobramycin and Gentamicin. All strains (09) with the armA gene were resistant to Tobramycin and Gentamicin, and the highest frequencies of aacXarmA were found in the tobramycin- and gentamicin-resistant strains. A study published in 2007 on the emergence of aminoglycoside resistance genes armA and rmtB in Belgium showed that out of 18 Enterobacteriaceae, only one E. coli strain carried the armA and rmtB genes [
The main limitation of our work is the limited number of resistance markers studied, in particular genes involved in resistance to beta-lactam antibiotics, fluoroquinolones and trimethoprim/sulfamethoxazole.
The presence of this methylase gene in our study is a boon to the awareness of the risk of transferring this gene to other clinical strains.
This study on the identification of E. coli resistance genes in E. coli in Ouagadougou showed that these strains were more resistant to Tobramycin and Gentamycin. Among these strains, amikacin was the most active aminoglycoside. The aac(3)-IIc and aac(6)-Ib genes are primarily responsible for aminoglycoside resistance in E. coli. However, the presence of the RNA methylase resistance gene armA found for the first time among E. coli strains in Burkina Faso, allowed us to strengthen the monitoring and control of resistant strains.
The authors extend their gratitude to Richard OUEDRAOGO, Patrick DAMIBA, Napebgsom KAFANDO, Fanta NEYAGA (May she rest in peace), Essi Etonam DOVO, Edwige DIANDA, Hermanne GUISSOU, Isaïe OUEDRAOGO, Kadidiatou RABO, and Thomas OUEDRAOGO for their valuable assistance in the collection of strains. Additionally, the authors would like to acknowledge Abel SORGHO, Prosper BADO, Hermann SOMBIE, Valéry BAZIE, and Marius SETOR for their invaluable contributions during the molecular biology manipulations.
The authors and all participants in this study declare no conflicts of interest.
Djagbare, P., Nadembega, C., Sagna, T., Ouattara, A.K., Sampo, E., Zohoncon, T., Ouedraogo, M., Belemgnegre, M., Obiri-Yeboah, D. and Simpore, J. (2023) Detection of aac(3)IIc, aac(6)Ib, armA Genes Coding for Escherichia coli Resistance to Aminoglycosides in Burkina Faso. Advances in Infectious Diseases, 13, 574-585. https://doi.org/10.4236/aid.2023.134047