To compare the global expression of different VDAC isoforms in different physiological T lymphoid tissues to the malignant T-ALL, we used publicly available GEO datasets (GSE141140, GSE33470) extracted from the website https://www.ncbi.nlm.nih.gov/gds and analyzed in GraphPad prism 9.0. The dataset GSE141140 was modified in our lab, in a different study, to add more control groups, namely the thymocytes and hematopoietic pluripotent stem cells (HPSCs) respectively. For differential gene analysis and protein-to-protein interaction, we used Cytoscape and R software respectively.

T-ALL cell lines: Jurkat, Molt4, Loucy, CUTLL1, RPMI 8402, CCRF-CEM, P12-Ichikawa (P12 or P12-Ich), HPB-ALL, Peer and Molt3 cells, kindly provided by the Center of Molecular Medicine, Children’s Hospital of Chongqing Medical University, were cultured in RPMI 1640 (Gibco, USA) supplemented with 10% FBS, 1% penicillin/streptomycin combo (Gibco, USA), and 2 mmol/l L-glutamine. T-ALL cell lines were treated with inhibitors of VDAC2.

HEK-293PA (Human embryonic kidney) cells kindly provided by the Center of Molecular Medicine, Children’s Hospital of Chongqing Medical University, were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, USA), which included 10% FBS, 1% penicillin/streptomycin combination, and 2 mmol/l L-glutamine, were used to produce the retrovirus expression vector. All cells were cultured in a humidified atmosphere at 37˚C in 5% CO₂. This cell line was used to assemble retroviral vector particles, containing siRNA.

About 2 × 10⁶ cells were centrifuged at 800 G/min, 4˚C; supernatant was completely removed, and 1 ml of Trizol RNAiso (Takara, Japan) was added, mixed well then 200 µl Trichloromethane was added, mixed well again and centrifuged at 4˚C for 13,000 G for 15 minutes. The tRNA will be found in the supernatant. After centrifugation, 400 µl of supernatant is carefully aspirated into a new vial after which same volume of isopropanol is added and mixed homogenously; centrifuged at 4˚C for 13,000 G for 10 minutes. The supernatant is discarded and do the wash step twice with freshly prepared 70% ethanol, by centrifuging at 4˚C, 12,000 rpm for 5 minutes; completely discard supernatant by spinning down on the mini-centrifuge for 5 seconds and aspirate with pipet and dry at room temperature for 5 minutes. 10 µL of ddH₂O is added to dissolve tRNA; then detect extracted RNA by agarose gel electrophoresis.

The cDNAs were treated to SYBR Green-based real-time PCR method, and GAPDH was used as reference gene. The following primer sequences for gene expression RT qPCR assays were used: Human VDAC2, forward: CTTTGCAGT GGGCTACAGGA, reverse: ACGAGTGCAGTTGGTACCTG; GAPDH forward: CAGCGACACCCACTCCTCCACCTT, reverse: ATGAGGTCCACCACCCTGTTGCT.

The T-ALL cell lines were cultured in presence of erastin at increasing concentration (from 0 µM to 20 µM), at 37 ˚C in 5% CO₂ for 48 hours, then tested using PE Annexin V method, as described by manufacturer provided protocol.

The siRNA construct of human VDAC2 was designed and procedure was performed as reported elsewhere [18] . The hVDAC2-siRNAs were synthesized by Huada Biology (Beijing, China) and then used in molecular cloning step. The following sequences were used:

Sense: GGCAAAAAA GCTTGGACATCAGGTACCAACTGCA TTTTT,

Antisense: GCCA AAAAATGCAGTTGGTACCTGATGTCCAAGC TTTTT.

An in-house plasmid, pSEIB-361-GFP, was cut using a single point restriction endonuclease enzyme (NEB, USA), linked to siRNA construct with T4 DNA ligase (NEB, USA) to form a recombinant DNA sequence. 50 µl E. coli DH5α (Tiangen, CAT: CB101) competent cells were transformed with recombinant DNA sequence, by heat shock at 42˚C for 90 seconds, to allow penetration of expression vector containing target sequence, placed on ice for 3 - 5 minutes; then mixed with 800 µl liquid broth and shaken in a water bath at 37˚C for 30 - 60 minutes. Transformed cells are then centrifuge at 2000 rpm for 3min, and sediment of competent cells is evenly spread on Muller-Hinton plate coated with Ampicillin (concentration of 100 mg/ml) and incubates it at 37˚C for 12 - 14 hours. Plasmid is extracted from single colonies bacteria by alkaline lysis method, followed by agarose gel electrophoresis, plasmid PCR, and RNA depletion by magnetic beads, using manufacturer provided protocol.

The HEK-293PA cell was cultured in T7 flasks until it reaches 60% - 80% confluence. Transfection was done for each of the three plasmids: 8 µg of recombinant p-SEIB-361-GFP-hVDAC2-siRNA; packaging plasmids: 8 µg of p-Ampho and 2 µg of p-VSV-g. 144 µg of polyethylenimine (PEI) reagent (Polysciences, Warrington, USA), was used to enhance transfection efficiency. The first four hours, FBS-free DMEM was used, followed by DMEM supplemented by 10% FBS for 24 h, then replaced with fresh media. Supernatants with retrovirus were collected at 48 h, 72 h and 96 h from HEK-293PA cells, post-transfection for harvesting of retrovirus vectors.

Retroviral infection of T-ALL cells for siRNA gene delivery

Healthy T-ALL cell lines with at least 70% confluence were centrifuged and resuspended in fresh, serum-free RPMI 1640 medium. The supernatant containing retrovirus was infected together with 4 µg/ml Polybrene (Polysciences, Warrington, USA) to cells in 3 cycles at 4 h intervals, virus was reinfected into cells three times, and replacing the media with each round. The infected cells were screened at 48 h post-infection according to the different tolerance concentration of blasticidin (Polysciences, Warrington, USA).

About 5 × 10⁵ cells were centrifuged at 2000 rpm for 5 minutes, and the supernatant was removed. Pre-cooled PBS was added to the cells, and they were spun at 2000 rpm for 5 minutes to wash them. PE Annexin V method was performed according to manufacturer provided protocol.

To test cell viability and deduce cell proliferation rate, T-ALL cells in logarithmic growth phase after exposure to various treatment factors were inoculated on 96 well plates at rate of 5000 cells per well, with 3 wells per group. After 12 h, 24 h, 48 h, 72 h respectively, 10 µl CCK-8 solution is added to each well, mix before continuing to culture. After 4 h, absorbance at wavelength of 450 nm was detected by an enzyme marker. A cell proliferation curve based on absorbance values was drawn.

Cell cycle was tested 48 h and 72 h after exposure to treatment factors. T-ALL cells were isolated and rinsed in PBS; fixed with 70% ethanol and PI staining was performed according to manufacturer protocol.

To unless otherwise stated, all experiments performed in triplicates. Statistical details of the experiments including statistical tests used can be found in the figure legends. Statistical significance was defined as p < 0.05. We used GraphPad 9.0 software to analyse our experimental and public dataset data. All experiments, when n not indicated, were carried out in triplicates and a mean value was taken as a final value. Experimental data were analyzed using the statistical methods: Student’s t-test or repeated-measures one-way or two-way analysis of variance (ANOVA) as indicated in the figure legends.

Our observations were that the global expression levels (mean ± SD) of VDAC2 were highest expressed isoform in T-ALL cells (116.2 ± 36.7) when compared to the control group cells, which are: the thymocytes, HPSC and normal T lymphocytes (peripheral T lymphocytes). VDAC1 was the highest expressed isoform in the control group, HPSC (90.7 ± 42.9) and thymocytes (150.1 ± 33.9). On the other hand, VDAC3 showed no statistically-significant difference in the mean value across all cell types (Figure 1(A) & Figure 1(B)).

VDAC2 expression in T-ALL patients’ cells was significantly high, compared to VDAC2 expression in normal peripheral T cells (p < 0.0027). There was no significant difference in levels of VDAC2 between T-ALL cells when compared to HPSC (p < 0.2159), and thymocytes (p < 0.3713). Interestingly, VDAC1 isoform expressed the same pattern, with comparable means between T-ALL cells against HPSCs (p < 0.4067) and thymocytes (p < 0.0879) and a significantly lower VDAC1 expression in peripheral T lymphocytes (p < 0.0008) (Figure 1(A) & Figure 1(B)).

We then tested mRNA expression of VDAC2 by quantitative RT-PCR, amongst seven T-ALL cell lines, namely Jurkat, Molt4, CUTLL1, RPMI 8402, CCRF-CEM, HPB-ALL, and P12-ICH cells, and found that VDAC2 was heterogeneously

expressed in T-ALL cell lines.

In Figure 2, we investigated how VDAC2 is expressed in developing T cells,

from the bone marrow, through thymus into the peripheral blood. Using publicly available dataset (GSE33470) RNA-seq results, we found that VDAC2 expression levels were the highest at the intermediate single positive stage (ISP), which is a transitioning stage between double negative (DN) and double positive (DP) stages. Comparing the expression of VDAC2 in a poorly differentiated and immature double negative thymocytes stage (CD34⁺CD1a⁻ to CD4ISP) to the more differentiated, DP and single positive cells (DPCD3⁻ to CD3⁺CD8⁺), we found a significant difference in expression (p < 0.0040).

Using the RNA-seq dataset results (GSE141140), we found that protein to protein interactions of VDAC2 existed with other genes associated with mitochondria-mediated apoptosis pathway. Figure 3 shows that VDAC2 is associated to 5 genes, namely BAK, BAX, BCL2-L1, CASP3 and DIABLO. Further differential genomic analysis of the dataset revealed that different gene expression existed in the three different controls when compared to T-ALL, indicating that the type of control is very important when comparing the gene expression of different cohorts.

We tested the effects of inhibiting VDAC2 in T-ALL cell lines, using a small molecular inhibitor erastin, at increasing concentration（0, 0.1, 1.0, 5.0,10, 20 µM), after incubation for 48 hours at 37˚C in CO₂. The cell survival rates as measured by PE Annexin V flow cytometry method, as demonstrated in Figure 4, shows that two cell lines (Jurkat with IC₅₀ = 3.943 µM, Molt4 with IC₅₀ =

3.286 µM) were sensitive to erastin and the rest cell lines either had unstable IC₅₀ (CUTLL1 and RPMI 8402) or showed resistance to erastin (Loucy, CCRF-CEM, P12-ICHI, HPB-ALL, and PEER cells).

To investigate the cell viability and proliferation of T-ALL cells when cells are exposed to transient silencing of the VDAC2 gene, thereby creating stably expressing VDAC2-siRNA cells (see Figure 5). We measured the functional effects such as survival, apoptosis and proliferation rate of T-ALL cells transfected with siRNA over a period of 96 hours.

Using the CCK-8 assay, we found that T-ALL cells showed a gradual increase

in proliferation for the first 48 hours post-transfection, followed by an abrupt abrogated proliferation which was pronounced at 96 hours post-siRNA transfection (see Figure 6(A)). A decreased cell survival rate and increased apoptosis was also confirmed by PE Annexin V method, 96 h post-transfection (Figure 6(B) & Figure 6(D)). The results indicated that VDAC2 siRNA took effect at 48 hours after transfection. When comparing the proliferation rates as measured in absorbance of cells at 72 hours and 96 hours post-transfection, there is an inhibited proliferation (p < 0.0016).

We further went to confirm the survival and apoptosis rate of T-ALL cells post-transient silencing of VDAC2 with siRNA by means of PE Annexin V assays. Six VDAC2 siRNA transfected cells showed a decreased cell viability to an average of <20%, 72 hours after retrovirus was introduced. When we compared the mean survival rate of all cell lines at zero hours before transfection (mean 94.4%, ±1.90) and 72 hours after transfection (mean 12.0%, ±4.67) by ANOVA, the difference was very statistically significant (p < 0.0001).

We stained T-ALL cells with Propidium Iodide, to determine the cell cycle status of cells with genetic downregulated of VDAC2. Surprisingly, treatment of T-ALL cells with VDAC2 siRNA arrested cell cycle in Sub-G₁ phase, for all the six cell lines tested. When comparing cell cycle of untreated to VDAC2-siRNA treated T-ALL cells, there is a decrease in the proportion of cell cycle division, namely the G1-phase, S-phase and G2-phase (Table 1(A) & Table 1(B); Figure 7). Most

of the cells were confined to the sub-G1 phase of cell cycle and facing an imminent cell death. Transfection of T-ALL cells with VDAC2-siRNA induced a G0/G1 cell cycle arrest (Figure 7; Table 1(A) & Table 1(B)). We then used student’s t-test to compare of flow cytometry counts (G1 phase compared to sub-G1 phase) of all six tested cell lines when untreated with VDAC2-siRNA to 72 hours post-treatment we found that statistically significant values in Jurkat (p < 0.05) and CCRF-CEM cells (p < 0.05), and a non-significant p-value but elevated sub-G1 cell population in Molt4, HPB-ALL, RPMI 8402 and CUTTL1 cells.