<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2023.1410029</article-id><article-id pub-id-type="publisher-id">ABB-128580</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Molecular Identification and Characterization of a Begomovirus Associated with Okra Enation Leaf Curl Disease in Mali
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Gaoussou</surname><given-names>K. Keita</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Laya</surname><given-names>Kansaye</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lassina</surname><given-names>Doumbia</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ibrahim</surname><given-names>Keita</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mariam</surname><given-names>Sangare</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tidiani</surname><given-names>Sinayoko</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Boubacar</surname><given-names>Macalou</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Moussa</surname><given-names>Noussourou Maiga</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Nadou</surname><given-names>Paul Sanogo</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ousmane</surname><given-names>Koita</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Université des Sciences, des Techniques et des Technologies de Bamako (USTTB) de Bamako, Laboratoire de Biologie Moléculaire Appliquée (LBMA), Bamako, Mali</addr-line></aff><aff id="aff3"><addr-line>Institut Economie Rural (IER), Bamako, Mali</addr-line></aff><aff id="aff1"><addr-line>Institut Polytechnique Rural de Formation et de Recherche Appliquée (IPR/IFRA) de Katibougou, Koulikoro, Mali</addr-line></aff><pub-date pub-type="epub"><day>25</day><month>10</month><year>2023</year></pub-date><volume>14</volume><issue>10</issue><fpage>429</fpage><lpage>438</lpage><history><date date-type="received"><day>4,</day>	<month>August</month>	<year>2023</year></date><date date-type="rev-recd"><day>23,</day>	<month>October</month>	<year>2023</year>	</date><date date-type="accepted"><day>26,</day>	<month>October</month>	<year>2023</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Okra is one of the most widespread vegetable crops in the world, particularly in West Africa. However, several factors influence okra crops as biotic and abiotic factors. Among the diseases affecting its culture, okra leaf curl disease is a major threat. This study aims to assess begomoviruses from okra plants with symptoms like leaves curl by molecular approach. A total of thirteen serologically positive samples were tested by PCR assay, and one sample was sequenced among them. The begomovirus was found in six isolates, 
  Bhendi yellow vein mosaic virus (BYVMV) in three isolates, and 
  Okra enation leaf curl virus (OELCuV) in three isolates, respectively. The begomovirus isolate sequences shared 90% identity with the
   Cotton leaf curl Gezira virus. Mixed infections between these viruses were found. Thus, these results highlight the need to monitor the spread of these disease-causing viruses for okra crops in Mali. In addition, they can also lead to a considerable loss in okra fields in Koulikoro, which is an agricultural region by excellence.
 
</p></abstract><kwd-group><kwd>Okra</kwd><kwd> PCR</kwd><kwd> Begomovirus</kwd><kwd> BYVMV</kwd><kwd> OELCuV</kwd><kwd> Mali</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Okra or Abelmoschus esculentus L. Moench, is a flowering plant composed of edible green seed pods [<xref ref-type="bibr" rid="scirp.128580-ref1">1</xref>] . The Malvaceae Familly, okra is a vegetable native to West and Central Africa [<xref ref-type="bibr" rid="scirp.128580-ref2">2</xref>] .</p><p>The Geminiviridae family is composed of small circular ssDNA viruses, encapsidated within virions, with geminate morphology, and known to cause diseases in crop plants across the world [<xref ref-type="bibr" rid="scirp.128580-ref3">3</xref>] .</p><p>Cultivated okra is recognized to be susceptible to a multiple number of begomovirus-like mosaic virus diseases and others. These others could be responsible viruses such as Yellow vein mosaic disease (OYVMV), Okra leaf curl disease (OLCV), and Okra enation leaf curl disease (OELCuV), CLCuGV, and CYCrV which are potentially transmitted in the field by the whitefly [<xref ref-type="bibr" rid="scirp.128580-ref4">4</xref>] - [<xref ref-type="bibr" rid="scirp.128580-ref8">8</xref>] .</p><p>Most geminiviruses are in the genus Begomovirus [<xref ref-type="bibr" rid="scirp.128580-ref9">9</xref>] .</p><p>Begomovirus infects primarily dicotyledonous plants and the transmission is done by the whitefly Bemisia tabaci [<xref ref-type="bibr" rid="scirp.128580-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.128580-ref11">11</xref>] . Transmission is mainly by whitefly [<xref ref-type="bibr" rid="scirp.128580-ref12">12</xref>] , and infection increases as the number of whiteflies increases. Symptoms appear 8 to 12 days after infection [<xref ref-type="bibr" rid="scirp.128580-ref3">3</xref>] .</p><p>OLCD is an important viral disease characterized by leaf curling either upward or downward, mostly associated with plant stunting. Caused by viruses of the genus Begomovirus, and affects the culture of Okra in terms of yield and fruit quality in tropical and subtropical areas [<xref ref-type="bibr" rid="scirp.128580-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.128580-ref14">14</xref>] .</p><p>In most African countries, Okra leaf curl disease (OLCD) is considered the most serious disease menacing okra production [<xref ref-type="bibr" rid="scirp.128580-ref14">14</xref>] . Infection usually occurs at an early stage in the crop [<xref ref-type="bibr" rid="scirp.128580-ref15">15</xref>] . The age of the seedlings plays an important role in the acquisition of infection. It is highest between 7 and 15 days of seeding [<xref ref-type="bibr" rid="scirp.128580-ref3">3</xref>] .</p><p>OYVMV is one of the most devastating and widespread viruses in the okra fields, transmitted by whitefly (Bemisia tabaci Genn.), which is the most troublesome pest of many crops in the world [<xref ref-type="bibr" rid="scirp.128580-ref16">16</xref>] . Kulkarni initially reported the virus in Mumbai, India in 1924. Yadav et al. reported that the okra Leaf curl disease can cause significant yield losses. The losses of yield are more important among plants infected at an early stage [<xref ref-type="bibr" rid="scirp.128580-ref17">17</xref>] . The virus is responsible for 80% - 90% of yield losses and it affects all the developmental stages of okra plants. In Ghana, Africa, more than 50% of disease incidence in okra farms has been reported [<xref ref-type="bibr" rid="scirp.128580-ref16">16</xref>] .</p><p>Usually, viral infections are controlled by vector control. Controlling whitefly populations and/or treating seedlings with phytopesticides are just some of the ways to avoid infection by the okra Leaf curl virus [<xref ref-type="bibr" rid="scirp.128580-ref18">18</xref>] . It has been reported that controlling whitefly populations is the best measure against okra Leaf curl disease [<xref ref-type="bibr" rid="scirp.128580-ref18">18</xref>] .</p><p>Near Bamako, Mali, typical symptoms of begomovirus infection, such as yellow veining, leaf yellowing, crinkling, and cupping, were observed in okra (Abelmoschus esculentus) variety trials. After sequence analysis, the disease was caused by a distinct begomovirus named Okra Yellow Vein Crinkle Disease (OYVCrD) [<xref ref-type="bibr" rid="scirp.128580-ref19">19</xref>] . This study aimed to identify and characterize begomoviral infection by molecular method from okra plants with OLCD plus the mosaic symptoms in Koulikoro, Mali.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Sample Collection</title><p>Leaves of okra showing symptoms were collected from nine (9) different field locations of Koulikoro (IPR Diakitebougou, IPR boarding garden, IPR garden near bridge, IPR garden, Kolebougou, Koulikoro Downtown, and Niarebougou). It was previously 52 samples from which 13 samples have tested positive for the Okra Mosaic virus (OkMV) serologically.</p></sec><sec id="s2_2"><title>2.2. DNA Isolation</title><p>Approximately 100 mg of okra leaves frozen at −20˚C were used for DNA extraction. Virus DNA was extracted using a DNeasy Plant Mini kit (Qiagen, Maryland, USA) according to the manufacturing’s instructions. The concentration and purity of DNA were evaluated at 260 to 280 nm with a spectrophotometer (Eppendorf AG, Germany) by absorbance at (260/280, and 260/230 ratio) respectively. DNA was stored at −20˚C when it was not used immediately.</p></sec><sec id="s2_3"><title>2.3. PCR Amplification</title><p>All DNA isolates were screened for begomovirus detection, Bhendi yellow vein mosaic virus (BYVMV), and Okra enation leaf curl virus (OELCuV). The primers used were “Okra-F318/Okra-R1004, and Okra-1469/Okra-R2338” for begomovirus, “BY” for BYVMV, and “OE” for OELCuV (<xref ref-type="table" rid="table1">Table 1</xref>).</p><p>Polymerase chain reactions (PCR) were carried out at the Laboratoire de Biologie Mol&#233;culaire Appliqu&#233;e (LBMA) in Bamako. Primers (<xref ref-type="table" rid="table1">Table 1</xref>) were used to identify begomoviruses, BYVMV, and OELCuV in diseased plant leaf samples. PCR was performed following the protocol modified from studies conducted by Naresh et al. (2019) in southwest India, and Tiendrebeogo (2014) in Burkina Faso [<xref ref-type="bibr" rid="scirp.128580-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.128580-ref21">21</xref>] .</p><p>Amplification was carried out using the thermocycler PTC 200. The total volume of the reaction was 25 &#181;l containing different concentrations: 1 X Buffer, 3</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> List of primers</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequence 5’ → 3’</th><th align="center" valign="middle" >Amplified fragment size bp</th><th align="center" valign="middle" >References</th></tr></thead><tr><td align="center" valign="middle" >OE For</td><td align="center" valign="middle" >CGCTATAAGTACTTGCGCACTAAG</td><td align="center" valign="middle"  rowspan="2"  >327</td><td align="center" valign="middle"  rowspan="4"  >(Naresh et al. 2019)</td></tr><tr><td align="center" valign="middle" >OE Rev</td><td align="center" valign="middle" >CATTCGTGATTTTGTGACGCGG</td></tr><tr><td align="center" valign="middle" >BY For</td><td align="center" valign="middle" >GGCATGGACAAACAGGCCTATG</td><td align="center" valign="middle"  rowspan="2"  >470</td></tr><tr><td align="center" valign="middle" >BY Rev</td><td align="center" valign="middle" >CCAACGCCTGTTCCCTCGCTG</td></tr><tr><td align="center" valign="middle" >Okra-F318</td><td align="center" valign="middle" >AATTATGTCGAAGCGACCAG</td><td align="center" valign="middle"  rowspan="2"  >700</td><td align="center" valign="middle"  rowspan="4"  >(Tiendrebeogo et al. 2010; Tiendrebeogo, 2014)</td></tr><tr><td align="center" valign="middle" >Okra-R1004</td><td align="center" valign="middle" >GCATTCTCCGTATGATTCTC</td></tr><tr><td align="center" valign="middle" >Okra-1469</td><td align="center" valign="middle" >CAGTGATGAGTTCCCCTGTG</td><td align="center" valign="middle"  rowspan="2"  >900</td></tr><tr><td align="center" valign="middle" >Okra-R2338</td><td align="center" valign="middle" >GTCAAGTCCTACATCGACAAGG</td></tr></tbody></table></table-wrap><p>mM MgCl<sub>2</sub>, 0.4 mM dNTPs, 0.4 &#181;M each primer, 1.25 U GoTaq&#174; DNA Polymerase, and 5 &#181;l of DNA. The program was conducted using the thermocycler PTC 200:1 cycle of denaturation at 94˚C for 5 minutes followed by 35 cycles of 94˚C for 1 min (denaturation), 52˚C for 30 sec (hybridization), 72˚C for 1 min (initial elongation), 72˚C for 10 min (final elongation).</p><p>The product amplifications were visualized on 1% and 1.5% agarose gel according to primer size with ethidium bromide using UV-light with UV&#174; light transilluminator and Doc-ItLS Analysis Software.</p></sec><sec id="s2_4"><title>2.4. Sequencing</title><p>One sample positive with Okra-F318/Okra-R1004 primers selected based on product quality PCR was subject to the Sanger sequencing technique using the CEQ™ 8000 DNA analyzer (Beckman Coulter). The sequences were analyzed using the NCBI BLAST Search Tool (BLAST, https://www.ncbi.nlm.nih.gov/) consulted on 31 July 2023. Following amplification, the PCR products were purified and re-amplified using the GenomeLab DTCS Quick Start Kit (Beckman Coulter, USA) according to the manufacturer’s instructions. Finally, sequencing products were purified by ethanol precipitation.</p></sec><sec id="s2_5"><title>2.5. Phylogenetic Analysis</title><p>The Basic Local Alignment Search Tool (BLAST) of NCBI (National Center for Biotechnology Information) was used to confirm the identity of the generated sequences in the GenBank nucleotide database. The sequences were aligned with BioEdit software version 7.7 using sequences retrieved on GenBank alignments. The GenBank accession numbers, strain, country of origin, district of origin, date, and the plant of isolation were given for each virus when available.</p><p>The phylogenetic tree was performed using Molecular Evolutionary Genetics Analysis (MEGA) software version 7.0. The Maximum likelihood statistical method based on the Tamura-Nei model was performed [<xref ref-type="bibr" rid="scirp.128580-ref22">22</xref>] . The robustness of the phylogenetic tree was evaluated with 1000 bootstrap replicates.</p></sec></sec><sec id="s3"><title>3. Results</title>Identification of Okra Leaf Curl Virus<p>At the left, the PCR product shows Okra-F318/Okra-R1004 which amplified 700 bp with samples B1, C3, D3, E3, E4, and E5 positive; B2, B3, and B4 were negative; NC negative control and PC positive control to the assay; Marq-100 molecular weigh (100 bp). At the right, Okra-1469/Okra-R2338 which amplified 900 bp with B1, D3, E3, and E5 positive, B2, B3, B4, C1, and C3 were negative respectively. NC negative control and PC positive control to the assay; Marq-100 molecular weight (100 bp).</p><p>Symptoms were mainly mosaic and leaf curl. We found mixed infections.</p><p>The genome highlighted in red corresponds to the sequence of this study. The phylogeographic analysis of the sequences using BLAST tools showed that the viruses isolated in Mali are mostly similar to those from Burkina Faso (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p></sec><sec id="s4"><title>4. Discussion</title><p>Among the samples collected from different areas of Koulikoro, 13 samples have been positive for serological tests. PCR was successfully applied for begomoviral detection in these symptomatic serological positive samples with fragments of approximately 900 bp, 700 bp (see <xref ref-type="fig" rid="fig1">Figure 1</xref>), 470 bp, and 327 bp (the figure does not show). The result obtained was expected, the band of products PCR was properly visible on the agarose gel after electrophoresis (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><p>These PCR product fragments found in this study corroborate those of Tiendrebeogo et al. (2010) [<xref ref-type="bibr" rid="scirp.128580-ref14">14</xref>] ; Tiendrebeogo, (2014) [<xref ref-type="bibr" rid="scirp.128580-ref21">21</xref>] , and Naresh et al. (2019) [<xref ref-type="bibr" rid="scirp.128580-ref20">20</xref>] who have carried out similar work on okra begomoviruses.</p><p>In this study, we have evaluated the possibility of okra leaves being infected by several types of viruses. We first tested okra leaves serologically for okra mosaic virus. PCR was used to identify the viruses responsible for okra leaf disease. In the present study, PCR was used to identify the begomoviruses BYVMV and OELCuV.</p><p>This study showed that 46% (6/13) of samples were positive for begomovirus-specific primers, 23% (3/13) for BYVMV, and 23% (3/13) for OELCuV respectively (<xref ref-type="table" rid="table3">Table 3</xref>).</p><p>In the identification process of the viruses infecting okra leaves, we found in the same DNA extracts begomovirus plus BYVMV and OELCuV. This is the first time that these two viral species infecting okra leaves (BYVMV and OELCuV) have been reported in Mali, and they may be responsible for a major threat to okra production.</p><p>Tiendr&#233;b&#233;ogo et al. (2010) [<xref ref-type="bibr" rid="scirp.128580-ref14">14</xref>] reported that the effect of okra leaf curl disease is greater in local okra seed crops with an overall considerable yield loss, ranging from 68.5% to 72.5% in Burkina Faso compared to commercial seed crops from 8.7% to 16.2%. The effect of the disease on local okra seed crops was</p><p>observed by a 58% reduction in growth compared to 39.6% for commercial ones [<xref ref-type="bibr" rid="scirp.128580-ref14">14</xref>] .</p><p>We found mixed infections with the virus responsible for enrolment and yellow vein mosaic of leaves, with the other viruses investigated in this study accounting for 23% (3/13) (<xref ref-type="table" rid="table3">Table 3</xref>). Tiendr&#233;b&#233;ogo et al. (2010) [<xref ref-type="bibr" rid="scirp.128580-ref14">14</xref>] , reported major symptoms such as leaf curl found in this study.</p><p>The sequenced sample was 90% identified with 5% gaps using the NCBI BLAST tool with a higher similarity to Cotton leaf curl Gezira virus from Burkina Faso. Thus, we used BLAST NCBI, which showed similarity with Cotton leaf curl Gezira virus from different geographical areas Burkina Faso, C&#244;te d’Ivoire, and Niger (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Results of PCR by samples symptoms and primers used</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >ID</th><th align="center" valign="middle"  rowspan="2"  >Symptoms</th><th align="center" valign="middle"  colspan="4"  >PCR</th></tr></thead><tr><td align="center" valign="middle" >BY</td><td align="center" valign="middle" >OE</td><td align="center" valign="middle" >Okra318</td><td align="center" valign="middle" >Okra1469</td></tr><tr><td align="center" valign="middle" >B1</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >POS</td></tr><tr><td align="center" valign="middle" >B2</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td></tr><tr><td align="center" valign="middle" >B3</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td></tr><tr><td align="center" valign="middle" >B4</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td></tr><tr><td align="center" valign="middle" >C1</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td></tr><tr><td align="center" valign="middle" >C2</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td></tr><tr><td align="center" valign="middle" >C3</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >NEG</td></tr><tr><td align="center" valign="middle" >C4</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td></tr><tr><td align="center" valign="middle" >D2</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td></tr><tr><td align="center" valign="middle" >D3</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >POS</td></tr><tr><td align="center" valign="middle" >E3</td><td align="center" valign="middle" >Mosaic + leaf curl + yellow spots</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >POS</td></tr><tr><td align="center" valign="middle" >E4</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >NEG</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >NEG</td></tr><tr><td align="center" valign="middle" >E5</td><td align="center" valign="middle" >Mosaic + leaf curl</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >POS</td><td align="center" valign="middle" >POS</td></tr></tbody></table></table-wrap><p>NEG: Negative POS: Positive.</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Number of positive samples detected by PCR</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >PCR Positive</th><th align="center" valign="middle" >Fr&#233;quency n = 13</th><th align="center" valign="middle" >Percentage</th></tr></thead><tr><td align="center" valign="middle" >BY</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >23.1</td></tr><tr><td align="center" valign="middle" >OE</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >23.1</td></tr><tr><td align="center" valign="middle" >Okra-F318/R1004</td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >46.2</td></tr><tr><td align="center" valign="middle" >Okra-F1469/R2338</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >30.8</td></tr><tr><td align="center" valign="middle" >Mix infection*<sup> </sup></td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >23.1</td></tr></tbody></table></table-wrap><p>*: begemovirus + BYVMV + OELCuV.</p><p>The bogomovirus was also found associated with the Okra curl disease and CLCuGV (Cotton leaf curl Gezira virus) in Burkina Faso [<xref ref-type="bibr" rid="scirp.128580-ref14">14</xref>] .</p><p>In this study, the sequenced sample showed a very high similarity to CLCuGV. This suggests a permanent circulation in the fields where the samples were collected. It is also important to note that cotton is also well-grown in these fields during the rainy season.</p><p>Cotton leaf curl Gezira virus has been reported in several African countries, including Burkina Faso [<xref ref-type="bibr" rid="scirp.128580-ref23">23</xref>] , Niger [<xref ref-type="bibr" rid="scirp.128580-ref24">24</xref>] , C&#244;te d’Ivoire [<xref ref-type="bibr" rid="scirp.128580-ref25">25</xref>] , and Sudan [<xref ref-type="bibr" rid="scirp.128580-ref26">26</xref>] .</p></sec><sec id="s5"><title>5. Conclusion</title><p>This study is the first of its kind, with all activities from collection to sequencing analysis carried out in Mali. The okra leaf curl disease (OLCD) is present in the agroecological zone of Koulikoro, Mali. These molecular results highlight the complex causes of okra leaf curl disease in Mali and suggest future investigations.</p></sec><sec id="s6"><title>Acknowledgements</title><p>Thank you to Val&#233;rie Verdier of IRD—France and Professor Daouda Kon&#233; of UFHB in Abidjan—C&#244;te d’Ivoire for their support.</p></sec><sec id="s7"><title>Funding</title><p>This research didn’t receive grants from any funding agency in the public, commercial or not-for-profit sectors.</p></sec><sec id="s8"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest.</p></sec><sec id="s9"><title>Cite this paper</title><p>Keita, G.K., Kansaye, L., Doumbia, L., Keita, I., Sangare, M., Sinayoko, T., Macalou, B., Maiga, M.N., Sanogo, N.P. and Koita, O. (2023) Molecular Identification and Characterization of a Begomovirus Associated with Okra Enation Leaf Curl Disease in Mali. Advances in Bioscience and Biotechnology, 14, 429-438. https://doi.org/10.4236/abb.2023.1410029</p></sec></body><back><ref-list><title>References</title><ref id="scirp.128580-ref1"><label>1</label><mixed-citation publication-type="book" xlink:type="simple">Adelakun, O.E. and Oyelade, O.J. (2011) Potential Use of Okra Seed (Abelmoschus esculentus Moench) Flour for Food Fortification and Effects of Processing. In: Preedy, V.R., Watson, R.R. and Patel, V.B., Eds., Flour and Breads and Their Fortification in Health and Disease Prevention, Academic Press, Cambridge, 205-212.  
https://doi.org/10.1016/B978-0-12-380886-8.10019-4</mixed-citation></ref><ref id="scirp.128580-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Schippers, R.R. (2000) African Indigenous Vegetables: An Overview of the Cultivated Species.</mixed-citation></ref><ref id="scirp.128580-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Venkataravanappa, V., Kodandaram, M.H., Lakshminarayana Reddy, C.N., Shankarappa, K.S. and Krishna Reddy, M. (2017) Comparative Transmission of Bhendi Yellow Vein Mosaic Virus by Two Cryptic Species of the Whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae). 3 Biotech, 7, Article No. 331.  
https://doi.org/10.1007/s13205-017-0970-8</mixed-citation></ref><ref id="scirp.128580-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Hameed, S., Khalid, S., Ehsan-ul-Haq, S. and Hashrni, A.A. (1994) Cotton Leaf Curl Disease in Pakistan Caused by a Whitefly-Transmitted Geminivirus. Plant Disease, 78, 529. https://doi.org/10.1094/PD-78-0529H</mixed-citation></ref><ref id="scirp.128580-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Konaté, G., Barro, N., Fargette, D., Swanson, M.M. and Harrison, B.D. (1995) Occurrence of Whitefly-Transmitted Geminiviruses in Crops in Burkina Faso, and Their Serological Detection and Differentiation. Annals of Applied Biology, 126, 121-129. https://doi.org/10.1111/j.1744-7348.1995.tb05008.x</mixed-citation></ref><ref id="scirp.128580-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Vegetable Seeds (2023) Disease Management: Okra Disease Management.  
https://www.nunhems.com/in/en/disease-management/okra-disease-management.html</mixed-citation></ref><ref id="scirp.128580-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Venkataravanappa, V., Reddy, C.N.L., Jalali, S., Briddon, R.W. and Reddy, M.K. (2015) Molecular Identification and Biological Characterisation of a Begomovirus Associated with Okra Enation Leaf Curl Disease in India. European Journal of Plant Pathology, 141, 217-235. https://doi.org/10.1007/s10658-014-0463-0</mixed-citation></ref><ref id="scirp.128580-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Venkataravanappa, V., Reddy, C.N.L., Jalali, S. and Reddy, M.K. (2013) Molecular Characterization of a New Species of Begomovirus Associated with Yellow Vein Mosaic of Bhendi (Okra) in Bhubhaneswar, India. European Journal of Plant Pathology, 136, 811-822. https://doi.org/10.1007/s10658-013-0209-4</mixed-citation></ref><ref id="scirp.128580-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Fiallo-Olivé, E., et al. (2021) ICTV Virus Taxonomy Profile: Geminiviridae 2021. Journal of General Virology, 102, Article ID: 001696.  
https://doi.org/10.1099/jgv.0.001696</mixed-citation></ref><ref id="scirp.128580-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Morales, F.J. and Anderson, P.K. (2001) The Emergence and Dissemination of Whitefly-Transmitted Geminiviruses in Latin America. Archives of Virology, 146, 415-441. https://doi.org/10.1007/s007050170153</mixed-citation></ref><ref id="scirp.128580-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Varma, A. and Malathi, V.G. (2003) Emerging Geminivirus Problems: A Serious Threat to Crop Production. Annals of Applied Biology, 142, 145-164.  
https://doi.org/10.1111/j.1744-7348.2003.tb00240.x</mixed-citation></ref><ref id="scirp.128580-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Venkataravanappa, V., Lakshminarayana Reddy, C.N., Jalali, S. and Krishna Reddy, M. (2012) Molecular Characterization of Distinct Bipartite Begomovirus Infecting bhendi (Abelmoschus esculentus L.) in India. Virus Genes, 44, 522-535.  
https://doi.org/10.1007/s11262-012-0732-y</mixed-citation></ref><ref id="scirp.128580-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Inoue-Nagata, A.K., Lima, M.F. and Gilbertson, R.L. (2016) A Review of Geminivirus Diseases in Vegetables and Other Crops in Brazil: Current Status and Approaches for Management. Horticultura Brasileira, 34, 8-18.  
https://doi.org/10.1590/S0102-053620160000100002</mixed-citation></ref><ref id="scirp.128580-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Tiendrébéogo, F., et al. (2010) Impact of Okra Leaf Curl Disease on Morphology and Yield of Okra. Crop Protection, 29, 712-716.  
https://doi.org/10.1016/j.cropro.2010.02.007</mixed-citation></ref><ref id="scirp.128580-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Senevirathna, H.M.S.I., Wasala, S.K., Senanayake, D.M.J.B., Weerasekara, D., Wickamasinghe, H.A.M. and Deepal, P.K.G.A. (2016) Characterization and Detection of Yellow Vein Disease of Okra (Abelmoschus esculentus (L.) Moench) in Sri Lanka. Tropical Agricultural Research, 27, 360-369.  
https://doi.org/10.4038/tar.v27i4.8213</mixed-citation></ref><ref id="scirp.128580-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Mubeen, M., et al. (2021) Yellow Vein Mosaic Disease in Okra (Abelmoschus esculentus L.): An Overview on Causal Agent, Vector and Management. Phyton, 90, 1573-1587. https://doi.org/10.32604/phyton.2021.016664</mixed-citation></ref><ref id="scirp.128580-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Yadav, Y., et al. (2018) Enation Leaf Curl Virus (ELCV): A Real Threat in Major Okra Production Belts of India: A Review. Journal of Pharmacognosy and Phytochemistry, 7, 3795-3802.</mixed-citation></ref><ref id="scirp.128580-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Asare-Bediako, E., Addo-Quaye, A. and Bi-Kusi, A. (2023) Comparative Efficacy of Plant Extracts in Managing Whitefly (Bemisia tabaci gen) and Leaf Curl Disease in Okra (Abelmoschus esculentus L). American Journal of Agricultural Science and Technology, 2, 31-41.</mixed-citation></ref><ref id="scirp.128580-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Kon, T., Rojas, M.R., Abdourhamane, I.K. and Gilbertson, R.L. (2009) Roles and Interactions of Begomoviruses and Satellite DNAs Associated with Okra Leaf Curl Disease in Mali, West Africa. Journal of General Virology, 90, 1001-1013.  
https://doi.org/10.1099/vir.0.008102-0</mixed-citation></ref><ref id="scirp.128580-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Naresh, M., et al. (2019) Occurrence and Variability of Begomoviruses Associated with Bhendi Yellow Vein Mosaic and Okra Enation Leaf Curl Diseases in South-Western India. VirusDisease, 30, 511-525.  
https://doi.org/10.1007/s13337-019-00551-4</mixed-citation></ref><ref id="scirp.128580-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Tiendrébéogo, F. (2014) Caractérisation et aspects épidémiologiques des Begomovirus infectant les plantes mara&amp;#238;chères et le manioc au Burkina Faso. Master’s Thesis, Université de Ouagadougou, Ouagadougou.</mixed-citation></ref><ref id="scirp.128580-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Tamura, K. and Nei, M. (1993) Estimation of the Number of Nucleotide Substitutions in the Control Region of Mitochondrial DNA in Humans and Chimpanzees. Molecular Biology and Evolution, 10, 512-526.</mixed-citation></ref><ref id="scirp.128580-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Tiendrébéogo, F., et al. (2010) Molecular Diversity of Cotton Leaf Curl Gezira Virus Isolates and Their Satellite DNAs Associated with Okra Leaf Curl Disease in Burkina Faso. Virology Journal, 7, Article No. 48.  
https://doi.org/10.1186/1743-422X-7-48</mixed-citation></ref><ref id="scirp.128580-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Shih, S.L., Kumar, S., Tsai, W.S., Lee, L.M. and Green, S.K. (2009) Complete Nucleotide Sequences of Okra Isolates of Cotton Leaf Curl Gezira Virus and Their Associated DNA-β from Niger. Archives of Virology, 154, 369-372.  
https://doi.org/10.1007/s00705-008-0304-6</mixed-citation></ref><ref id="scirp.128580-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Sék, K., et al. (2016) First Reports of Cotton Leaf Curl Gezira Virus and Okra Yellow Crinkle Virus Associated with Okra Leaf Curl Disease in Cote d’Ivoire. New Disease Reports, 34, 8. https://doi.org/10.5197/j.2044-0588.2016.034.008</mixed-citation></ref><ref id="scirp.128580-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Idris, A.M. and Brown, J.K. (2002) Molecular Analysis of Cotton Leaf Curl Virus-Sudan Reveals an Evolutionary History of Recombination. Virus Genes, 24, 249-256. https://doi.org/10.1023/A:1015380600089</mixed-citation></ref></ref-list></back></article>