<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJMB</journal-id><journal-title-group><journal-title>American Journal of Molecular Biology</journal-title></journal-title-group><issn pub-type="epub">2161-6620</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajmb.2023.134019</article-id><article-id pub-id-type="publisher-id">AJMB-128469</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Detection of Human Papillomavirus DNA and E6/E7 mRNA from HPV Genotypes 16, 18, 31 and 33 in Histologically Confirmed Cases of Cervical Cancer and Precancerous Lesions in Burkina Faso
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Théodora</surname><given-names>Mahoukèdè Zohoncon</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shoukrat</surname><given-names>Ohuwa Toyin Bello</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Prosper</surname><given-names>Bado</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Rogomenoma</surname><given-names>Alice Ouédraogo</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Estelle</surname><given-names>Ouédraogo</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ina</surname><given-names>Marie Angèle Traoré</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Abdoul</surname><given-names>Karim Ouattara</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Florencia</surname><given-names>Wenkunni Djigma</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Albert</surname><given-names>Théophane Yonli</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Assita</surname><given-names>Sanou-Lamien</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Olga</surname><given-names>Mélanie Lompo</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jacques</surname><given-names>Simpore</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib></contrib-group><aff id="aff5"><addr-line>Faculté des Sciences de la Santé, Université Saint Thomas d’Aquin (USTA), Ouagadougou, Burkina Faso</addr-line></aff><aff id="aff3"><addr-line>Centre Hospitalo-Universitaire Yalgado Ouedraogo, Ouagadougou, Burkina Faso</addr-line></aff><aff id="aff2"><addr-line>Centre de Recherche Biomoléculaire Pietro Annigoni (CERBA), Ouagadougou, Burkina Faso</addr-line></aff><aff id="aff4"><addr-line>Pathological Anatomy and Cytology Laboratory, Université Joseph Ki-Zerbo, Ouagadougou, Burkina Faso</addr-line></aff><aff id="aff1"><addr-line>Laboratoire de Biologie Moléculaire et de Génétique (LABIOGENE), Université Joseph KI-ZERBO, Ouagadougou, Burkina Faso</addr-line></aff><pub-date pub-type="epub"><day>31</day><month>08</month><year>2023</year></pub-date><volume>13</volume><issue>04</issue><fpage>276</fpage><lpage>290</lpage><history><date date-type="received"><day>17,</day>	<month>September</month>	<year>2023</year></date><date date-type="rev-recd"><day>21,</day>	<month>October</month>	<year>2023</year>	</date><date date-type="accepted"><day>24,</day>	<month>October</month>	<year>2023</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  <b>Introduction:</b> Cervical cancer, caused by persistent high-risk human papillomavirus (HPV) infection, remains a global public health problem. The cellular transformation and maintenance of the malignant phenotype of these HPVs are attributed to the viral oncoproteins E6 and E7. 
  <b>Objective:</b> This study aims to detect the presence of human papillomavirus DNA and E6/E7 oncoprotein mRNA of HPV genotypes 16, 18, 31 and 33 in cases of cervical cancer and precancerous lesions, histologically confirmed in Burkina Faso. 
  <b>Methods:</b> This descriptive cross-sectional study focused on cases of cervical cancer and high-grade intraepithelial neoplasia (CIN) and was conducted from June to December 2022. One hundred (100) samples of fixed and paraffin-embedded tissues were collected from the pathological anatomy and cytology laboratories of hospitals in the capital of Burkina Faso. High-risk human papillomavirus (HR-HPV) DNA was detected using multiplex real-time PCR, while the presence of E6 and E7 mRNA in cervical cancer and high-grade CIN samples was determined using real-time Reverse Transcriptase-PCR (RT-PCR) with TaqMan probes. 
  <b>Results:</b> The mean age of women diagnosed with cervical cancer and high-grade CIN was 50.81 &#177; 13.65 years, ranging from 22 to 82 years. Cervical cancer and high-grade CIN were positive for at least one high-risk human papillomavirus (HR-HPV) in 80% of cases. The most prevalent genotypes observed were HPV16, 18, 31, and 33, collectively accounting for 70.08% of cases. Of the 89 samples that tested positive for HR-HPV genotypes 16, 18, 31, and 33, 88 (98.88%; 95% CI: [94.58 - 99.94]) were also positive for the presence of mRNA encoding the E6 and E7 oncoproteins of HPV16, 18, 31, and 33. 
  <b>Conclusion:</b> In the presence of HPV DNA, testing for E6 and E7 oncoprotein mRNA could serve as a promising biomarker and valuable tool for improved assessment of the progression to cervical cancer.
 
</p></abstract><kwd-group><kwd>HPV</kwd><kwd> E6/E7</kwd><kwd> Cervical Cancer</kwd><kwd> Precancerous Lesions</kwd><kwd> Burkina Faso</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The persistence of an infection with at least one high-risk HPV is the primary cause of most cervical cancers [<xref ref-type="bibr" rid="scirp.128469-ref7">7</xref>] . Cervical cancer poses a significant public health challenge, particularly in developing countries. In 2018, the worldwide incidence of cervical cancer was estimated at 570,000 cases, resulting in 311,000 deaths [<xref ref-type="bibr" rid="scirp.128469-ref8">8</xref>] . Alarmingly, 85% of these cases and 87% of the deaths occurred in low-income countries [<xref ref-type="bibr" rid="scirp.128469-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.128469-ref10">10</xref>] . Globally, cervical cancer ranked as the fourth most common cancer among women and a leading cause of cancer-related deaths [<xref ref-type="bibr" rid="scirp.128469-ref8">8</xref>] .</p><p>High-risk human papillomavirus (HR-HPV) viral DNA has been detected in biopsies of cervical cancer and precursor lesions [<xref ref-type="bibr" rid="scirp.128469-ref11">11</xref>] . The cellular transformation and maintenance of the malignant phenotype in these cases are attributed to the viral proteins E6 and E7 [<xref ref-type="bibr" rid="scirp.128469-ref12">12</xref>] . These proteins interfere with various cellular processes, including cell cycle regulation, apoptosis control, DNA repair, mitotic spindle formation, intercellular adhesion, and mitogenic signal transduction pathways. Their disruptive effects contribute to the development and progression of malignancies [<xref ref-type="bibr" rid="scirp.128469-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.128469-ref14">14</xref>] . The E6 protein binds to the p53 protein, leading to its degradation and causing dysfunction in the apoptosis process. Meanwhile, the pRB protein plays a crucial role in cell proliferation [<xref ref-type="bibr" rid="scirp.128469-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.128469-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.128469-ref17">17</xref>] .</p><p>Research confirms a strong association between the development of cervical cancer following HR-HPV infection and the expression of E6/E7 oncoproteins [<xref ref-type="bibr" rid="scirp.128469-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.128469-ref19">19</xref>] .</p><p>A link between the expression of E6/E7 oncoproteins and the progression of HR-HPV infection to cervical cancer has been described. Additionally, research indicates that these oncoproteins can serve as diagnostic markers to assess the likelihood and risks of progressing to the invasive cancer stage.</p><p>In this pioneering study on HPV oncoproteins conducted in Burkina Faso, our primary objective was to detect the presence of HPV DNA and E6/E7 oncoprotein mRNA from HPV genotypes 16, 18, 31, and 33 in cases of cervical cancer and precancerous lesions, which were histologically confirmed.</p></sec><sec id="s2"><title>2. Methods</title><sec id="s2_1"><title>2.1. Study Framework</title><p>The study was conducted in Ouagadougou, the capital of Burkina Faso. Fixed and paraffin-embedded tissues obtained from cervical biopsies, conization procedures, or hysterectomies, all dating back less than a year, were collected from the pathological anatomy and cytology laboratories of Ouagadougou’s hospitals, including the largest reference hospital in Burkina Faso, Centre Hospitalier Universitaire Yalgado Ou&#233;draogo. Subsequently, the specimens were transported to the Centre de Recherche Biomol&#233;culaire Pietro Annigoni (CERBA). Here, molecular analyses were performed at the “Laboratoire National de R&#233;f&#233;rence pour le HPV” (LNR-HPV).</p></sec><sec id="s2_2"><title>2.2. Study Type and Population</title><p>This was a descriptive cross-sectional study conducted between June and December 2022. It comprised a collection of one hundred (100) tissue samples, which were fixed and embedded in paraffin. These samples were obtained from cases of cervical cancer and high-grade intraepithelial neoplasia.</p></sec><sec id="s2_3"><title>2.3. Tissue Sample Collection</title><p>Specific codes corresponding to confirmed cases of cervical cancer and high-grade cervical intraepithelial neoplasia were identified by utilizing the hospital anatomy and cytology laboratory registers. These codes were then used to locate the corresponding tissue blocks. Sociodemographic information was also documented. Subsequently, the solid paraffin blocks, containing either biopsy, conization, or hysterectomy specimens, were processed by cutting them into five sections, each no thicker than 20 &#181;m, using a microtome.</p></sec><sec id="s2_4"><title>2.4. Inclusion and Exclusion Criteria</title><p>All fixed and paraffin-embedded tissue samples with a histological diagnosis confirming cervical cancer or high-grade cervical intraepithelial neoplasia (CIN) were included. Samples with a normal histological diagnosis were excluded from this study.</p></sec><sec id="s2_5"><title>2.5. DNA/RNA Extraction</title><p>DNA and RNA extraction was performed using the “R-Biopharm RIDA<sup>&#174;</sup> Xtract” commercial kit, following the manufacturer’s protocols. The process began with the deparaffinization of archived tissue sections using xylene and alcohol. Initially, 1 mL of xylene was added to the tube containing the tissues, followed by vortexing, a 10-minute incubation at 50˚C, and centrifugation at 14,000 rpm for 2 minutes. This deparaffinization step was repeated. Subsequently, 1 mL of absolute ethanol was added, followed by vortexing and centrifugation at 14,000 rpm for 2 minutes. This ethanol wash step was also repeated, and finally, the sample was air-dried for 15 minutes.</p><p>The extraction of nucleic acids followed a series of principles and steps, including cell lysis, DNA precipitation (binding of nucleic acids to the column), washing, elution of nucleic acids, and subsequent quantification of the extracts using a Nanodrop. The resulting extracts were stored at - 80˚C for further manipulation.</p></sec><sec id="s2_6"><title>2.6. Detection of HR-HPV</title><p>The detection of HR-HPV was carried out using multiplex real-time PCR, employing the HPV Genotypes 14 Real-TMQuant kit from SACACE Biotechnologies<sup>&#174;</sup> in Italy. This kit allows for the identification of 14 high-risk HPV genotypes (HPV-16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68) by targeting the L1 region of the HR-HPV genome.</p><p>For each sample, four PCR tubes were utilized. Each tube contained primers for the target regions of three or four types of HR-HPV and the human beta-globin gene, which served as an internal control to monitor the presence of cellular material in the sample. Specifically, for each sample, we had the following four tubes: PCR-mix-1 (16, 18, 31, IC); PCR-mix-1 (39, 45, 59, IC); PCR-mix-1 (33, 35, 56, 68); PCR-mix-1 (51, 52, 58, 66).</p><p>The pre-PCR steps involved the preparation of the Mix solution (PCR-buffer-FRT + Hot Start DNA Polymerase) and the Reaction Mix solution (Mix solution + each PCR-mix-1). For each sample, 15 &#181;L of the Reaction Mix solution was added to the four tubes, followed by the addition of 10 &#181;L of the DNA extract. This resulted in a total reaction volume of 25 &#181;L for each PCR.</p><p>These PCR reaction mixtures, contained in sterile 0.2 mL microtubes, were introduced onto the SaCycler-96 Real-Time PCR v.7.3 plate (Sacace Biotechnology, Italy) for amplification. The amplification program consisted of one cycle of 95˚C for 15 minutes, followed by five cycles of 95˚C for 5 sec, 60˚C for 20 sec, and 72˚C for 15 sec, and finally 40 cycles of 95˚C for 5 sec, 60˚C for 30 sec, and 72˚C for 15 sec.</p><p>The results were interpreted using Microsoft Excel software and a program named HPV Genotypes 14 Real-TM.xls (SACACE Biotechnologies<sup>&#174;</sup>, Italy), following the manufacturer’s protocol.</p></sec><sec id="s2_7"><title>2.7. Detection of HR-HPV Oncoprotein E6 and E7 Transcripts</title><p>The detection of E6 and E7 oncoprotein mRNA was conducted in samples that tested positive for HPV DNA. The real-time reverse transcriptase-PCR (RT-PCR) technique, utilizing TaqMan probes, was used to detect the presence of E6/E7 mRNA specifically from HPV genotypes 16, 18, 31, and 33 in cervical cancer and high-grade CIN samples.</p><sec id="s2_7_1"><title>2.7.1. Synthesis of cDNA</title><p>After mRNA extraction, cDNA synthesis was performed using the M-MLV Reverse Transcriptase Kits from Invitrogen and Random hexamers (Invitrogen), following the manufacturer’s protocol. In the initial Mix, comprising 1 μL of dNTP mix (10 mM of dATP, dGTP, dCTP, and dTTP at neutral pH), 0.1 μL of random hexamers, and 5 μL of distilled water, we added 10 μL of RNA. The reaction mixture was incubated at 65˚C for 5 minutes and then rapidly cooled on ice. A second Mix was prepared, consisting of 4 μL of 5&#215; FirstStrand Buffer, 2 μL of 0.1 M dithiothreitol (DTT), and 1 μL of M-MLV reverse transcriptase (RT). The cDNA synthesis proceeded with the following amplification program: 25˚C for 10 minutes, 37˚C for 50 minutes, and 70˚C for 15 minutes.</p></sec><sec id="s2_7_2"><title>2.7.2. Amplification by Real-Time PCR</title><p>The obtained cDNA was diluted 1/1000 before being utilized for real-time PCR. Real-time PCR for HPV 16/17/31/33 oncoproteins E6/E7 was performed in a total reaction volume of 20 μL, consisting of 10 μL of TaqMan<sup>&#174;</sup> Universal Master Mix II no UNG, 2X, 0.5 μL of forward and reverse primers, 0.5 μL of probes, 5 μL of cDNA (ranging from 1 to 100 ng), and 4 μL of distilled water. During the manipulation, both a negative control and a positive control were included. The amplification program included an initial denaturation step at 95˚C for 10 minutes, followed by 45 cycles of denaturation at 95˚C for 15 seconds and annealing/extension at 60˚C for 60 seconds. <xref ref-type="table" rid="table1">Table 1</xref> provides the sequences of primers and probes used for real-time PCR.</p></sec></sec><sec id="s2_8"><title>2.8. Data Analysis</title><p>Our data were analyzed using Excel, SPSS 20.0, and Epi Info 7.2.2.6 software. We set the confidence interval at 95%, and for comparisons, we employed the Chi-square test. Statistical significance was defined at P &lt; 0.05.</p></sec><sec id="s2_9"><title>2.9. Ethical Considerations</title><p>This study received approval from the institutional ethics committee of “Hospital Saint Camille in Ouagadougou”, Burkina Faso through its deliberation No. 2022-05-012 of 05/20/2022. Confidentiality and anonymity were strictly respected.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Sequences of primers and probes used for real-time PCR</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer or probe</th><th align="center" valign="middle" >Sequence (5’ to 3’)</th><th align="center" valign="middle" >Location</th><th align="center" valign="middle" >Product size (bp)</th></tr></thead><tr><td align="center" valign="middle" >HPV 16 E6-F</td><td align="center" valign="middle" >GCACCAAAAGAGAACTGCAATGTT</td><td align="center" valign="middle" >85 - 108</td><td align="center" valign="middle" >152</td></tr><tr><td align="center" valign="middle" >HPV 16 E6-R</td><td align="center" valign="middle" >AGTCATATACCTCACGTCGCAGTA</td><td align="center" valign="middle" >197 - 236</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 16 E6-P</td><td align="center" valign="middle" >GGACCCACAGGAGCGACCCAGAAAGTTA</td><td align="center" valign="middle" >112 - 139</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 16 E7-F</td><td align="center" valign="middle" >CAAGTGTGACTCTACGCTTCGG</td><td align="center" valign="middle" >738 - 759</td><td align="center" valign="middle" >81</td></tr><tr><td align="center" valign="middle" >HPV 16 E7-R</td><td align="center" valign="middle" >GTGGCCCATTAACAGGTCTTCCAA</td><td align="center" valign="middle" >796 - 818</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 16 E7-P</td><td align="center" valign="middle" >TGCGTACAAAGCACACACGTAGACATTCGT</td><td align="center" valign="middle" >763 - 792</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 18 E6-F</td><td align="center" valign="middle" >CTATAGAGGCCAGTGCCATTCG</td><td align="center" valign="middle" >503 - 524</td><td align="center" valign="middle" >79</td></tr><tr><td align="center" valign="middle" >HPV 18 E6-R</td><td align="center" valign="middle" >TTATACTTGTGTTTCTCTGCGTCG</td><td align="center" valign="middle" >558 - 581</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 18 E6-P</td><td align="center" valign="middle" >CAACCGAGCACGACAGGAACGACTCCA</td><td align="center" valign="middle" >530 - 556</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 18 E7-F</td><td align="center" valign="middle" >TAATCATCAACATTTACCAGCCCG</td><td align="center" valign="middle" >721 - 744</td><td align="center" valign="middle" >113</td></tr><tr><td align="center" valign="middle" >HPV 18 E7-R</td><td align="center" valign="middle" >CGTCTGCTGAGCTTTCTACTACTA</td><td align="center" valign="middle" >810 - 833</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 18 E7-P</td><td align="center" valign="middle" >CGAGCCGAACCACAACGTCACACAATGTT</td><td align="center" valign="middle" >745 - 774</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 31 E6-F</td><td align="center" valign="middle" >AAGACCGTTGTGTCCAGAAG</td><td align="center" valign="middle" >428 - 447</td><td align="center" valign="middle" >106</td></tr><tr><td align="center" valign="middle" >HPV 31 E6-R</td><td align="center" valign="middle" >GTCTTCTCCAACATGCTATGC</td><td align="center" valign="middle" >511 - 534</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 31 E6-P</td><td align="center" valign="middle" >CGTCCTGTCCACCTTCCTCCTATG</td><td align="center" valign="middle" >488 - 511</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 31 E7-F</td><td align="center" valign="middle" >TGTGTTAGATTTGCAACCTGAG</td><td align="center" valign="middle" >592 - 613</td><td align="center" valign="middle" >78</td></tr><tr><td align="center" valign="middle" >HPV 31 E7-R</td><td align="center" valign="middle" >ACATCCTCCTCATCTGAGCT</td><td align="center" valign="middle" >669 - 649</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 31 E7-P</td><td align="center" valign="middle" >CAACTGACCTCCACTGTTATGAGCAAT</td><td align="center" valign="middle" >615 - 641</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 33 E6-F</td><td align="center" valign="middle" >TGCACGACTATGTTTCAAGAC</td><td align="center" valign="middle" >100 - 120</td><td align="center" valign="middle" >132</td></tr><tr><td align="center" valign="middle" >HPV 33 E6-R</td><td align="center" valign="middle" >CTCAGATCGTTGCAAAGGTTT</td><td align="center" valign="middle" >211 - 231</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 33 E6-P</td><td align="center" valign="middle" >ATTCCACGCACTGTAGTTCAATGTTGT</td><td align="center" valign="middle" >179 - 205</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 33 E7-F</td><td align="center" valign="middle" >TTGTAACCTGTTGTCACACTTG</td><td align="center" valign="middle" >733 - 754</td><td align="center" valign="middle" >88</td></tr><tr><td align="center" valign="middle" >HPV 33 E7-R</td><td align="center" valign="middle" >AGTAGTTGCTGTATGGTTCGTA</td><td align="center" valign="middle" >799 - 820</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV 33 E7-P</td><td align="center" valign="middle" >ACTTGCTGTACTGTTGACACATAAACGA</td><td align="center" valign="middle" >767 - 794</td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><p>F: forward; R: reverse; P: TaqMan probe.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Sociodemographic Characteristics of the Study Population</title><p>This study focused on a total of 100 archived tissue samples obtained from the cervix. These tissue samples were fixed and embedded in paraffin. Among the samples, the pathological diagnosis revealed 8 cases of CIN2 (Cervical Intraepithelial Neoplasia Grade 2), 8 cases of CIN3 (Cervical Intraepithelial Neoplasia Grade 3), and 84 cases of invasive cervical cancers.</p><p>The age of the patients included in this study ranged from 22 to 82 years, with a mean age of 50.81 &#177; 13.65 years. Most of these patients, accounting for 70% of the sample, were identified as housewives and 41% resided in rural areas. Regarding marital status, 61% of the cases were brides. In terms of educational background, 80% of the participants had an educational level equal to or lower than primary school. Furthermore, 44% of the cases were classified as large multiparous (having had five or more deliveries), followed by multiparous individuals (having had three or four deliveries) in 30% of cases, with delivery extremes ranging from 2 to 10. Approximately 62% of the patients reported having their first sexual intercourse before the age of 18, with 20% of them experiencing their initial sexual encounter during their pediatric years (between 13 and 15 years of age). The mean age at first sexual intercourse was 16.85 &#177; 1.69 years, ranging from 13 to 22 years. Surprisingly, 72% of the patients reported never using condoms during sexual intercourse, and they also did not use oral contraceptives. Among the 84 patients diagnosed with invasive cervical cancer, two of them were under 30 years old. <xref ref-type="table" rid="table2">Table 2</xref> presents the distribution of the age group according to the histological profiles of cervical cancer.</p></sec><sec id="s3_2"><title>3.2. Genotyping of HR-HPV and Detection of the Presence of E6 and E7 mRNA</title><p>Among the 100 cases of cervical cancer and high-grade CIN (Cervical Intraepithelial Neoplasia), 80 samples tested positive for at least one of the 14 sought HR-HPV (High-Risk Human Papillomavirus) genotypes. This corresponds to a detection rate of 80% when considering viral DNA detection. The cumulative count of detected genotypes reached 127, with the predominant genotypes being HPV16, 18, 31, and 33, collectively representing a cumulative frequency of 70.08% (89 out of 127). The remaining genotypes (35, 39, 45, 51, 52, 56, 58, 59, 66, and 68) constituted 29.92% (38 out of 127) of the total.</p><p>The investigation for the presence of E6/E7 mRNA focused on the four most prevalent genotypes, namely HPV16, 18, 31, and 33. However, the cumulative frequency of these seven high-risk genotypes (HPV16, 18, 31, 33, 45, 52, 58) accounted for 80.31% of the genotypes associated with precancerous and cancerous lesions within our study cohort. Therefore, by considering these seven high-risk genotypes covered by the nonavalent vaccine, our findings suggest that the vaccine could potentially prevent 80.31% of precancerous and cancerous lesions, based on the data derived from our study. <xref ref-type="fig" rid="fig1">Figure 1</xref> presents the distribution of the 14 HR-HPV genotypes in the study population.</p><p>The positivity rate of E6/E7 oncogene mRNA expression was compared to that of HPV DNA. Among the 89 samples that tested positive for HR-HPV 16, 18, 31, and 33 using the DNA-HPV technique, 88 (98.88%; 95% CI: [94.58 - 99.94]) were also found to be positive for the presence of mRNA for the E6 and E7 oncoproteins of HPV16, 18, 31, and 33. For these four most frequent HR-HPV genotypes, a remarkable 100% concordance was observed between detection via the HPV DNA technique and the detection of the presence of E6/E7 oncogene mRNA in cases of histologically confirmed invasive cervical cancer. Specifically, there were 74 cases positive for both HPV 16, 18, 31, and 33 DNA and HPV 16, 18 E6 and E7 mRNA.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Distribution of the age group according to histological profiles of cervical cancer</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Age group (years)</th><th align="center" valign="middle"  colspan="3"  >Histological profiles</th><th align="center" valign="middle"  rowspan="2"  >Total</th><th align="center" valign="middle"  rowspan="2"  >P-value</th></tr></thead><tr><td align="center" valign="middle" >CIN2 n (%)</td><td align="center" valign="middle" >CIN3 n (%)</td><td align="center" valign="middle" >Invasive cancer n(%)</td></tr><tr><td align="center" valign="middle" >&lt;30</td><td align="center" valign="middle" >02 (50)</td><td align="center" valign="middle" >00</td><td align="center" valign="middle" >02 (50)</td><td align="center" valign="middle" >04 (100)</td><td align="center" valign="middle" >0.223</td></tr><tr><td align="center" valign="middle" >30 - 55</td><td align="center" valign="middle" >05 (9.1)</td><td align="center" valign="middle" >07 (11.3)</td><td align="center" valign="middle" >50 (81)</td><td align="center" valign="middle" >62 (100)</td><td align="center" valign="middle" >&lt;0.0001</td></tr><tr><td align="center" valign="middle" >&gt;55</td><td align="center" valign="middle" >01 (3.3)</td><td align="center" valign="middle" >01 (3.3)</td><td align="center" valign="middle" >32 (94)</td><td align="center" valign="middle" >34 (100)</td><td align="center" valign="middle" >&lt;0.0001</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >8 (100)</td><td align="center" valign="middle" >8 (100)</td><td align="center" valign="middle" >84 (100)</td><td align="center" valign="middle" >100 (100)</td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><p>Furthermore, in the case of CIN2 (Cervical Intraepithelial Neoplasia Grade 2), 87.5% (7 out of 8) exhibited the expression of E6 and E7 mRNA transcripts. In CIN3 cases, a complete 100% expression of E6 and E7 mRNA was observed. When considering high-grade precancerous and cancerous lesions of the cervix, there was no statistically significant difference between the presence of HPV-DNA and the detection of HPV E6 and E7 mRNA for genotypes 16, 18, 31, and 33 (p = 0.999). <xref ref-type="table" rid="table3">Table 3</xref> shows the frequencies of HPV-DNA and E6/E7 mRNA according to the frequencies of HR-HPV 16, 18, 31, and 33 genotypes and the histological profile of the cervical lesions.</p></sec><sec id="s3_3"><title>3.3. HR-HPV Genotypes According to the Grade of Cervical Lesions</title><p>The most prevalent HR-HPV genotypes in cases of invasive cervical cancer were 16, 18, and 33. Notably, there was an absence of E6 and E7 mRNA expression from HPV 18 in CIN 2 and 3. <xref ref-type="table" rid="table4">Table 4</xref> presents the distribution of E6/E7 mRNA from HR-HPV16/18/31/33 according to the grade of cervical lesions.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Cervical cancer is among the malignancies that can be prevented through understanding the causative agent, namely HPV, and by employing available prevention and screening methods. Nevertheless, it remains evident that cervical</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Presence of HPV-DNA and E6/E7 mRNA depending on the frequencies of HR-HPV 16, 18, 31 and 33 genotypes and the histological profile of cervical lesions</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >HPV-DNA n (%)</th><th align="center" valign="middle" >E6/E7 mRNA n (%)</th><th align="center" valign="middle" >P-value</th></tr></thead><tr><td align="center" valign="middle" >HR-HPV genotypes</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV16</td><td align="center" valign="middle" >31 (34.83)</td><td align="center" valign="middle" >31 (35.23)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV18</td><td align="center" valign="middle" >30 (33.71)</td><td align="center" valign="middle" >30 (34.09)</td><td align="center" valign="middle" >0.999</td></tr><tr><td align="center" valign="middle" >HPV31</td><td align="center" valign="middle" >09 (10.11)</td><td align="center" valign="middle" >09 (10.23)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HPV33</td><td align="center" valign="middle" >19 (21.35)</td><td align="center" valign="middle" >18 (20.45)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >89 (100)</td><td align="center" valign="middle" >88 (100)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Histological stage</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >CIN2</td><td align="center" valign="middle" >08 (08.99)</td><td align="center" valign="middle" >07 (07.95)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >CIN3</td><td align="center" valign="middle" >07 (07.86)</td><td align="center" valign="middle" >07 (07.95)</td><td align="center" valign="middle" >0.970</td></tr><tr><td align="center" valign="middle" >Cancer</td><td align="center" valign="middle" >74 (83.15)</td><td align="center" valign="middle" >74 (84.10)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >89 (100)</td><td align="center" valign="middle" >88 (100)</td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Distribution of E6/E7 mRNA from HR-HPV16/18/31/33 depending on the histological profile</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >E6/E7 mRNA</th><th align="center" valign="middle"  colspan="3"  >Grade of cervical lesions</th><th align="center" valign="middle" ></th></tr></thead><tr><td align="center" valign="middle" >CIN2 n (%)</td><td align="center" valign="middle" >CIN3 n (%)</td><td align="center" valign="middle" >Cancer n (%)</td><td align="center" valign="middle" >Total</td></tr><tr><td align="center" valign="middle" >HPV16</td><td align="center" valign="middle" >04 (57.14)</td><td align="center" valign="middle" >04 (57.14)</td><td align="center" valign="middle" >23 (31.08)</td><td align="center" valign="middle" >31</td></tr><tr><td align="center" valign="middle" >HPV18</td><td align="center" valign="middle" >00 (00)</td><td align="center" valign="middle" >00 (00)</td><td align="center" valign="middle" >30 (40.54)</td><td align="center" valign="middle" >30</td></tr><tr><td align="center" valign="middle" >HPV31</td><td align="center" valign="middle" >01 (14.29)</td><td align="center" valign="middle" >01 (14.29)</td><td align="center" valign="middle" >07 (9.46)</td><td align="center" valign="middle" >09</td></tr><tr><td align="center" valign="middle" >HPV33</td><td align="center" valign="middle" >02 (28.57)</td><td align="center" valign="middle" >02 (28.57)</td><td align="center" valign="middle" >14 (18.92)</td><td align="center" valign="middle" >18</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >07 (100)</td><td align="center" valign="middle" >07 (100)</td><td align="center" valign="middle" >74 (100)</td><td align="center" valign="middle" >88</td></tr></tbody></table></table-wrap><p>cancer represents a significant global public health challenge, despite the high likelihood of viral clearance in cases of infection. Indeed, persistent HR-HPV infection stands as the primary risk factor for the development of cervical intraepithelial lesions and eventual cervical cancer [<xref ref-type="bibr" rid="scirp.128469-ref20">20</xref>] . While there is evidence of the presence of HPV DNA, the crucial question remains: will the infection be transient or persistent, potentially leading to cervical cancer? Several authors have pointed to a strong association between cervical carcinogenesis and HPV infection, particularly when there is transcription of HR HPV oncogenes E6 and E7, leading to an increase in their mRNA and protein levels. Therefore, the detection of HR HPV E6 and E7 mRNAs holds promise as a valuable biomarker for assessing their persistence and oncogenic activity. This, in turn, could significantly enhance our ability to evaluate the progression to high-grade cervical intraepithelial lesions and may have a substantial impact on the patient monitoring protocol [<xref ref-type="bibr" rid="scirp.128469-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.128469-ref21">21</xref>] . As per Derbie et al., emerging evidence suggests that HPV E6/E7 mRNA testing may serve as a valuable tool in comparison to cytology and HPV DNA testing for the early detection of precancerous dysplasia [<xref ref-type="bibr" rid="scirp.128469-ref21">21</xref>] . In addition, Nikolic et al. reported that the percentage of expression of HR-HPV oncoproteins E6 and E7 would be proportional to the degree of severity of the cervical lesion. [<xref ref-type="bibr" rid="scirp.128469-ref20">20</xref>] .</p><p>In our study, we detected 14 HR-HPV DNA in women diagnosed with CIN 2, CIN 3, and invasive cervical cancer. We specifically investigated the most prevalent genotypes, namely HPV 16, 18, 31, and 33, for the expression of E6 and E7 mRNA transcripts. Notably, the average age of women with cervical lesions in our study was 50.81 &#177; 13.65 years. This finding contrasts with the results reported by Ou&#233;draogo et al. in cases of high-grade CIN in Burkina Faso, where the average age was reported as 41.5 &#177; 9.8 years [<xref ref-type="bibr" rid="scirp.128469-ref22">22</xref>] ; Zohoncon et al., (46.32 &#177; 12.76 years) in cases of invasive cervical cancer in Burkina Faso [<xref ref-type="bibr" rid="scirp.128469-ref23">23</xref>] and Zohoncon et al., (40.05 &#177; 13.99) in Benin in cases of high-grade CIN and invasive cervical cancer [<xref ref-type="bibr" rid="scirp.128469-ref24">24</xref>] . These differences may be explained by sample sizes, types and grades of cervical lesions, and regions.</p><p>In our study, HR-HPV DNA was found in 80% of cases of high-grade CIN and invasive cervical cancer. This result corroborates those of Zohoncon et al., (76.92%) [<xref ref-type="bibr" rid="scirp.128469-ref24">24</xref>] and Sanou-Lamien et al., (76%) [<xref ref-type="bibr" rid="scirp.128469-ref25">25</xref>] . In women with high-grade precancerous lesions, previous authors reported a 70% positivity rate for HPV in 2016 [<xref ref-type="bibr" rid="scirp.128469-ref26">26</xref>] . However, our result is lower than the 48.8% reported in 2016 by Ou&#233;draogo et al., in cases of high-grade precancerous lesions [<xref ref-type="bibr" rid="scirp.128469-ref22">22</xref>] .</p><p>The most prevalent HR-HPV genotypes observed in our study among cases of high-grade CIN and invasive cervical cancer were HPV 16, 18, 31, and 33. These findings align with results reported by other authors. For instance, Zohoncon et al., conducted a study in Burkina Faso and reported that HPV 18, 31, 16, 39, and 45 were the most commonly found genotypes in cases of invasive cervical cancer, which is consistent with our observations [<xref ref-type="bibr" rid="scirp.128469-ref23">23</xref>] .</p><p>Nikolic et al., reported a frequency of HPV 16 of 76% in high-grade CIN, followed by HPV 31 (17%) and HPV 33 (9%) [<xref ref-type="bibr" rid="scirp.128469-ref20">20</xref>] . According to these authors, there appears to be a decrease in the frequency of HPV 31 with the progression of precancerous cervical lesions. They suggest that its prevalence tends to be lower in cases of cervical cancer compared to precancerous lesions.</p><p>A similar trend is observed for HPV 33, which is also classified fourth in terms of frequency and is responsible for approximately 4.2% of all cases of cervical cancer [<xref ref-type="bibr" rid="scirp.128469-ref20">20</xref>] . Par contre dans notre &#233;tude, la pr&#233;valence du HPV 33 &#233;tait nettement &#233;lev&#233;e. However, in our study, the prevalence of HPV 33 was notably higher. This discrepancy could be attributed to various factors. One possible explanation is the geographic diversity in HPV genotypes [<xref ref-type="bibr" rid="scirp.128469-ref27">27</xref>] [<xref ref-type="bibr" rid="scirp.128469-ref28">28</xref>] . Additionally, the phenomenon of viral clearance may play a role in these differences. In their study, Nikolic et al. reported a low frequency of HPV genotypes 52, 56, 45, 18, 59, 58, 39, 35, and HPV 18 [<xref ref-type="bibr" rid="scirp.128469-ref20">20</xref>] . However, HPV 18 is considered to be responsible for approximately 15% of invasive cervical cancers.</p><p>The frequency of HPV 18 has been reported to be 10 times lower than that of HPV 16 [<xref ref-type="bibr" rid="scirp.128469-ref20">20</xref>] . However, this was not the case in our study, as HPV 18 was the most prevalent (40.54%) among the four predominant genotypes in cases of cervical lesions. Clifford et al. had reported that only HPV 16, HPV 18, and HPV 45 represented a larger proportion of HPV infections in cases of invasive cervical cancer compared to cases with normal cytology [<xref ref-type="bibr" rid="scirp.128469-ref29">29</xref>] . Nevertheless, in our study, HPV 18 was not detected in cases of CIN. This aligns with the findings of Kusakabe et al., who reported that HPV 18 is challenging to detect in precancerous lesions [<xref ref-type="bibr" rid="scirp.128469-ref16">16</xref>] .</p><p>To date, not all HR-HPV genotypes are covered by the available HPV vaccines. HPV vaccination has been introduced in more than half of the World Health Organization (WHO) member countries as of 2020 [<xref ref-type="bibr" rid="scirp.128469-ref20">20</xref>] . This became a reality in Burkina Faso on April 26, 2022, with the introduction of the HPV vaccine for girls aged 9 to 14 years [<xref ref-type="bibr" rid="scirp.128469-ref30">30</xref>] . According to Nikolic et al., the results of their study indicate that 80% of precancerous lesions could be prevented using the nonavalent vaccine [<xref ref-type="bibr" rid="scirp.128469-ref20">20</xref>] . These findings align with the outcomes of our research, as our data suggests that the nonavalent vaccine could potentially prevent 80.31% of cervical lesions.</p><p>Malla and Kamal, in 2021 reported that cervical cancer is the fourth most common cancer among women aged 15 to 44 worldwide [<xref ref-type="bibr" rid="scirp.128469-ref17">17</xref>] . Experimental and epidemiological studies have identified that HPV types 16 and 18 are responsible for 70% of precancerous cervical lesions and cervical cancer worldwide due to their ability to induce genetic and epigenetic alterations in the host genome [<xref ref-type="bibr" rid="scirp.128469-ref17">17</xref>] .</p><p>Some studies have reported the presence of E6 and E7 mRNA in women with normal cervical cytology [<xref ref-type="bibr" rid="scirp.128469-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.128469-ref31">31</xref>] . Valen&#231;a et al., in 2016 reported that the E6/E7 test was positive in 69 samples (57.5%) with negative cytological results [<xref ref-type="bibr" rid="scirp.128469-ref26">26</xref>] . HPV 16 E6/E7 mRNA was detected in 61.2% of cases, followed by HPV 33 (26.5%), HPV 31 (17.3%), and HPV 18 (10%) [<xref ref-type="bibr" rid="scirp.128469-ref26">26</xref>] .</p><p>The positivity rate of mRNA for oncoproteins E6 and E7 of HPV16, 18, 31, and 33 was 98.88% in our study. Similarly, other authors have reported high positivity rates of E6/E7 mRNA in cases of CIN and cervical cancer. For instance, Valen&#231;a et al., reported in their study that out of 111 women who underwent biopsy and an E6/E7 test, the positivity rate of the E6/E7 test was 84.7% in women with cervical intraepithelial neoplasia (CIN) grade 2 or higher lesions [<xref ref-type="bibr" rid="scirp.128469-ref26">26</xref>] . In addition, Yu and Wang 2022 reported that the presence of HPV DNA and HPV E6/E7 mRNA were significantly higher in cases of CIN and cervical cancer than in cases of inflammation of the cervix [<xref ref-type="bibr" rid="scirp.128469-ref32">32</xref>] . Yu and Wang also reported that the specificity of HPV E6/E7 mRNA was lower than that of HPV DNA in detecting low-grade intraepithelial neoplasia, but it performed better in detecting high-grade intraepithelial neoplasia and cervical cancer [<xref ref-type="bibr" rid="scirp.128469-ref32">32</xref>] . Furthermore, Cao et al. reported that the total E6/E7 mRNA positivity rate was 67.27% and there was no significant difference between CIN1 and CIN2/P16 negative [<xref ref-type="bibr" rid="scirp.128469-ref33">33</xref>] . All of the above findings support the notion that the mRNA test for HR-HPV oncoproteins E6 and E7 could serve as a potential biomarker to facilitate early diagnosis and, consequently, the early management of high-grade intraepithelial cervical lesions and cervical cancer.</p></sec><sec id="s5"><title>5. Conclusion</title><p>The present study has successfully demonstrated the presence of HR-HPV DNA and the expression of E6 and E7 oncoprotein mRNA from HR-HPV 16/18/31/33 in cases of high-grade cervical intraepithelial neoplasia and invasive cervical cancer. The detection of HR-HPV oncoprotein E6 and E7 mRNA represents a promising biomarker that could significantly enhance the assessment of progression toward high-grade cervical intraepithelial lesions and cervical cancer. The incorporation of routine tests for HR-HPV oncoprotein E6 and E7 mRNA could provide a valuable tool for early diagnosis and timely management of cervical cancer. This advancement holds great potential for clinicians, offering improved diagnostic accuracy and ultimately benefiting patients in the ongoing battle against this devastating disease.</p></sec><sec id="s6"><title>Acknowledgements</title><p>The authors are grateful to the “Centre de Recherche Biomol&#233;culaire Pietro Annigoni (CERBA)”, Ouagadougou, Burkina Faso.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>Zohoncon, T.M., Bello, S.O.T., Bado, P., Ou&#233;draogo, R.A., Ou&#233;draogo, E., Traor&#233;, I.M.A., Ouattara, A.K., Djigma, F.W., Yonli, A.T., Sanou-Lamien, A., Lompo, O.M. and Simpore, J. (2023) Detection of Human Papillomavirus DNA and E6/E7 mRNA from HPV Genotypes 16, 18, 31 and 33 in Histologically Confirmed Cases of Cervical Cancer and Precancerous Lesions in Burkina Faso. American Journal of Molecular Biology, 13, 276-290. https://doi.org/10.4236/ajmb.2023.134019</p></sec></body><back><ref-list><title>References</title><ref id="scirp.128469-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Alain, S., Hantz, S. and Denis, F. (2010) Papillomavirus: Les virus et la physiopathologie de l’infection. Médecine Thérapeutique/Pédiatrie, 13, 5-19.</mixed-citation></ref><ref id="scirp.128469-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Dunne, E.F., Unger, E.R., Sternberg, M., McQuillan, G., Swan, D.C., Patel, S.S. and Markowitz, L.E. (2007) Prevalence of HPV Infection among Females in the United States. Journal of American Medical Association, 297, 813-819.  
https://doi.org/10.1001/jama.297.8.813</mixed-citation></ref><ref id="scirp.128469-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Nubia, M. and Jacquard, A. (2008) Quelles données épidémiologiques sont nécessaires pour la mise en place de la vaccination contre le papillomavirus humain? La Presse Médicale, 37, 1377-1390. https://doi.org/10.1016/j.lpm.2008.04.008</mixed-citation></ref><ref id="scirp.128469-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Bruni, L., Diaz, M., Castellsague, X., Ferrer, E., Bosch, F.X. and de Sanjosé, S. (2010) Cervical Human Papillomavirus Prevalence in 5 Continents: Meta-Analysis of 1 Million Women with Normal Cytological Findings. The Journal of Infectious Diseases, 202, 1789-1799. https://doi.org/10.1086/657321</mixed-citation></ref><ref id="scirp.128469-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Faye, B, Gueye, S.A.A.M., Tine, J.A.D., Sarr, H. and Dièye, A. (2022) Molecular Genotyping of Human Papillomaviruses (HPV) in HIV+ and HIV&amp;minus; Women in Senegal. American Journal of Molecular Biology, 12, 54-66.  
https://www.scirp.org/journal/ajmb  
https://doi.org/10.4236/ajmb.2022.122006</mixed-citation></ref><ref id="scirp.128469-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Kabre, K.M., Ouermi, D., Zohoncon, T.M., Traore, F.P.W, Gnoumou, O.P.P., Ouedraogo, R.A., Yonli, A.T., Bado, P., Ouedraogo, P., Ouedraogo, T.C., Yelemkoure, T.E., Kuassi-Kpede, P.A., Obiri-Yeboah, D., Ouedraogo, C.M.R. and Simpore, J. (2022) Molecular Epidemiology of Human Papillomavirus in Pregnant Women in Burkina Faso. Biomolecular Concepts, 13, 334-340.  
https://doi.org/10.1515/bmc-2022-0026</mixed-citation></ref><ref id="scirp.128469-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Munoz, N., Castellsagué, X., de González, A.B. and Gissmann, L. (2006) Chapter 1: HPV in the Etiology of Human Cancer. Vaccine, 24, S1-S10.  
https://doi.org/10.1016/j.vaccine.2006.05.115</mixed-citation></ref><ref id="scirp.128469-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Bray, F., Ferlay, J., Soerjomataram, I., Siegel, R.L., Torre, L.A. and Jemal, A. (2018) Global Cancer Statistics 2018: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA: A Cancer Journal for Clinicians, 68, 394-424. https://doi.org/10.3322/caac.21492</mixed-citation></ref><ref id="scirp.128469-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Chuang, L.T., Temin, S., Camacho, R., Duenas-Gonzalez, A., Feldman, S., Gultekin, M., et al. (2016) Management and Care of Women with Invasive Cervical Cancer: American Society of Clinical Oncology Resource-Stratified Clinical Practice Guideline. Journal of Global Oncology, 2, 311-340.  
https://doi.org/10.1200/JGO.2016.003954</mixed-citation></ref><ref id="scirp.128469-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Randall, T.C. and Ghebre, R. (2016) Challenges in Prevention and Care Delivery for Women with Cervical Cancer in Sub-Saharan Africa. Frontiers in Oncology, 6, Article 160. https://doi.org/10.3389/fonc.2016.00160</mixed-citation></ref><ref id="scirp.128469-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Gissmann, L., Boshart, M., Durst, M., Ikenberg, H., Wagner, D. and Zur, H. (1984) Presence of Human Papillomavirus in Genital Tumors. The Journal of Investigative Dermatology, 83, 17-19. https://doi.org/10.1038/jid.1984.16</mixed-citation></ref><ref id="scirp.128469-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Münger, K. and Howley, P.M. (2002) Human Papilloma Virus Immortalization and Transformation Functions. Virus Research, 89, 213-228.  
https://doi.org/10.1016/S0168-1702(02)00190-9</mixed-citation></ref><ref id="scirp.128469-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Filippova, M., Parkhurst, L. and Duerksen-hughes, P.J. (2004) The Human Papillomavirus 16 E6 Protein Binds to Fas-Associated Death Domain and Protects Cells from Fas-Triggered Apoptosis. The Journal of Biological Chemistry, 279, 25729-25744.  
https://doi.org/10.1074/jbc.M401172200</mixed-citation></ref><ref id="scirp.128469-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Frolov, M.V. and Dyson, N.J. (2004) Molecular Mechanisms of E2F-Dependent Activation and pRB-Mediated Repression. Journal of Cell Science, 117, 2173-2181.  
https://doi.org/10.1242/jcs.01227</mixed-citation></ref><ref id="scirp.128469-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Rangarajan, A., Syal, R., Selvarajah, S., Chakrabarti, O., Sarin, A. and Krishna, S. (2001) Activated Notch1 Signaling Cooperates with Papillomavirus Oncogenes in Transformation and Generates Resistance to Apoptosis on Matrix Withdrawal through PKB/Akt. Virology, 286, 23-30. https://doi.org/10.1006/viro.2001.0867</mixed-citation></ref><ref id="scirp.128469-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Kusakabe, M., Taguchi, A., Sone, K., Mori, M. and Osuga, Y. (2023) Carcinogenesis and Management of Human Papillomavirus-Associated Cervical Cancer. International Journal of Clinical Oncology, 28, 965-974.  
https://doi.org/10.1007/s10147-023-02337-7</mixed-citation></ref><ref id="scirp.128469-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Malla, R. and Kamal, M.A. (2021) E6 and E7 Oncoproteins: Potential Targets of Cervical Cancer. Current Medicinal Chemistry, 28, 8163-8181.  
https://doi.org/10.2174/0929867327666201111145546</mixed-citation></ref><ref id="scirp.128469-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Wang, Y., Springer, S., Mulvey, C.L., Silliman, N., Schaefer, J., Sausen, M., et al. (2015) Detection of Somatic Mutations and HPV in the Saliva and Plasma of Patients with Head and Neck Squamous Cell Carcinomas. Science Translational Medicine, 7, 293ra104. https://doi.org/10.1126/scitranslmed.aaa8507</mixed-citation></ref><ref id="scirp.128469-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, J., Zhang, Y. and Zhang, Z. (2018) Prevalence of Human Papillomavirus and Its Prognostic Value in Vulvar Cancer: A Systematic Review and Meta-Analysis. PLOS ONE, 13, e0204162. https://doi.org/10.1371/journal.pone.0204162</mixed-citation></ref><ref id="scirp.128469-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Nikolic, N., Basica, B., Mandic, A., Surla, N., Gusman, V., Medic, D., Petrovic, T., Strbac, M. and Petrovic, V. (2023) E6/E7 mRNA Expression of the Most Prevalent High-Risk HPV Genotypes in Cervical Samples from Serbian Women. Diagnostics, 13, Article 917. https://doi.org/10.3390/diagnostics13050917</mixed-citation></ref><ref id="scirp.128469-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Derbie, A., Mekonnen, D., Woldeamanuel, Y., Ostade, X.V. and Abebe, T. (2020) HPV E6/E7 mRNA Test for the Detection of High Grade Cervical Intraepithelial Neoplasia (CIN2+): A Systematic Review. Infectious Agents and Cancer, 15, Article No. 9. https://doi.org/10.1186/s13027-020-0278-x</mixed-citation></ref><ref id="scirp.128469-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Ouédraogo, C., Zohoncon, T.M., Traoré, E.M.A., Ouattara, S., Bado, P., Ouedraogo, C.T., Djigma, F.W., Ouermi, D., Obiri-Yeboah, D., Lompo, O., Akpona, S.A. and Simpore, J. (2016) Distribution of High-Risk Human Papillomavirus Genotypes in Precancerous Cervical Lesions in Ouagadougou, Burkina Faso. Open Journal of Obstetrics and Gynecology, 6, 196-204. http://www.scirp.org/journal/ojog  
https://doi.org/10.4236/ojog.2016.64025</mixed-citation></ref><ref id="scirp.128469-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Zohoncon, T.M., Bado, P., Ouermi, D., Traoré, E.M.A., Ouattara, S., Djigma, F.W., Traore, I.M.A., Yonli, A.T., Obiri-Yeboah, D., Ouédraogo, C., Akpona, S.A., Lompo, O. and Simpore, J. (2016a) Molecular Characterization of High-Risk Human Papillomavirus Genotypes Involved in Invasive Cervical Cancer from Formalin-Fixed, Paraffin Tissues in Ouagadougou, Burkina Faso. International Journal of Current Research, 8, 39314-39318.</mixed-citation></ref><ref id="scirp.128469-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Zohoncon, T.M., Ouédraogo, T.C., Brun, L.V.C., Obiri-Yeboah, D., Djigma, W.F., Kabibou, S., Ouattara, S., Gomina, M., Yonli, A.T., Bazié, V.J.T.E., Ouédraogo, C., Lompo, O., Akpona, S.A. and Simpore, J. (2016) Molecular Epidemiology of High-Risk Human Papillomavirus in High-Grade Cervical Intraepithelial Neoplasia and in Cervical Cancer in Parakou, Republic of Benin. Pakistan Journal of Biological Sciences, 19, 49-56. https://doi.org/10.3923/pjbs.2016.49.56</mixed-citation></ref><ref id="scirp.128469-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Sanou-Lamien, A., Ki, R., Zohoncon-Kone, T.M., Ouedraogo, A.S., Konsegre, V., Ido, F., Savadogo, I., Traore-Millogo, F.D. and Lompo, O.M. (2018) Aspects socio-démographiques et histopathologiques des lésions précancéreuses de haut grade et cancéreuses du col utérin et caractérisation moléculaire des HPV oncogènes impliqués à Ouagadougou (Burkina Faso). Revue Africaine de Pathologie, 17, 48-55.</mixed-citation></ref><ref id="scirp.128469-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Valenca, J.E.C., Goncalves, A.K., da Silva, I.D.C.G., Junior, J.E., da Silva, T.T., Bruneska, D. and de Alencar Ximenes, R.A. (2016) High Risk HPV E6/E7 Oncoprotein Expression in Women with High Grade Squamous Intraepithelial Lesion. Revista Brasileira de Ginecologia e Obstetricia, 38, 154-159.  
https://doi.org/10.1055/s-0036-1580713</mixed-citation></ref><ref id="scirp.128469-ref27"><label>27</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Zohoncon</surname><given-names> T.M.</given-names></name>,<name name-style="western"><surname> Djigma</surname><given-names> W.F.</given-names></name>,<name name-style="western"><surname> Ouattara</surname><given-names> A.K.</given-names></name>,<name name-style="western"><surname> Traore</surname><given-names> I.M.</given-names></name>,<name name-style="western"><surname> Ouedraogo</surname><given-names> R.A.</given-names></name>,<name name-style="western"><surname> Traore</surname><given-names> E.M.</given-names></name>,<name name-style="western"><surname> Bado</surname><given-names> P.</given-names></name>,<name name-style="western"><surname> Ouedraogo</surname><given-names> T.C.</given-names></name>,<name name-style="western"><surname> Diarra</surname><given-names> B.</given-names></name>,<name name-style="western"><surname> Ilboudo</surname><given-names> M.</given-names></name>,<name name-style="western"><surname> Capo-Chichi</surname><given-names> C.D.</given-names></name>,<name name-style="western"><surname> Obiri-Yeboah</surname><given-names> D.</given-names></name>,<name name-style="western"><surname> Karou</surname><given-names> S.D.</given-names></name>,<name name-style="western"><surname> Nayama</surname><given-names> M.</given-names></name>,<name name-style="western"><surname> Horo</surname><given-names> A.</given-names></name>,<name name-style="western"><surname> Kouakou</surname><given-names> K.P.</given-names></name>,<name name-style="western"><surname> Gomina</surname><given-names> M.</given-names></name>,<name name-style="western"><surname> Ouattara</surname><given-names> S.</given-names></name>,<name name-style="western"><surname> Sanni</surname><given-names> A.</given-names></name>,<name name-style="western"><surname> Simon</surname><given-names> A.</given-names></name>,<name name-style="western"><surname> Ouedraogo</surname><given-names> C. and Simpore J. </given-names></name>,<etal>et al</etal>. (<year>2020</year>)<article-title>Mapping of Fourteen High-Risk Human Papillomavirus Genotypes by Molecular Detection in Sexually Active Women in the West African Sub-Region</article-title><source> International Journal of Genetics and Molecular Biology</source><volume> 12</volume>,<fpage> 11</fpage>-<lpage>21</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.128469-ref28"><label>28</label><mixed-citation publication-type="book" xlink:type="simple">Zohoncon, T.M., Ouedraogo, R.A., Djigma, F.W., Traore, L., Ouedraogo, T.C., Ilboudo, M., Ilboudo, R., Salambanga, C., Guigma, S.P., Tovo, S.F., Traore, M.A.E., Bado, P., Kande, A., Bisseye, C., Ouattara, A.K., Traore, I.M.A, Ouermi, D, Sagna, T., Yonli, A.T., Nadembega, W.M.C., Obiri-Yeboah, D., Gyebre, Y.M.C., Lompo, O.M., Ouedraogo, C.M.R. and Simpore, J. (2022) Molecular Epidemiology of High-Risk Human Papillomavirus Infection in Burkina Faso. In: Budak, M. and Rajkumar, R., Eds., Molecular Mechanisms in Cancer (pp. 1-18). IntechOpen.</mixed-citation></ref><ref id="scirp.128469-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Clifford, G.M., Tully, S. and Franceschi, S. (2017) Carcinogenicity of Human Papillomavirus (HPV) Types in HIV-Positive Women: A Meta-Analysis from HPV Infection to Cervical Cancer. Clinical Infectious Diseases, 64, 1228-1235.  
https://doi.org/10.1093/cid/cix135</mixed-citation></ref><ref id="scirp.128469-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">OMS (2022) Le Burkina Faso introduit le vaccin contre le HPV (papillomavirus Humain) responsable du cancer du col de l’utérus.  
https://www.afro.who.int/fr/countries/burkina-faso/news/le-burkina-faso-introduit-le-vaccin-contre-le-hpv-papillomavirus-humain-responsable-du-cancer-du-col</mixed-citation></ref><ref id="scirp.128469-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Argyri, E., Tsimplaki, E., Daskalopoulou, D., Stravopodis, D.J., Kouikoglou, O., Terzakis, E. and Panotopoulou, E. (2013) E6/E7 mRNA Expression of High-Risk HPV Types in 849 Greek Women. Anticancer Research, 33, 4007-4012.</mixed-citation></ref><ref id="scirp.128469-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Yu, T. and Wang, C. (2022) Clinical Significance of Detection of Human Papilloma Virus DNA and E6/E7 mRNA for Cervical Cancer Patients. Cellular and Molecular Biology (Noisy-le-Grand), 67, 155-159. https://doi.org/10.14715/cmb/2021.67.6.21</mixed-citation></ref><ref id="scirp.128469-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Cao, L., He, P., Yang, J., Long, X., Chen, Y., Yan, L. and Zhou, D. (2022) Predictive Value of HPV E6/E7 mRNA Detection on the Outcome of Cervical LSIL. Evidence-Based Complementary and Alternative Medicine, 2022, Article ID: 8747919.  
https://doi.org/10.1155/2022/8747919</mixed-citation></ref></ref-list></back></article>