<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OALibJ</journal-id><journal-title-group><journal-title>Open Access Library Journal</journal-title></journal-title-group><issn pub-type="epub">2333-9705</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/oalib.1107851</article-id><article-id pub-id-type="publisher-id">OALibJ-128205</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Business&amp;Economics</subject><subject> Chemistry&amp;Materials Science</subject><subject> Computer Science&amp;Communications</subject><subject> Earth&amp;Environmental Sciences</subject><subject> Engineering</subject><subject> Medicine&amp;Healthcare</subject><subject> Physics&amp;Mathematics</subject><subject> Social Sciences&amp;Humanities</subject></subj-group></article-categories><title-group><article-title>
 
 
  Prevalence of &lt;i&gt;Salmonella&lt;/i&gt; and &lt;i&gt;Campylobacter&lt;/i&gt; in Chicken among the Different Farming Systems in Papua New Guinea (PNG)
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lydia</surname><given-names>Tasi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jayaprakash</surname><given-names>Reddy</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mohammad</surname><given-names>Yazid Abdad</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Amenda</surname><given-names>Wilson</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Agriculture, Papua New Guinea University of Technology, Lae, Papua New Guinea</addr-line></aff><aff id="aff2"><addr-line>Papua New Guinea Institute of Medical Research, Goroka, Papua New Guinea</addr-line></aff><pub-date pub-type="epub"><day>28</day><month>09</month><year>2023</year></pub-date><volume>10</volume><issue>10</issue><fpage>1</fpage><lpage>11</lpage><history><date date-type="received"><day>13,</day>	<month>September</month>	<year>2023</year></date><date date-type="rev-recd"><day>7,</day>	<month>October</month>	<year>2023</year>	</date><date date-type="accepted"><day>10,</day>	<month>October</month>	<year>2023</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  This trial was conducted to identify the prevalence of 
  Salmonella and 
  Campylobacter in different farming practices: commercial, semi-commercial, and subsistence farms in the four regions; Southern, Highland, Momase, and New Guinea Island (NGI) in PNG. The research was conducted at Institute of Med-ical Research (IMR) at Goroka, Eastern Highland Province. The samples used in the experiment were retrospective samples that were collected in 2011 and 2012 among the four regions and at different farming sites. A total of 333DNA samples were extracted from cloacal swabs. These samples were subjected to molecular assay where DNA extraction was done and analysed using re-al-time polymerase chain reaction (PCR). From the result, it was evident that in Southern region, significant differences were observed only in commercial and semi-commercial farms (p-value = 0.0030) and semi-commercial and non-commercial farms (p-value = 0.0002). However, in NGI significant dif-ferences were not observed in all the farming practices (p-value &lt; 0.05). Significant differences were observed between 
  Campylobacter in commercial and non-commercial (p-value = 0.0006) and semi-commercial and non-commercial farm (p-value &lt; 0.0001) in Momase region. The Highlands regions showed significant differences of 
  Campylobacter spp. between commercial and semi-commercial (p-value &lt; 0.0001) and commercial and non-commercial (p-value &lt; 0.0001) farming practices.
 
</p></abstract><kwd-group><kwd>Deoxyribo Nucleic Acid</kwd><kwd> Polymerase Chain Reaction</kwd><kwd> &lt;i&gt;Salmonella&lt;/i&gt;</kwd><kwd> &lt;i&gt;Campylobacter&lt;/i&gt;</kwd><kwd> Molecular Assay</kwd><kwd> Poultry</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Chicken (broiler and layer) farming is one of the agricultural practices that are active throughout the country. In PNG there are basically three types of farming practices occurring and they are commercial farming, semi-commercial, and non-commercial. Commercial farming is owned by big companies, semi-commercial is run by individuals and non-commercial are free range birds that are kept in the village but are reared for eggs and consumption. Chickens are part of the protein constituents in our diets. However, rearing of chicken under three different farming systems has a greater impact on the prevalence of the two bacteria; Salmonella and Campylobacter in the chicken.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Study Design</title><p>The study was conducted in Institute of Medical Research (IMR) at Goroka, Eastern Highlands Province. Retrospective poultry samples were used and were originally collected by the National Agriculture Quarantine Inspection Authority (NAQIA) and Department of Agriculture and Livestock (DAL), during their annual surveillance study in poultry survey among the four regions: Southern, Momase, New Guinea Island (NGI), and Highlands, from June 2011 to April 2012. About 385 cloacal swabs were collected and sent to the IMR. The study carried out was designed as a cross-sectional study looking at poultry samples collected over a one year period from different poultry farms in the country. However, no longitudinal analysis was performed due to insufficient collection time points available.</p></sec><sec id="s2_2"><title>2.2. DNA Extraction</title><p>DNA extraction from cloacal swabs were performed using DNeasy Blood and Tissue Kit (QIAGEN Germany), according to the manufacturer’s instructions. DNA extraction was done in the biological safety cabinet class II. A total of 200 &#181;l of the sample was transferred into sterile microcentrifuge tube (1.5 ml) (Eppendorf<sup>&#174;</sup>, Germany). About 20 &#181;l of Proteinase K was added into the reaction tube followed by adding of 200 &#181;l of Buffer AL. The samples were then vortex and incubated in the hot water bath at 56˚C for 10 min. After incubation, 200 &#181;l of ethanol (96% - 100%) was added and the samples were mixed thoroughly by vortexing. After vortexing, all the samples in the reaction tubes were pipette into a new DNeasy mini spin column placed in a 2 ml collection tube. The tubes were then centrifuged at 8000 revolutions per minutes (rpm) (≥6000 g) for 1min. The flow was discarded and the DNeasy spin column tubes were placed into a new 2 ml collection tube. 500 ul of Wash Buffer AW1 was added and the suspension was centrifuged at 8000 rpm (≥6000 g) for 1min. The flow was discarded and the spin column was placed into a new collection tube. Then 500 &#181;l of Wash Buffer AW2 was added and the samples were centrifuged again for 3 min at 14,000 rpm (20,000 g). The flow was discarded the spin column was placed into a new 1.5 ml labelled microcentrifuge tubes. Finally, 200 &#181;l of elution Buffer AE was directly added into the DNeasy membrane and centrifuged for 1 min at 8000 rpm. The DNeasy spin column was discarded and the DNA extract was ready for real-time PCR.</p></sec><sec id="s2_3"><title>2.3. Primer and Probes</title><p>Salmonella and Campylobacter primers used in real-time PCR are listed below (<xref ref-type="table" rid="table1">Table 1</xref>). Primers for Salmonella are specific for outer membrane protein “ompF” gene and primers for Campylobacter are mainly for 16S rRNA gene.</p></sec><sec id="s2_4"><title>2.4. Real-Time PCR</title><p>Nucleic acid extracted from cloacal swabs was tested for Salmonella and Campylobacter spp. using real-time PCR analysis. PCR preparation was done by creating a plate map followed with master-mix reaction preparation (<xref ref-type="table" rid="table2">Table 2</xref>).</p><p>All the reagents were thawed down in the bio-safety hood cabinet and pipette into the reaction Eppendorf tube (1.5 ml) (Interpath Australia). The reaction tube was then centrifuge using the micro-centrifuge. 18 &#181;l of the reaction solution was aliquot into each Hard-Shell<sup>&#174;</sup> PCR Plates 96-well white (Bio-Rad Australia)</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Probes and primers nucleotide sequencing</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Organism</th><th align="center" valign="middle" >Oligonucleotide</th><th align="center" valign="middle" >Nucleotide Sequence</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle" >Salmonella</td><td align="center" valign="middle" >F primers</td><td align="center" valign="middle" >5’CCTGGCAGCGGTGATCC’3</td><td align="center" valign="middle" >(Tatavarthy and Cannons, 2010) [<xref ref-type="bibr" rid="scirp.128205-ref1">1</xref>]</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >R primers</td><td align="center" valign="middle" >5’AAATTTCTGCTGCGTTTGCG’3</td><td align="center" valign="middle" >(Tatavarthy and Cannons, 2010) [<xref ref-type="bibr" rid="scirp.128205-ref1">1</xref>]</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Probe</td><td align="center" valign="middle" >5’TGCCCTGCTGGCTGCTGCA’3</td><td align="center" valign="middle" >(Tatavarthy and Cannons, 2010) [<xref ref-type="bibr" rid="scirp.128205-ref1">1</xref>]</td></tr><tr><td align="center" valign="middle" >Campylobacter</td><td align="center" valign="middle" >F primers</td><td align="center" valign="middle" >5’CTGCTTAACACAAGTTGAGTA GG’3</td><td align="center" valign="middle" >(Josefsen et al., 2004) [<xref ref-type="bibr" rid="scirp.128205-ref2">2</xref>]</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >R primers</td><td align="center" valign="middle" >5’TTCCTTAGGTACCGTCAGAA’3</td><td align="center" valign="middle" >(Josefsen et al., 2004) [<xref ref-type="bibr" rid="scirp.128205-ref2">2</xref>]</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Probes</td><td align="center" valign="middle" >5’CCTCCACGCGGCGTTGCTGC’3</td><td align="center" valign="middle" >(Josefsen et al., 2004) [<xref ref-type="bibr" rid="scirp.128205-ref2">2</xref>]</td></tr></tbody></table></table-wrap><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Master-mix preparation</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  colspan="5"  >No: of samples: 12</th></tr></thead><tr><td align="center" valign="middle" >Reagents</td><td align="center" valign="middle" >Volume for 1 rxn (&#181;l)</td><td align="center" valign="middle" >Vol. for master + 10% (&#181;l)</td><td align="center" valign="middle" >Vol. for master + 1 rxn (&#181;l)</td><td align="center" valign="middle" >Vol. for master + 2 rxn (&#181;l)</td></tr><tr><td align="center" valign="middle" >2 &#215; Quantitect master-mix</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >121</td><td align="center" valign="middle" >120</td><td align="center" valign="middle" >130</td></tr><tr><td align="center" valign="middle" >Forward primer (20 &#181;l)</td><td align="center" valign="middle" >0.2</td><td align="center" valign="middle" >2.42</td><td align="center" valign="middle" >2.4</td><td align="center" valign="middle" >2.6</td></tr><tr><td align="center" valign="middle" >Reverse primer (20 &#181;l)</td><td align="center" valign="middle" >7.4</td><td align="center" valign="middle" >89.54</td><td align="center" valign="middle" >88.8</td><td align="center" valign="middle" >96.2</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >17.8</td><td align="center" valign="middle" >215.38</td><td align="center" valign="middle" >213.6</td><td align="center" valign="middle" >231.4</td></tr><tr><td align="center" valign="middle"  colspan="5"  >Template DNA (per rxn): 2 &#181;l</td></tr></tbody></table></table-wrap><p>on the green bio-freezer rack and capped with Optical Flat 8-Cap Strips (Bio-Rad Australia). The PCR plates were then covered with aluminium foil and transferred to Dangerous Pathogen Laboratory (DPL) for addition of templates and the controls. Extracted DNA (templates), positive control, and non-template control were added to the PCR well strips respectively at a volume of 2 &#181;l each. The samples were then transferred to the wet lab for molecular analysis using real-time PCR.</p><p>The PCR strips were placed in the max-centrifuge (Thermo IEC, Centra Gp8R). The rpm was set to 520 for 1 min. After centrifuging the strips were wiped with tissue and placed in the CFX 96 Real-time PCR system C1000 Thermol Cycler. Salmonella and Campylobacter have the same PCR cycling parameters: Initial heating occurred at 50˚C for 2 min followed by denaturation at 95˚C at 15 sec and 40 cycles of annealing temperature at 94˚C for 1 min and extension temperature at 60˚C for 1 min (<xref ref-type="table" rid="table3">Table 3</xref>). The amplification read at (FAM) Fluorophores and the final results amplified after 2 hrs 6 min.</p></sec><sec id="s2_5"><title>2.5. Statistical Analysis</title><p>All statistical analysis was performed using Real-Stats in Microsoft Excel. Comparison of Salmonella and Campylobacter spp. in different farming methods and in different regions was subjected to chi-square test. Further analysis was done using Fisher’s Exact Test to determine the significance difference of Salmonella and Campylobacter among each of the farming practices, and regions. A p-value of 0.05 or less was considered significant.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Southern Region</title><p>Prevalence of Salmonella and Campylobacter spp. were compared among different poultry farming methods: commercial, semi-commercial and non-commercial farming methods. A total of 8 cloacal swabs were collected from commercial farms, 6 from semi-commercial and 33 from non-commercial farms. Salmonella was not observed among the farming methods. However, Campylobacter was observed at 83.3% (5/6) in semi-commercial farms and 6.1% (2/33) in non-commercial farms but absent in commercial farms (<xref ref-type="table" rid="table4">Table 4</xref>).</p><p>Significant differences was observed only in commercial and semi-commercial farms (p-value = 0.0030) and semi-commercial and non-commercial farms (p-value = 0.0002).</p></sec><sec id="s3_2"><title>3.2. New Guinea Island (NGI)</title><p>A total of 57 cloacal swabs were collected from different poultry farming methods in the NGI region. Salmonella was positive at 5.9% (1/17) in semi-commercial and 2.6% (1/38) in non-commercial farms. Campylobacter was observed at 50.0% (1/2), 29.4% (5/17) and 21.1% (8/38) in commercial, semi-commercial and non-commercial farms respectively (<xref ref-type="table" rid="table5">Table 5</xref>).</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Real-time PCR cycling parameters</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Stage</th><th align="center" valign="middle" >Temperature</th><th align="center" valign="middle" >Time</th></tr></thead><tr><td align="center" valign="middle" >Initial heat activation</td><td align="center" valign="middle" >50˚C</td><td align="center" valign="middle" >2 min</td></tr><tr><td align="center" valign="middle" >Denaturation</td><td align="center" valign="middle" >95˚C</td><td align="center" valign="middle" >15 sec</td></tr><tr><td align="center" valign="middle" >40 cycle of:</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Annealing</td><td align="center" valign="middle" >94˚C</td><td align="center" valign="middle" >60 sec</td></tr><tr><td align="center" valign="middle" >Extension</td><td align="center" valign="middle" >60˚C</td><td align="center" valign="middle" >60 sec</td></tr></tbody></table></table-wrap><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Prevalence of Salmonella and Campylobacter spp. by different farming methods in the Southern region</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Farming methods</th><th align="center" valign="middle"  rowspan="2"  >Total samples tested</th><th align="center" valign="middle"  colspan="2"  >Salmonella</th><th align="center" valign="middle"  colspan="2"  >Campylobacter</th></tr></thead><tr><td align="center" valign="middle" >Positive</td><td align="center" valign="middle" >%</td><td align="center" valign="middle" >Positive</td><td align="center" valign="middle" >%</td></tr><tr><td align="center" valign="middle" >Commercial</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td></tr><tr><td align="center" valign="middle" >Semi-commercial</td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >83.3</td></tr><tr><td align="center" valign="middle" >Non-commercial</td><td align="center" valign="middle" >33</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >6.1</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >47</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >14.9</td></tr></tbody></table></table-wrap><table-wrap id="table5" ><label><xref ref-type="table" rid="table5">Table 5</xref></label><caption><title> Prevalence of Salmonella and Campylobacter spp. among farming methods in NGI region</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Farming methods</th><th align="center" valign="middle"  rowspan="2"  >Total samples tested</th><th align="center" valign="middle"  colspan="2"  >Salmonella</th><th align="center" valign="middle"  colspan="2"  >Campylobacter</th></tr></thead><tr><td align="center" valign="middle" >Positive</td><td align="center" valign="middle" >%</td><td align="center" valign="middle" >Positive</td><td align="center" valign="middle" >%</td></tr><tr><td align="center" valign="middle" >Commercial</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >50.0</td></tr><tr><td align="center" valign="middle" >Semi-commercial</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >5.9</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >29.4</td></tr><tr><td align="center" valign="middle" >Non-commercial</td><td align="center" valign="middle" >38</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >2.6</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >21.1</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >57</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >3.5</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >24.6</td></tr></tbody></table></table-wrap></sec><sec id="s3_3"><title>3.3. Momase</title><p>A total of 150 cloacal swabs samples were collected and tested among different poultry farming methods in the Momase region. Salmonella spp. was not observed in the different farming methods. Semi-commercial farms had the highest prevalence of Campylobacter spp. at 57.7% (45/78), with commercial farms at 52.0% (13/25) and non-commercial farms at 12.7% (6/47) (<xref ref-type="table" rid="table6">Table 6</xref>).</p><p>Significant differences were observed between Campylobacter in commercial and non-commercial (p-value = 0.0006) and semi-commercial and non-commercial farm (p-value &lt; 0.0001).</p></sec><sec id="s3_4"><title>3.4. Highlands</title><p>A total of 131 cloacal swabs were collected from poultry farms in the Highlands region. Twenty four swabs were collected from commercial farms, 62 from semi-commercial and 45 from non-commercial farms. Salmonella spp. was observed in both semi-commercial and non-commercial farms at 1.6% (1/62) and</p><table-wrap id="table6" ><label><xref ref-type="table" rid="table6">Table 6</xref></label><caption><title> Prevalence of Salmonella and Campylobacter spp. among poultry farming methods in Momase region</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th><th align="center" valign="middle"  colspan="2"  >Salmonella</th><th align="center" valign="middle"  colspan="2"  >Campylobacter</th></tr></thead><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle"  colspan="2"  >Positive</td><td align="center" valign="middle"  colspan="2"  >Positive</td></tr><tr><td align="center" valign="middle" >Farming methods</td><td align="center" valign="middle" >Total samples tested</td><td align="center" valign="middle" >n</td><td align="center" valign="middle" >%</td><td align="center" valign="middle" >n</td><td align="center" valign="middle" >%</td></tr><tr><td align="center" valign="middle" >Commercial</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >13</td><td align="center" valign="middle" >52.0</td></tr><tr><td align="center" valign="middle" >Semi-commercial</td><td align="center" valign="middle" >78</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >45</td><td align="center" valign="middle" >57.7</td></tr><tr><td align="center" valign="middle" >Non-commercial</td><td align="center" valign="middle" >47</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >12.7</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >150</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >64</td><td align="center" valign="middle" >42.7</td></tr></tbody></table></table-wrap><p>2.2% (1/45) respectively. Campylobacter spp. was found to have a higher prevalence rate in semi-commercial farms at 56.5% (35/62) compared to commercial farms at 8.3% (2/24) and least prevalent in non-commercial farms at 17.8% (8/45) (<xref ref-type="table" rid="table7">Table 7</xref>).</p><p>Significant differences were observed for Campylobacter spp. between commercial and semi-commercial (p-value &lt; 0.0001) and commercial and non-commercial (p-value &lt; 0.0001) farming practices in Highlands region.</p></sec><sec id="s3_5"><title>3.5. Salmonella and Campylobacter spp. among Commercial, Semi-Commercial, and Non-Commercial Farms in the Country</title><p>All data from different farming methods and data from all the regions were pooled, and subjected to chi-square test. Semi-commercial farms were observed to have higher carriage rates of Campylobacter spp. at 52.1% (85/163) compared to commercial farms at 27.1% (16/59) and non-commercial farms at 9.8% (16/163). Salmonella spp. was present only in semi-commercial farm and non-commercial farms at 1.2% (2/163) and 1.2% (2/163) respectively, but absent in commercial farms (<xref ref-type="table" rid="table8">Table 8</xref>).</p><p>Significant differences were observed for Campylobacter spp. between commercial and semi-commercial farms (p-value = 0.0012) and semi-commercial and non-commercial farm (p-value &lt; 0.0001).</p></sec><sec id="s3_6"><title>3.6. Salmonella and Campylobacter spp. among the Four Regions: Southern, NGI, Momase, and Highlands</title><p>Data from the three different farming practices was pooled, and the presence of Salmonella and Campylobacter spp. was analysed between the different regions: Southern, Momase, NGI, and Highlands by chi-square analysis followed by Fisher’s exact test. Campylobacter was observed in all four regions while Salmonella was largely absent. The Momase and Highlands regions had the higher prevalence rate of Campylobacter at 42.7% (64/150) and 34.4% (45/131) respectively compared to the NGI and Southern regions at 24.6% (14/57) and 14.9% (7/47) respectively (<xref ref-type="table" rid="table9">Table 9</xref>). Salmonella was observed but at a very low prevalence rate only in NGI region and Highlands region at 3.5% (2/57) and 1.5% (2/131) respectively. Significant differences in Salmonella between regions were not observed.</p><table-wrap id="table7" ><label><xref ref-type="table" rid="table7">Table 7</xref></label><caption><title> Prevalence of Salmonella and Campylobacter spp. among poultry farming methods in Highlands region</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th><th align="center" valign="middle"  colspan="2"  >Salmonella</th><th align="center" valign="middle"  colspan="2"  >Campylobacter</th></tr></thead><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle"  colspan="2"  >Positive</td><td align="center" valign="middle"  colspan="2"  >Positive</td></tr><tr><td align="center" valign="middle" >Farming methods</td><td align="center" valign="middle" >Total samples tested</td><td align="center" valign="middle" >n</td><td align="center" valign="middle" >%</td><td align="center" valign="middle" >n</td><td align="center" valign="middle" >%</td></tr><tr><td align="center" valign="middle" >Commercial</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >8.3</td></tr><tr><td align="center" valign="middle" >Semi-commercial</td><td align="center" valign="middle" >62</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1.6</td><td align="center" valign="middle" >35</td><td align="center" valign="middle" >56.5</td></tr><tr><td align="center" valign="middle" >Non-commercial</td><td align="center" valign="middle" >45</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >2.2</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >17.8</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >131</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >1.5</td><td align="center" valign="middle" >45</td><td align="center" valign="middle" >34.4</td></tr></tbody></table></table-wrap><table-wrap id="table8" ><label><xref ref-type="table" rid="table8">Table 8</xref></label><caption><title> Prevalence of Salmonella and Campylobacter spp. among farming methods in the country</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th><th align="center" valign="middle"  colspan="2"  >Salmonella</th><th align="center" valign="middle"  colspan="2"  >Campylobacter</th></tr></thead><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle"  colspan="2"  >Positive</td><td align="center" valign="middle"  colspan="2"  >Positive</td></tr><tr><td align="center" valign="middle" >Farming methods</td><td align="center" valign="middle" >Total samples tested</td><td align="center" valign="middle" >n</td><td align="center" valign="middle" >%</td><td align="center" valign="middle" >n</td><td align="center" valign="middle" >%</td></tr><tr><td align="center" valign="middle" >Commercial</td><td align="center" valign="middle" >59</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >16</td><td align="center" valign="middle" >27.1</td></tr><tr><td align="center" valign="middle" >Semi-commercial</td><td align="center" valign="middle" >163</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >1.2</td><td align="center" valign="middle" >85</td><td align="center" valign="middle" >52.1</td></tr><tr><td align="center" valign="middle" >Non-commercial</td><td align="center" valign="middle" >163</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >1.2</td><td align="center" valign="middle" >16</td><td align="center" valign="middle" >9.8</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >385</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >1.3</td><td align="center" valign="middle" >117</td><td align="center" valign="middle" >30.4</td></tr></tbody></table></table-wrap><table-wrap id="table9" ><label><xref ref-type="table" rid="table9">Table 9</xref></label><caption><title> Prevalence of Salmonella and Campylobacter spp. among the four regions in the country</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th><th align="center" valign="middle"  colspan="2"  >Salmonella</th><th align="center" valign="middle"  colspan="2"  >Campylobacter</th></tr></thead><tr><td align="center" valign="middle" >Regions</td><td align="center" valign="middle" >Total samples tested</td><td align="center" valign="middle" >Positive</td><td align="center" valign="middle" >%</td><td align="center" valign="middle" >Positive</td><td align="center" valign="middle" >%</td></tr><tr><td align="center" valign="middle" >Southern</td><td align="center" valign="middle" >47</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >14.9</td></tr><tr><td align="center" valign="middle" >NGI</td><td align="center" valign="middle" >57</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >3.5</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >24.6</td></tr><tr><td align="center" valign="middle" >Momase</td><td align="center" valign="middle" >150</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >64</td><td align="center" valign="middle" >42.7</td></tr><tr><td align="center" valign="middle" >Highlands</td><td align="center" valign="middle" >131</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >1.5</td><td align="center" valign="middle" >45</td><td align="center" valign="middle" >34.4</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >385</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >1.0</td><td align="center" valign="middle" >130</td><td align="center" valign="middle" >33.8</td></tr></tbody></table></table-wrap><p>Significant differences were observed for Campylobacter between the Southern and Momase regions (p-value = 0.0008), Southern and Highlands regions (p-value = 0.0132), and Momase and NGI regions (p-value = 0.0313). Significant differences in Salmonella between regions were not detected.</p></sec></sec><sec id="s4"><title>4. Discussion</title><sec id="s4_1"><title>4.1. Prevalence of Salmonella and Campylobacter among Different Farming Methods</title><p>Campylobacter and Salmonella were both detected from cloacal samples collected among the three different poultry farming methods in the country. There is a high prevalence of Campylobacter in semi-commercial (52.5%) and commercial (27.1%) farms and least in non-commercial or free range system (9.8%) in the present study. The differences in the prevalence of Campylobacter among the farming methods could be as a result of different agricultural activities such as farming methods, vaccines, deep litter management and biosecurity practices in the farm.</p><p>Vaccination of chickens is regarded as an additional measure to increase resistance of birds against Salmonella infection and decrease shedding of viable organisms (Dewaele et al., 2012 [<xref ref-type="bibr" rid="scirp.128205-ref3">3</xref>] ; Hassan and Curtiss, 1996 [<xref ref-type="bibr" rid="scirp.128205-ref4">4</xref>] ). Studies have proven that vaccination works by reducing the prevalence of Salmonella in breeder hens and the progeny or by increasing the passive immunity of the birds (broiler and layer) and blocking the horizontal transmission of Salmonella to the flocks (D&#243;rea et al., 2010) [<xref ref-type="bibr" rid="scirp.128205-ref5">5</xref>] . However, no suitable vaccine is readily available for Campylobacter infection (Ahmed et al., 2013 [<xref ref-type="bibr" rid="scirp.128205-ref6">6</xref>] ; Schroeder et al., 2014 [<xref ref-type="bibr" rid="scirp.128205-ref7">7</xref>] ). Hence, chicken are highly susceptible to Campylobacter transmission and colonization than Salmonella.</p><p>Under normal poultry farming condition, chicks usually become infected with Campylobacter at about 2 - 3 weeks of age (Hodgins et al., 2015 [<xref ref-type="bibr" rid="scirp.128205-ref8">8</xref>] ; Lin, 2009 [<xref ref-type="bibr" rid="scirp.128205-ref9">9</xref>] ). Maternal antibodies providing passive immunity are transferred to the avian embryos from serum to egg yolks (Hamal et al., 2006) [<xref ref-type="bibr" rid="scirp.128205-ref10">10</xref>] . The level of antibodies is very high at 3 to 4 days after hatching and thereafter gradually decreases to undetectable levels at 2 to 3 week (Sahin et al., 2001) [<xref ref-type="bibr" rid="scirp.128205-ref11">11</xref>] . Once the chicken is infected with Campylobacter, the organisms usually spread so rapidly that close to 100% birds are reported to be colonized for a shorter period of time (Hamal et al., 2006) [<xref ref-type="bibr" rid="scirp.128205-ref10">10</xref>] . The pathogen survives in the chicken gut throughout the grow-out period (Hodgins et al., 2015) [<xref ref-type="bibr" rid="scirp.128205-ref8">8</xref>] .</p><p>Poultry litter provides an ideal environment for Campylobacter growth however other researchers have observed lower prevalence of Salmonella in litter. Environmental factors in the poultry house play an important role on the growth of Campylobacter in the litter. Since Campylobacter is sensitive to drying, increased temperature, lower ventilation rate and high humidity with an increasing pH in the litter encourages higher growth of Campylobacter (Chinivasagam et al., 2009) [<xref ref-type="bibr" rid="scirp.128205-ref12">12</xref>] . This could be the reason for the non-detection of Campylobacter in non-commercial poultry farms. Litter management in the farm is a very important agricultural practice to reduce prevalence of Campylobacter (Line and Bailey, 2006) [<xref ref-type="bibr" rid="scirp.128205-ref13">13</xref>] .</p><p>Urea and uric acids make up 70% of the nitrogen content of poultry litter and are readily degraded to ammonia (Newell et al., 2011 [<xref ref-type="bibr" rid="scirp.128205-ref14">14</xref>] ; Rothrock et al., 2008 [<xref ref-type="bibr" rid="scirp.128205-ref15">15</xref>] ). Ammonia emissions beyond the threshold level of 25 ppm in the poultry house causes complication in chicken’s health. Birds starting to develop stressful conditions, infection occurs in respiratory system and eventually decreases immunity. Thus leaving the birds susceptible to bacterial colonization and infection (Line and Bailey, 2006) [<xref ref-type="bibr" rid="scirp.128205-ref13">13</xref>] .</p><p>Prevalence of Salmonella and Campylobacter in poultry is determined by the on-farm biosecurity practices (Colles et al., 2015 [<xref ref-type="bibr" rid="scirp.128205-ref16">16</xref>] ; Hald et al., 2000 [<xref ref-type="bibr" rid="scirp.128205-ref17">17</xref>] ). Biosecurity is a set of preventative measures to reduce the risk of transmission in poultry farms in three main areas: isolation, mobility, and cleanliness and hygiene. Effective biosecurity measures to control Salmonella and Campylobacter in poultry farms include all-in-all-out system followed by disinfection of sheds, restricted movement of birds, workers and equipment, lack of contact with migratory birds, use of feed pellets, chlorination of drinking water, proper litter management, washing and sanitizing of hatching eggs, and purification of air in hatching cabinets (Colles et al., 2015 [<xref ref-type="bibr" rid="scirp.128205-ref16">16</xref>] ; Conan et al., 2012 [<xref ref-type="bibr" rid="scirp.128205-ref18">18</xref>] ). The prevalence of Salmonella and Campylobacter in the farm is not guaranteed to be eliminated completely, but lowering the prevalence is an important strategy for reducing contamination of birds entering the processing plant and minimising risk of contaminated meat and egg products entering the food chain (McCrea et al., 2006 [<xref ref-type="bibr" rid="scirp.128205-ref19">19</xref>] ; Trampel et al., 2014 [<xref ref-type="bibr" rid="scirp.128205-ref20">20</xref>] ).</p><p>Poultry housing system in PNG provides free access for movement of insects such as Synanthropic flies, in particular the house fly Musca domestica and flies belonging to Diptera: Brachycera spp. which have been associated with animal and human activities (Hald et al., 2008 [<xref ref-type="bibr" rid="scirp.128205-ref17">17</xref>] ; Trampel etal., 2014 [<xref ref-type="bibr" rid="scirp.128205-ref20">20</xref>] ). Darkling beetles (Hazeleger et al., 2008) [<xref ref-type="bibr" rid="scirp.128205-ref21">21</xref>] and rodents are ubiquitous and thrives wherever food stocks and habitats are plentiful and can live in close proximity to humans and livestock (Meerburg et al., 2006) [<xref ref-type="bibr" rid="scirp.128205-ref22">22</xref>] .</p></sec><sec id="s4_2"><title>4.2. Prevalence of Salmonella and Campylobacter spp. in Different Regions</title><p>Salmonella and Campylobacter positivity were identified among the four regions in the country, Southern, Momase, NGI and the Highlands regions. Campylobacter was found to be more prevalent than Salmonella. It was observed that Campylobacter had a higher prevalence in the Momase and Highland regions at 42.7% and 34.4% respectively compared to the NGI (24.6%) and Southern (14.9%) regions. Salmonella was observed only in NGI and Highlands regions at (3.5%) and (1.5%). Currently there is no information available about the poultry farming practices in each of the regions. However, it is assumed that higher prevalence of Campylobacter in Momase and Highlands regions is believed to be associated with poultry farms having poor biosecurity practices.</p></sec></sec><sec id="s5"><title>5. Conclusion</title><p>In conclusion, Salmonella and Campylobacter was observed in poultry farms in PNG, however at low prevalence as compared to other developed countries. Campylobacter is more prevalent than Salmonella. Semi-commercial and commercial farms were found to have more carrierssss of Campylobacter than in non-commercial or free-range farm. A higher prevalence of Campylobacter was also observed in Momase and Highlands region.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest.</p></sec><sec id="s7"><title>Cite this paper</title><p>Tasi, L., Reddy, J., Abdad, M.Y. and Wilson, A. (2023) Prevalence of Salmonella and Campylobacter in Chicken among the Different Farming Systems in Papua New Guinea (PNG). Open Access Library Journal, 10: e7851. https://doi.org/10.4236/oalib.1107851</p></sec></body><back><ref-list><title>References</title><ref id="scirp.128205-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Tatavarthy, A. and Cannons, A. (2010) Real-Time PCR Detection of Salmonella Species Using a Novel Target: The Outer Membrane Porin F Gene (ompF). Letter Applied Microbiology, 50, 645-652.  
https://doi.org/10.1111/j.1472-765X.2010.02848.x</mixed-citation></ref><ref id="scirp.128205-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Josefsen, M.H., L&amp;ouml;fstr&amp;ouml;m, C., Hansen, T.B., Christensen, L.S., Olsen, J.E. and Hoorfar, J. (2010) Rapid Quantification of Viable Campylobacter Bacteria on Chicken Carcasses, Using Real-Time PCR and Propidium Monoazide Treatment, as a Tool for Quantitative Risk Assessment. Applied and Environmental Microbiology, 76, 5097-5104. https://doi.org/10.1128/AEM.00411-10</mixed-citation></ref><ref id="scirp.128205-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Dewaele, I., Van Meirhaeghe, H., Rasschaert, G., Vanrobaeys, M., De Graef, E., Herman, L., Ducatelle, R., Heyndrickx, M. and De Reu, K. (2012) Persistent Salmonella Enteritidis Environmental Contamination on Layer Farms in the Context of an Implemented National Control Program with Obligatory Vaccination. Poultry Science, 91, 282-291. https://doi.org/10.3382/ps.2011-01673</mixed-citation></ref><ref id="scirp.128205-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Hassan, J.O. and Curtiss, R. (1996) Effect of Vaccination of Hens with an Avirulent Strain of Salmonella Typhimurium on Immunity of Progeny Challenged with Wild-Type Salmonella Strains. Infection and Immunity, 64, 938-944. 
https://doi.org/10.1128/iai.64.3.938-944.1996</mixed-citation></ref><ref id="scirp.128205-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Dórea, F.C., Cole, D.J., Hofacre, C., Zamperini, K., Mathis, D., Doyle, M.P., Lee, M.D. and Maurer, J.J. (2010) Effect of Salmonella Vaccination of Breeder Chickens on Contamination of Broiler Chicken Carcasses in Integrated Poultry Operations. Applied and Environmental Microbiology, 76, 7820-7825. 
https://doi.org/10.1128/AEM.01320-10</mixed-citation></ref><ref id="scirp.128205-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Ahmed, M.F.M., Schulz, J. and Jartung, H. (2013) Survival of Campylobacter jejuni in Naturally and Artificially Contaminated Laying Hen Feces. Poultry Science, 92, 364-369. https://doi.org/10.3382/ps.2012-02496</mixed-citation></ref><ref id="scirp.128205-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Schroeder, M.W., Eifert, J.D., Ponder, M.A. and Schmale, D.G. (2014) Association of Campylobacter spp. Levels between Chicken Grow-Out Environmental Samples and Processed Carcasses. Poultry Science, 93, 734-741. 
https://doi.org/10.3382/ps.2013-03646</mixed-citation></ref><ref id="scirp.128205-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Hodgins, D., Barjesteh, N., St. Paul, M., Ma, Z., Monteiro, M. and Sharif, S. (2015) Evaluation of a Polysaccharide Conjugate Vaccine to Reduce Colonization by Campylobacter jejuni in Broiler Chickens. Biomedical Research Notes, 8, 755-765.  
https://doi.org/10.1186/s13104-015-1203-z</mixed-citation></ref><ref id="scirp.128205-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Lin, J. (2009) Novel Approaches for Campylobacter Control in Poultry. Foodborne Pathogens and Disease, 6, 755-765. https://doi.org/10.1089/fpd.2008.0247</mixed-citation></ref><ref id="scirp.128205-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Hamal, K.R., Burgess, S.C., Pevzner, I.Y. and Erf, G.F. (2006) Maternal Antibody Transfer from Dams to Their Egg Yolks, Egg Whites, and Chicks in Meat Lines of Chickens. Poultry Science, 85, 1364-1372. https://doi.org/10.1093/ps/85.8.1364</mixed-citation></ref><ref id="scirp.128205-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Sahin, O., Morishita, T. and Zhang, Q.J. (2002) Campylobacter Colonization in Poultry: Sources of Infection and Modes of Transmission. Animal Health Research Reviews, 3, 95-105. https://doi.org/10.1079/AHRR200244</mixed-citation></ref><ref id="scirp.128205-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Chinivasagam, H.N., Tran, T., Maddock, L., Gale, A. and Blackall, P.J. (2009) Mechanically Ventilated Broiler Sheds: A Possible Source of Aerosolized Salmonella, Campylobacter, and Escherichia coli. Applied and Environmental Microbiology, 75, 7417–7425. https://doi.org/10.1128/AEM.01380-09</mixed-citation></ref><ref id="scirp.128205-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Line, J.E. and Bailey, J.S. (2006) Effect of On-Farm Litter Acidification Treatments on Campylobacter and Salmonella Populations in Commercial Broiler Houses in Northeast Georgia. Poultry Science, 85, 1529-1534.  
https://doi.org/10.1093/ps/85.9.1529</mixed-citation></ref><ref id="scirp.128205-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Newell, D.G., Elvers, K.T., Dopfer, D., Hansson, I., Jones, P. and James, S. (2011) Biosecurity-Based Interventions and Strategies to Reduce Campylobacter spp. on Poultry Farms. Applied Environmental Microbiology, 77, 8605-8614.  
https://doi.org/10.1128/AEM.01090-10</mixed-citation></ref><ref id="scirp.128205-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Rothrock, M.J., Cook, K.L., Warren, J.G. and Sistani, K. (2008) The Effect of Alum Addition on Microbial Communities in Poultry Litter. Poultry Science, 87, 1493-1503. https://doi.org/10.3382/ps.2007-00491</mixed-citation></ref><ref id="scirp.128205-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Colles, F.M., McCarthy, N.D., Bliss, C.M., Layton, R. and Maiden, M.C.J. (2015) The Long-Term Dynamics of Campylobacter Colonizing a Free-Range Broiler Breeder Flock: An Observational Study. Environmental Microbiology, 17, 938-946.  
https://doi.org/10.1111/1462-2920.12415</mixed-citation></ref><ref id="scirp.128205-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Hald, B., Skovgard, H., Pedersen, K. and Bunkenborg, H. (2008) Influxed Insects as Vectors for Campylobacter jejuni and Campylobacter coli in Danish Broiler Houses. Poultry Science, 87, 1428-1434. https://doi.org/10.3382/ps.2007-00301</mixed-citation></ref><ref id="scirp.128205-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Conan, A., Goutard, F.L., Sorn, S. and Vong, S. (2012) Biosecurity Measures for Backyard Poultry in Developing Countries: A Systematic Review. Biomedical Veterinary Research, 8, 1-10. https://doi.org/10.1186/1746-6148-8-240</mixed-citation></ref><ref id="scirp.128205-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">McCrea, B.A., Tonooka, K.H., VanWorth, C., Boggs, C.L., Atwil,l E.R. and Schrader, J.S. (2006) Prevalence of Campylobacter and Salmonella Species on Farm, after Transport, and at Processing in Specialty Market Poultry. Poultry Science, 85, 136-143. https://doi.org/10.1093/ps/85.1.136</mixed-citation></ref><ref id="scirp.128205-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Trampel, D.W., Holder, T.G. and Gast, R.K. (2014) Integrated Farm Management to Prevent Salmonella Enteritidis Contamination of Eggs. Applied Poultry Research, 23, 1-13. https://doi.org/10.3382/japr.2014-00944</mixed-citation></ref><ref id="scirp.128205-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Hazeleger, W.C., Bolder, N.M., Beumer, R.R. and Jacobs-Reitsma, W.F. (2008) Darkling Beetles (Alphitobius diaperinus) and Their Larvae as Potential Vectors for the Transfer of Campylobacter jejuni and Salmonella enterica Serovar Paratyphi B Variant Java between Successive Broiler Flocks. Applied and Environmental Microbiology, 7, 6887-6891. https://doi.org/10.1128/AEM.00451-08</mixed-citation></ref><ref id="scirp.128205-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Meerburg, B.G., Jacobs-Reitsma, W.F., Wagenaar, J.A. and Kijlstra, A. (2006) Presence of Salmonella and Campylobacter spp. in Wild Small Mammals on Organic Farms. Applied and Environmental Microbiology, 72, 960-962. 
https://doi.org/10.1128/AEM.72.1.960-962.2006</mixed-citation></ref></ref-list></back></article>