Escherichia coli, a Gram-negative bacterium, is commonly associated community and hospital-acquired infections, with significant antibiotic resistance implications for public health. This study aimed to detect the
bla
VIM gene in
E. coli strains isolated from the Centre Hospitalier Universitaire Pédiatrique Charles De Gaulle (CHUP-CDG) in Ouagadougou, Burkina Faso.
E. coli strains were isolated from various biological samples (urine, pus, blood, stool, and cerebrospinal fluid) from 2009 to 2013 at CHUP-CDG. Antibiotic susceptibility testing for cefotaxime, ceftazidime, and imipenem was performed using the disc diffusion method on Mueller-Hinton agar. Classical PCR was used to identify the
bla
VIM gene. The susceptibility test showed high resistance of strains to third generation cephalosporins. The resistance rate was 82.86% (29/35), 80.00% (28/35) and 11.42% (4/35) for cefotaxime, ceftriaxone, and imipenem, respectively. Analysis of PCR products revealed that 11.42% (4/35) of strains harbored the
bla
VIM gene. Significantly, 75.00% (3/4) of strains with the
bla
VIM gene were isolated from urine samples. The present study demonstrated the presence of the
bla
VIM gene in
E. coli resistant strains to β-lactams at CHUP-CDG. Our results suggest the presence of other resistance genes in view of the low rate of
bla
VIM found in resistant strains. Surveillance measures are necessary to prevent the spread of these resistant strains.
Escherichia coli is a bacterial species in the genus Escherichia and belonging to the Enterobacteriaceae family [1] . Most strains of E. coli are non-pathogenic agents in the intestinal flora of humans and animals. However, some strains have acquired virulence factors that allow them to cause significant intestinal and extraintestinal pathology [2] . Intestinal and extraintestinal infections caused by pathogenic E. coli include urinary tract infections [3] , neonatal meningitis [4] , sepsis [5] , skin infections and colisepticemia [6] . E. coli can survive and adapt in a wide range of external conditions; and it can spread between humans and animals through various routes and cause disease, hence the use of appropriate antibiotics to inhibit or destroy this pathogen [2] .
Antibiotics are still needed for the treatment of bacterial diseases worldwide, but antibiotic resistance due to irrational use has become a serious public health problem [7] . E. coli resistance to antibiotics may be due to the production of metallo-β-lactamases (MBLs). Metallo-β-lactamases are a group of enzymes that hydrolyze β-lactams, including carbapenems [8] . The first MBL-like VIM enzyme was discovered in P. aeruginosa in 1997, and since then, more than 69 variants have been reported [9] . MBLs can spread horizontally through Enterobacteriaceae and other clinically important gram-negative bacteria via mobile genetic elements [10] . Furthermore, research has revealed that MBLs are widely distributed in various geographical locations. It is considered a serious concern as they lead to therapeutic impasses [8] . Beta-lactamases with carbapenemase activity are the most potent mechanisms of carbapenem resistance. However, the distribution of carbapenemase genes is poorly documented in Burkina Faso.
The main objective of this study was to identify the VIM-type carbapenemase gene carried by E. coli strains at the Centre Hospitalier Universitaire Pédiatrique Charles De Gaulle (CHUP-CDG) of Ouagadougou, Burkina Faso.
2. Materials and Methods2.1. Type and Period of Study
This was a retrospective collection descriptive study of bacterial samples responsible for human infections [9] [10] . The study was conducted at the Centre de Recherche Biomoléculaire Pietro Annigoni (CERBA)/Laboratoire de Biologie Moléculaire et de Génétique (LABIOGENE) from June to September 2021.
2.2. Sampling
The biological material consisted of 35 Escherichia coli isolates collected between 2009 and 2013 from sick children at the CHUP-CDG of Ouagadougou in Burkina Faso [11] [12] . These strains were isolated from various biological samples such as urine, pus, cerebrospinal fluid (CSF), stool and blood. The strains were stored at −80˚C in Luria Bertani (LB) supplemented with 30% glycerol at CERBA.
2.3. Strain Sensitivity Testing
The disk diffusion method was used to perform the antibiotic susceptibility test of the strains on Mueller-Hinton agar (MH), while following the guidelines provided by the Antibiogram Committee of the French Microbiology Society [13] . The interpretation of the results was based on the categorization of the strains into either Susceptible (S) or Resistant (R) to the tested antibiotics, which included ceftriaxone (CRO), cefotaxime (CTX), and imipenem (IMP).
2.4. DNA Extraction
DNA extraction was carried out using the boiling method [14] . An isolated colony was taken from the MH petri dishes and suspended in 200 μL of distilled water in previously labeled Eppendorf tubes. The tube was then placed in a water bath at 100˚C for 15 minutes to release the bacterial genetic material. The supernatant, which contained the released DNA, was transferred to a new Eppendorf tube after a 10-minute centrifugation at 12,000 rpm. The quantity and purity of the DNA extract were assessed using a NanoDrop spectrophotometer (Thermo Scientific, Wilmington, DE, United States) and the DNA extract was stored at −20˚C until molecular analysis.
2.5. Gene Amplification
Conventional PCR was performed using the GeneAmp PCR System 9700 thermal cycler (Applied Biosystems, California, USA) in a 20 μL reaction mixture. This reaction mixture was prepared using 4 μL GREEN PCR Master Mix + 0.5 μL of sense primer + 0.5 μL of antisense primer + 14 μL of PCR water + 1 μL of DNA extract from each strain. PCR amplification of the blaVIM gene was performed with the following specific primers: VIM-F 5’ GTTTGGTCGCATATCGCAAC 3’ and VIM-R 5’ AATGCGCAGCACCAGGATAG 3’ with an expected amplicon of 382 bp (Shams, et al., 2018). The PCR program used in this study consisted of an initial denaturation step at 96˚C for 5 minutes, followed by 30 cycles of denaturation at 96˚C for 30 seconds, hybridization at 61˚C for 30 seconds, and elongation at 72˚C for 30 seconds. A final elongation step was performed at 72˚C for 7 minutes after the completion of the 30 cycles.
2.6. Agarose Gel Electrophoresis
The amplified DNA fragments obtained through PCR were separated by agarose gel electrophoresis, which consisted of a 1.5% gel prepared in a 1X tris base-borate-EDTA solution with 0.5 μg/mL of ethidium bromide. A volume of 8 μL of the amplicons was added to each well of the gel, starting from the second well, while the first well was filled with 8 μL of the 100-bp molecular weight marker. Electrophoresis was carried out for 25 minutes at 100 V. After the migration, the gels were visualized using the GeneFlash apparatus (Syngene, Cambridge, UK) under UV light at 365 nm.
2.7. Ethics Approval
The protocol of the current study was reviewed and approved by the institutional ethics committee of CERBA/LABIOGENE.
2.8. Statistical Analyses
The collected data were entered into Microsoft Excel 2019 and then analyzed with statistics and data (STATA) software (Stata Corporation, College Station, TX, USA). The results for categorical variables were presented in terms of frequency and percentage (%).
3. Results
Sensitivity testing on 35 strains of E. coli, showed high resistance to third generation cephalosporins. The resistance rate was 82.85% (29/35) for cefotaxime and 80.00% (28/35) for ceftriaxone with 11.42% (4/35) of resistance rate to imipenem. Table 1 shows the distribution of resistance by biological sample.
PCR product examination via agarose gel electrophoresis enabled the detection of 4 strains (11.42%) harboring the blaVIM gene. Figure 1 shows the electrophoretic profile of the blaVIM gene at 382 bp. The majority (75% or 3/4) of the blaVIM gene-carrying strains were from urine samples (Table 2).
4. Discussions
Antimicrobial resistance is a serious threat to human and animal health [15] . Carbapenems, particularly imipenem, were once considered first-line drugs in the treatment of severe bacterial infections [10] . However, in recent years, there
Distribution of resistance by biological samples
Biological samples
Antibiotics
CTX
CAZ
IMP
Urine
16 (45.71%)
15 (42.85%)
3 (8.57%)
Pus
10 (28.57%)
10 (28.57%)
1 (2.85%)
Blood
1 (2.85%)
1 (2.85%)
0 (00%)
Stool
1 (2.85%)
1 (2.85%)
0 (00%)
Cerebrospinal fluid
1 (2.85%)
1 (2.85%)
0 (00%)
Total
29 (82.85%)
28 (80.00%)
4 (11.42%)
Distribution of the bla<sub>VIM</sub> gene by biological samples
Biological samples
BlaVIM gene
Urine
3 (8.57%)
Pus
1 (2.85%)
Blood
0 (00%)
Stool
0 (00%)
Cerebrospinal fluid
0 (00%)
Total
4 (11.42%)
has been a significant growth in antibiotic resistance, which may limit treatment options [16] . The objective of this study was to characterize the blaVIM gene within E. coli strains isolated from sick children from 2009 to 2013 at the CHUP-CDG of Ouagadougou, Burkina Faso.
In the present study, the results of antibiotic susceptibility testing of strains showed high resistance to cefotaxime (82.85%) and ceftriaxone (80.00%). A recent study conducted in the cities of Boromo and Gourcy in Burkina Faso, showed high rates of resistance of E. coli and Salmonella isolated from diarrheic children to common antibiotics [17] . High resistance of E. coli to ceftriaxone (64.3%; 9/14) was also reported in febrile children under 5 years old in Nanoro, Burkina Faso [18] . In addition, resistance to third generation cephalosporins has also been reported in clinical isolates of E. coli in Egypt [19] , Togo [20] and Libya [21] . This high level of cephalosporin resistance could be due to the acquisition of antibiotic resistance factors [14] [22] . Several bacterial isolates that were found to produce extended-spectrum β-lactamases and exhibit resistance to multiple antibiotics were previously reported by our research team [11] [20] [21] [22] .
The strains showed the highest susceptibility to imipenem among all β-lactam molecules tested, which confirms its status as the first-line treatment for severe infections caused by multidrug-resistant bacteria [23] . The resistant strains identified in this study were primarily isolated from urine samples as previously reported in studies conducted in Burkina Faso [22] [24] [25] , Niger [26] and Togo [27] [28] .
PCR detection of carbapenem resistance genes showed that 11.42% (4/35) of strains carried the blaVIM gene. Carbapenems are the treatment of choice for ESBL-producing Enterobacteriaceae. Nonetheless, the public health concern is increasing due to the emergence and spread of carbapenemase-producing Enterobacteriaceae, which limits the available therapeutic options. The blaVIM gene was reported in two imipenem-resistant E. coli isolates in a previous study in Burkina Faso [17] . A study in Nigeria reported the blaVIM gene in four carbapenem-resistant, metallo-β-lactamase (MBL)-producing strains of Pseudomonas aeruginosa [29] . Metallo-β-lactamases are a particular concern due to their increasing prevalence worldwide, especially in Asia, and their ability to resist most recently licensed β-lactam-β-lactamase inhibitors.
The VIM enzymes, which are of this type, are typically encoded by gene cassettes located in either class 1 or class 3 integrons [30] . Studies conducted in Pakistan have reported the presence of VIM-type metallo-β-lactamases in E. coli. One of these studies found that out of 145 E. coli isolates, 50 isolates (34.48%) were MBL producers and that the blaVIM gene was carried by 8 strains [31] . Another study reported that 15.1% of MBL-producing E. coli strains harbored the blaVIM gene [11] . Given the expansion of these MBL-producing clinical isolates, it is important to sustain surveillance efforts and develop new therapeutic solutions, particularly in developing countries such as Burkina Faso.
5. Conclusion
The present study has revealed a significant resistance among clinical strains of E. coli to third generation cephalosporins, despite a weak presence of the blaVIM gene. Notably, cefotaxime and ceftriaxone exhibited high resistance rates, while imipenem showed lower resistance rates. The low prevalence of the blaVIM gene suggests the involvement of other resistance genes, necessitating enhanced surveillance to effectively prevent and control the dissemination of metallo-β-lactamase-producing bacteria.
Acknowledgements
We acknowledge all the staff of CERBA and LABIOGENE for excellent technical help.
Conflicts of Interest
The authors declare no conflicts of interest.
Cite this paper
Ouattara, A.K., Ouédraogo, B., Tiemtoré, R.Y.W., Dabiré, A.M., Sougué, S. and Simporé, J. (2023) Detection of blaVIM Gene in β-Lactam Resistant E. coli Isolated from Clinical Samples in Ouagadougou, Burkina Faso. Open Access Library Journal, 10: e10534. https://doi.org/10.4236/oalib.1110534
NOTESReferencesShin, H., Kim, Y., Unno, T. and Hur, H.G. (2023) Prevalence and Characterization of CRISPR Locus 2.1 Spacers in Escherichia coli Isolates Obtained from Feces of Animals and Humans. Microbiology Spectrum, 11, e0493422.
https://doi.org/10.1128/spectrum.04934-22Weerdenburg, E., Davies, T., Morrow, B., Zomer, A.L., Hermans, P., Go, O., Spiessens, B., van den Hoven, T., van Geet, G., Aitabi, M., DebRoy, C., Dudley, E.G., Bonten, M., Poolman, J. and Geurtsen, J. (2022) Global Distribution of O Serotypes and Antibiotic Resistance in Extraintestinal Pathogenic Escherichia coli Collected from the Blood of Patients with Bacteremia across Multiple Surveillance Studies. Clinical Infectious Diseases, 76, e1236-e1243. https://doi.org/10.1093/cid/ciac421Varghese, A., Saleena, U.V., Bhat, G., et al. (2023) Comparison of Genetic Factors of Escherichia coli in Patients with Urosepsis and Urinary Tract Infections. A Systematic Review. Reviews and Research in Medical Microbiology.Pons, S., Frapy, E., Sereme, Y., Gaultier, C., Lebreton, F., Kropec, A., Danilchanka, O., Schlemmer, L., Schrimpf, C., Allain, M., Angoulvant, F., Lecuyer, H., Bonacorsi, S., Aschard, H., Sokol, H., Cywes-Bentley, C., Mekalanos, J.J., Guillard, T., Pier, G.B., Roux, D. and Skurnik, D. (2023) A High-Throughput Sequencing Approach Identifies Immunotherapeutic Targets for Bacterial Meningitis in Neonates. EBioMedicine, 88, Article ID: 104439. https://doi.org/10.1016/j.ebiom.2023.104439Yair, Y., Michaux, C., Biran, D., Bernhard, J., Vogel, J., Barquist, L. and Ron, E.Z. (2022) Cellular RNA Targets of Cold Shock Proteins CspC and CspE and Their Importance for Serum Resistance in Septicemic Escherichia coli. mSystems, 7, e00086-22. https://doi.org/10.1128/msystems.00086-22Gemeinder, J.L.P., Barros, N.R., Pegorin, G.S., Singulani, J.L., Borges, F.A., Arco, M., Giannini, M., Almeida, A.M.F., Salvador, S.L.S. and Herculano, R.D. (2021) Gentamicin Encapsulated within a Biopolymer for the Treatment of Staphylococcus aureus and Escherichia coli Infected Skin Ulcers. Journal of Biomaterials Science, Polymer Edition, 32, 93-111. https://doi.org/10.1080/09205063.2020.1817667Mueller, T. and ystergren, P.-O. (2016) The Correlation between Regulatory Conditions and Antibiotic Consumption within the WHO European Region. Health Policy, 120, 882-889. https://doi.org/10.1016/j.healthpol.2016.07.004Wu, W., Feng, Y., Tang, G., Qiao, F., McNally, A. and Zong, Z. (2019) NDM Metallo-β-Lactamases and Their Bacterial Producers in Health Care Settings. Clinical Microbiology Reviews, 32, e00115-18. https://doi.org/10.1128/CMR.00115-18Naas, T., Oueslati, S., Bonnin, R.A., Dabos, M.L., Zavala, A., Dortet, L., Retailleau, P. and Iorga, B.I. (2017) Beta-Lactamase Database (BLDB)—Structure and Function. Journal of Enzyme Inhibition and Medicinal Chemistry, 32, 917-919.
https://doi.org/10.1080/14756366.2017.1344235Shams, S., Hashemi, A., Esmkhani, M., Kermani, S., Shams, E. and Piccirillo, A. (2018) Imipenem Resistance in Clinical Escherichia coli from Qom, Iran. BMC Research Notes, 11, Article No. 314. https://doi.org/10.1186/s13104-018-3406-6Metuor Dabire, A., Zongo, K.J., Zeba, B., Moussawi, J., Baucher, M. and El Jaziri, M. (2013) Resistances to the Oxyimino-Cephalosporins by Ctx-M-15 Producing Klebsiella Isolated From the Urines Samples of Patients in the University Hospital Complex Paediatric Charles De Gaulle (CHUP-CDG) of Ouagadougou in Burkina Faso. Journal of Asian Scientific Research, 3, 882-890.
https://archive.aessweb.com/index.php/5003/article/view/3540Metuor Dabire, A., Zongo, K.J., Zeba, B., Traoré/Ouedraogo, R., Moussawi, J., Baucher, M. and El Jaziri, M. (2014) First Detection of SHV-Type Extended Spectrum β-Lactamases in the University Hospital Complex Paediatric Charles De Gaulle (CHUP-CDG) of Ouagadougou in Burkina Faso. Journal of Asian Scientific Research, 4, 214-221.
https://archive.aessweb.com/index.php/5003/article/view/3629Eucast/Ca-Sfm (2021) Comité de l’antibiogramme de la Société Franaise de Microbiologie.Mètuor, D.A., Tiemtoré, R.Y.W.-K., Bangré, Y.A., Zohoncon, T.M., Sougué, S., Zongo, J.K. and Simporé, J. (2019) Detection of Multidrug-Resistant Enterobacteria Simultaneously Producing Extended-Spectrum-Lactamases of the PER and GES Types Isolated at Saint Camille Hospital Center, Ouagadougou, Burkina Faso. African Journal of Microbiology Research, 13, 414-420.
https://doi.org/10.5897/AJMR2019.9147Poirel, L., Madec, J.Y., Lupo, A., Schink, A.K., Kieffer, N., Nordmann, P. and Schwarz, S. (2018) Antimicrobial Resistance in Escherichia coli. Microbiology Spectrum, 6, 1-26. https://doi.org/10.1128/microbiolspec.ARBA-0026-2017Catalano, A., Iacopetta, D., Ceramella, J., Scumaci, D., Giuzio, F., Saturnino, C., Aquaro, S., Rosano, C. and Sinicropi, M.S. (2022) Multidrug Resistance (MDR): A Widespread Phenomenon in Pharmacological Therapies. Molecules, 27, Article No. 616. https://doi.org/10.3390/molecules27030616Dembélé, R., Soulama, I., Kaboré, W.A.D., Konaté, A., Kagambèga, A., N'Golo, D.C., Traoré, O., Seck, A., Traoré, A.S. and Guessennd, N. (2021) Molecular Characterization of Carbapenemase-Producing Enterobacterales in Children with Diarrhea in Rural Burkina Faso. Journal of Drug Delivery and Therapeutics, 11, 84-92.
https://doi.org/10.22270/jddt.v11i1.4513Bonko, M.D.A., Tahita, M.C., Kiemde, F., Lompo, P., Yougbaré, S., Some, A.M., Tinto, H., Mens, P.F., Menting, S. and Schallig, H. (2021) Antibiotic Susceptibility Profile of Bacterial Isolates from Febrile Children under 5 Years of Age in Nanoro, Burkina Faso. Tropical Medicine & International Health, 26, 1220-1230.
https://doi.org/10.1111/tmi.13644Khalifa, S.M., El-Aziz, A.M.A., Hassan, R. and Abdelmegeed, E.S. (2021) β-Lactam Resistance Associated with β-Lactamase Production and Porin Alteration in Clinical Isolates of E. coli and K. pneumoniae. PLOS ONE, 16, e0251594.
https://doi.org/10.1371/journal.pone.0251594Toudji, A.G., Djeri, B., Karou, S.D., Tigossou, S., Ameyapoh, Y. and De Souza, C. (2017) Prévalence des souches d’entérobactéries productrices de bêta-lactamases à spectre élargi isolées au Togo et de leur sensibilité aux antibiotiques. International Journal of Biological and Chemical Sciences, 11, 1165-1177.
https://doi.org/10.4314/ijbcs.v11i3.19Zorgani, A., Almagatef, A., Sufya, N., Bashein, A. and Tubbal, A. (2017) Detection of CTX-M-15 among Uropathogenic Escherichia coli Isolated from Five Major Hospitals in Tripoli, Libya. Oman Medical Journal, 32, 322-327.
https://doi.org/10.5001/omj.2017.61Diagbouga, S., Salah, F., Sadji, A., Dabire, A., Nadembega, C., Kere, A., Soubeiga, S., Ouattar, A., Zohoncon, T., Belemgnegre, M., Karou, S. and Simpore, J. (2016) Detection of High Prevalence of TEM/SHV/CTX-M Genes in ESBL Producing and Multidrug Resistant Klebsiella pneumoniae and Klebsiella oxytoca. Journal of Clinical and Diagnostic Research, 4, Article ID: 000129.Jain, P., Bepari, A.K., Sen, P.K., Rafe, T., Imtiaz, R., Hossain, M. and Reza, H.M. (2021) High Prevalence of Multiple Antibiotic Resistance in Clinical E. coli Isolates from Bangladesh and Prediction of Molecular Resistance Determinants Using WGS of an XDR Isolate. Scientific Reports, 11, Article No. 22859.
https://doi.org/10.5001/omj.2017.61Tiemtoré, R.Y., Mètuor-Dabiré, A., Zohoncon, T.M., Bangré, Y.A., Sougue, S., Zongo, J. and Simpore, J. (2019) First Detection of PE-Type Extended-Spectrum β-Lactamases at Saint Camille Hospital Center of Ouagadougou, Burkina Faso. International Journal of Biochemistry, Biophysics & Molecular Biology, 4, 7-12.
https://doi.org/10.11648/j.ijbbmb.20190401.12Tiemtoré, R.Y.W., Mètuor Dabiré, A., Ouermi, D., Sougué, S., Benao, S. and Simporé, J. (2022) Isolation and Identification of Escherichia coli and Klebsiella pneumoniae Strains Resistant to the Oxyimino-Cephalosporins and the Monobactam by Production of GES Type Extended Spectrum Bêta-Lactamase (ESBL) at Saint Camille Hospital Center in Ouagadougou, Burkina Faso. Infection and Drug Resistance, 15, 3191-3204. https://doi.org/10.2147/IDR.S360945Moumouni, A., Diagbouga, S., Nadembèga, C., Metuor Dabire, A., Soubeiga, S.T., Ouattara, A.K., Zohoncon, T., Djigma, F., Langendorf, C. and Simpore, J. (2017) Quinolone Resistance (qnr) Genes in Fecal Carriage of Extended Spectrum Beta-Lactamases Producing Enterobacteria Isolated from Children in Niger. Current Research in Microbiology and Biotechnology, 5, 953-957.
http://crmb.aizeonpublishers.net/content/2017/1/crmb953-957.pdfSalah, F., Diagbouga, S., Dabire, A.M., Sadji, A., Nadembega, C. and Moumouni, A. (2016) First Detection of Resistance Genes Encoding Extended Spectrum β-Lactamase Producing Escherichia coli at Lomé, Togo. Archives of Clinical Microbiology, 7, 32.Salah, F.D., Soubeiga, S.T., Ouattara, A.K., Sadji, A.Y., Metuor-Dabire, A., Obiri-Yeboah, D., Banla-Kere, A., Karou, S. and Simpore, J. (2019) Distribution of Quinolone Resistance Gene (QNR) in ESBL-Producing Escherichia coli and Klebsiella spp. in Lomé, Togo. Antimicrobial Resistance & Infection Control, 8, Article No. 104. https://doi.org/10.1186/s13756-019-0552-0Nmema, E. and Ologun, C. (2019) Detection of Blavim Genes in Clinical Isolates of Carbapenem-Resistant, Metallo-β-Lactamase Producing Pseudomonas aeruginosa. Annals of Biomedical Sciences, 18, 147-156.
https://www.ajol.info/index.php/abs/article/view/188575Boyd, S.E., Livermore, D.M., Hooper, D.C. and Hope, W.W. (2020) Metallo-β-Lactamases: Structure, Function, Epidemiology, Treatment Options, and the Development Pipeline. Antimicrobial Agents and Chemotherapy, 64, e00397-20.
https://doi.org/10.1128/AAC.00397-20Nahid, F., Khan, A.A., Rehman, S. and Zahra, R. (2013) Prevalence of Metallo-β-Lactamase NDM-1-Producing Multi-Drug Resistant Bacteria at Two Pakistani Hospitals and Implications for Public Health. Journal of Infection and Public Health, 6, 487-493. https://doi.org/10.1016/j.jiph.2013.06.006