<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OALibJ</journal-id><journal-title-group><journal-title>Open Access Library Journal</journal-title></journal-title-group><issn pub-type="epub">2333-9705</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/oalib.1109969</article-id><article-id pub-id-type="publisher-id">OALibJ-124688</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Business&amp;Economics</subject><subject> Chemistry&amp;Materials Science</subject><subject> Computer Science&amp;Communications</subject><subject> Earth&amp;Environmental Sciences</subject><subject> Engineering</subject><subject> Medicine&amp;Healthcare</subject><subject> Physics&amp;Mathematics</subject><subject> Social Sciences&amp;Humanities</subject></subj-group></article-categories><title-group><article-title>
 
 
  Effect of Overexpression of &lt;i&gt;SlbZIP39&lt;/i&gt; on Plant Architecture and Fruit Size in Tomato (&lt;i&gt;Solanum lycopersicum&lt;/i&gt; L.)
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yee</surname><given-names>Yee Lwin</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Min</surname><given-names>Kyaw Thu</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Khin</surname><given-names>Hnin Yee</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Maw</surname><given-names>Maw Khin</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Biology, School of Life Sciences, Chongqing University, Chongqing, China</addr-line></aff><aff id="aff2"><addr-line>Department of Botany, Yangon University, Yangon, Republic of the Union of Myanmar</addr-line></aff><aff id="aff3"><addr-line>Department of Botany, Myingyan University, Myingyan, Republic of the Union of Myanmar</addr-line></aff><pub-date pub-type="epub"><day>04</day><month>04</month><year>2023</year></pub-date><volume>10</volume><issue>04</issue><fpage>1</fpage><lpage>14</lpage><history><date date-type="received"><day>5,</day>	<month>March</month>	<year>2023</year></date><date date-type="rev-recd"><day>25,</day>	<month>April</month>	<year>2023</year>	</date><date date-type="accepted"><day>28,</day>	<month>April</month>	<year>2023</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  The transcription factors of the 
  bZIP (basic leucine zipper) family are involved in the regulation of molecular analysis in fruit development, plant architecture, and response to environmental factors. Here, we performed transcription of the 
  SlbZIP39 gene in various tissues and fruit developmental stages. However, they revealed that the different transcription levels of tomato tissues were expressed by floral parts and immature green stages. We observed that 
  SlbZIP39 was induced by the treatments of tomato plants with D-mannitol, NaCl, IAA, GA3, ABA, and dehydration stress. We further revealed that Group IV 
  bZIP transcription factors are expressed in fruit developmental stages in overexpressing plants. In addition, we found that overexpression of 
  SlbZIP39 decreased plant height and reduced fruit size. However, overexpression of 
  SlbZIP39 may affect early flowering and fruit development in tomato. These results suggest that the transcription factor of 
  SlbZIP39 is involved in abiotic stresses, regulation of fruit size, and plant architecture.
 
</p></abstract><kwd-group><kwd>Abiotic Stresses</kwd><kwd> Hormonal Treatments</kwd><kwd> Fruit Size</kwd><kwd> Tomato (&lt;i&gt;Solanum lycopersicum&lt;/i&gt;)</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Plant transcription factors of the bZIP family play a significant role in biological advancements inclusive of morphogenesis, seed maturation, flower development, and environmental factors [<xref ref-type="bibr" rid="scirp.124688-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref2">2</xref>] . However, bZIP transcription factors are involved in multiple abiotic stress tolerances. Several reports have indicated that members of the bZIP transcription factor family function in plant hormone signaling and environmental stresses, which include drought and salt stress [<xref ref-type="bibr" rid="scirp.124688-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref6">6</xref>] .</p><p>Among all the plant transcription factors, bZIP genes have been identified in monocotyledonous and dicotyledonous plants. Nowadays, it is reported that 75 bZIP genes have been classified in Arabidopsis thaliana [<xref ref-type="bibr" rid="scirp.124688-ref7">7</xref>] , 89 in Oryza sativa [<xref ref-type="bibr" rid="scirp.124688-ref8">8</xref>] , 125 in Zea mays [<xref ref-type="bibr" rid="scirp.124688-ref9">9</xref>] , 160 in Glycine max [<xref ref-type="bibr" rid="scirp.124688-ref10">10</xref>] , and 55 in Vitis vinifera [<xref ref-type="bibr" rid="scirp.124688-ref11">11</xref>] . AREB1, AREB2, and ABF3 up-regulate ABA, drought tolerance, and water stresses in Arabidopsis, and they also function as master transcription factors [<xref ref-type="bibr" rid="scirp.124688-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref13">13</xref>] . Furthermore, AtABF3 increased tolerance to various abiotic stresses in Alfalfa [<xref ref-type="bibr" rid="scirp.124688-ref14">14</xref>] . Overexpression of AtbZIP3 is involved in leaf development and response to the sugar signaling pathway in Arabidopsis [<xref ref-type="bibr" rid="scirp.124688-ref15">15</xref>] . However, AtbZIP19 and AtbZIP23 have been related to the regulation of zinc deficiency in Arabidopsis [<xref ref-type="bibr" rid="scirp.124688-ref16">16</xref>] .</p><p>In plants, some researchers have confirmed that transcription factors of the bZIP family are induced in seed maturation [<xref ref-type="bibr" rid="scirp.124688-ref1">1</xref>] , light response [<xref ref-type="bibr" rid="scirp.124688-ref17">17</xref>] , sucrose signaling [<xref ref-type="bibr" rid="scirp.124688-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref19">19</xref>] , pathogen resistance [<xref ref-type="bibr" rid="scirp.124688-ref3">3</xref>] , flower development and fertility [<xref ref-type="bibr" rid="scirp.124688-ref20">20</xref>] , phytohormone response, development of organs and response to various stresses [<xref ref-type="bibr" rid="scirp.124688-ref2">2</xref>] . AtbZIP63 may participate in the interaction of ABA and glucose in Arabidopsis [<xref ref-type="bibr" rid="scirp.124688-ref19">19</xref>] . Kang et al. [<xref ref-type="bibr" rid="scirp.124688-ref21">21</xref>] , state that overexpression of ABF3 and ABF4 functions in ABA hypersensitivity, whereas it reduces transpiration and enhances tolerance in Arabidopsis. The function of bZIP16 was developed in seed germination and seedling development of Arabidopsis [<xref ref-type="bibr" rid="scirp.124688-ref22">22</xref>] . Besides, overexpression of GmbZIP1 affected the response of ABA in seed germination stages and abiotic stress tolerance in soybeans [<xref ref-type="bibr" rid="scirp.124688-ref23">23</xref>] . AtbZIP17 might play roles as an ABA signaling pathway and is involved in seed germination and seed filling in Arabidopsis. Furthermore, it was genetically demonstrated that AtbZIP17 plays a crucial role in osmotic stress and is affected as a negative regulator of storage and seed germination in Arabidopsis [<xref ref-type="bibr" rid="scirp.124688-ref24">24</xref>] .</p><p>SlbZIP38, SlbZIP1 and LebZIP2 functions were found to be involved in tomato responses to various environmental stresses [<xref ref-type="bibr" rid="scirp.124688-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref25">25</xref>] . Furthermore, SlAREB1 was characterized by ABA, salt, drought, and cold resistance from tomato [<xref ref-type="bibr" rid="scirp.124688-ref26">26</xref>] . In Vitis vinifera, VIbZIP36 improved tolerance to drought treatment in seed germination [<xref ref-type="bibr" rid="scirp.124688-ref27">27</xref>] . Overexpression of VIbZIP30 not only improved seed germination under dehydration stress but was also involved in drought stress in grapevine [<xref ref-type="bibr" rid="scirp.124688-ref28">28</xref>] .</p><p>Tomato (Solanum lycopersicum L.) is a dicotyledonous plant that is one of 69 SlbZIP gene family members classified into 14 groups. In this study, we performed further experimental design by overexpressing the SlbZIP39 gene in a tomato to investigate its expression profiles in the different tissues, abiotic stresses, hormonal treatments, and physiological characteristics in tomato.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Plant Materials and Growth Conditions</title><p>The WT tomato (Solanum lycopersicum L., cv. Micro-Tom) and transgenic seeds were sterilized before germinating, and the seedlings were then grown in 1/2 MS medium. The plants were cultivated in a greenhouse under standard conditions with 18 h light (25˚C)/6h dark (18˚C) cycles and 80% relative humidity. The different tissue samples were gathered to carry out the gene expression analysis, which included roots, stems, leaves, shoots, petioles, flowers, buds, sepals, petals, stamens, pistils, pedicles, immature, mature green, breaker, and 5-day breaker. All the tissue samples were immediately frozen in liquid nitrogen and stored at −80˚C.</p></sec><sec id="s2_2"><title>2.2. Vector Construction and Transformation</title><p>The full length of SlbZIP39 CDS without the stop codon was amplified with a primer (<xref ref-type="table" rid="table1">Table 1</xref>). The PCR fragments were cloned, then digested by NotI and SbfI and cloned into the K303 expression vector (Gateway technology) under the CaMV 35S promoter. This construction was transformed into Solanum lycopersicum L., cv. Micro-Tom by Agrobacterium tumefaciens strain GV3101 [<xref ref-type="bibr" rid="scirp.124688-ref29">29</xref>] .</p></sec><sec id="s2_3"><title>2.3. RNA Isolation and Quantitative Real-Time PCR Analysis</title><p>Total RNA from different tissues was extracted by using the E.Z.N.A.&#174; Plant RNA Kit (Omega Bio-Tek, USA, R6827-01), according to the manufacturer’s instructions. cDNAs were synthesized with the Prime-Script<sup>TM</sup> RT reagent Kit with gDNA Eraser (Perfect Real Time) (TAKARA, Japan). Quantitative real-time PCR was performed according to the instructions provided for the Bio-Rad-CFX system (Bio-Rad, USA), using SYBR Green PCR Master Mix (CWBIO, China). The tomato UBI gene (Solyc07g064130) was used as an internal control for normalization. The relative quantification of gene expression levels was calculated by the comparative 2<sup>−∆∆CT</sup> method. All the primers used for the qRT-PCR were listed in <xref ref-type="table" rid="table1">Table 1</xref>. The experiments are repeated at least three times.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> List of the primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene Name</th><th align="center" valign="middle" >Forward primer</th><th align="center" valign="middle" >Reverse primer</th></tr></thead><tr><td align="center" valign="middle" >SlbZIP39 SlUBI-Q SlbZIP39-Q SlbZIP04-Q SlbZIP07-Q SlbZIP10-Q SlbZIP34-Q</td><td align="center" valign="middle" >ATGTCTTCGACTCCGCACT GCCGACTACAACATCCAGAAGG TGTCTTCGACTCCGCACTTG ACATGGCTTCGACTCAGCAA GTGCGGCACAGAACAATGTG GTGAACTTAGCCGTAGGCTTGAG TCATGGTGGTTGATGAAAGGA</td><td align="center" valign="middle" >AAACTGGAACATATCAGAAGCAGT TGCAACACAGCGAGCTTAACC GTTCTGGTTCTGCAGCTGTG CACGCCAGATAGTGCTCTGA TAGGCTGCATTGCACAAGGA CATAATGGGTTGATTGGCAGATAG TGTGTTGTCATGGTGATGCTG</td></tr></tbody></table></table-wrap></sec><sec id="s2_4"><title>2.4. Abiotic Stress and Hormone Treatments</title><p>Tomato seedlings were grown in a greenhouse under the same conditions, and all the treatments were conducted using one-month-old plants. For abiotic stress treatments, the plants were sprayed with 100 mM D-mannitol and 200 mM NaCl. For the hormone treatments, the plants were sprayed with 100 &#181;M ABA, GA3, and IAA solutions. For the dehydration assay, leaves and fruits were left on a piece of dry filter paper at 25˚C &#177; 1˚C, and then all samples were collected at the designated time. All the samples were harvested at 0 h, 3 h, 6 h, 12 h, and 24 h after each treatment. The harvested samples at 0 h were used as control and stored at −80˚C. For each treatment, samples were collected from 6 plants, mixed and all the experiments were performed at least three times.</p></sec><sec id="s2_5"><title>2.5. Statistical Analysis</title><p>Statistical analysis was conducted using Prism-6 (GraphPad, San Diego, CA, USA). All the experiments were repeated three times, and all the data was calculated as the expression of mean &#177; standard error. Comparisons between the two groups were performed using Student’s t-tests. The significance values of (*P &lt; 0.05; **P &lt; 0.01) were considered to be compared between wild-type and transgenic plants.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Expression Patterns of SlbZIP39 Induced by Abiotic and Hormonal Stresses</title><p>Previous reports have indicated that SlbZIP transcription factors are involved in abiotic and biotic stresses [<xref ref-type="bibr" rid="scirp.124688-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref25">25</xref>] . We therefore analyzed the transcript levels of SlbZIP39 in leaves under abiotic and hormonal stress. The transcripts of SlbZIP39 are not only induced by NaCl and D-mannitol treatments but also affected by IAA, GA3, and ABA treatments (<xref ref-type="fig" rid="fig1">Figure 1</xref> and <xref ref-type="fig" rid="fig2">Figure 2</xref>). In NaCl and D-mannitol treatments, however, the level of SlbZIP39 transcription was relatively down-regulated in NaCl but adequately up-regulated in D-mannitol treatment (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a) and <xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). During the dehydration treatments, we compared tomato leaves and fruits. The transcript of SlbZIP39 was expressed in tomato leaves and fruits but was slightly down-regulated at 3 h and 6 h and moderately up-regulated at 12 h and 24 h in leaves (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c) and <xref ref-type="fig" rid="fig1">Figure 1</xref>(d)). The level of SlbZIP39 transcription was significantly reduced during fruit dehydration treatments (<xref ref-type="fig" rid="fig1">Figure 1</xref>(d)). In the hormone treatments, the transcript level of SlbZIP39 was affected within 3 h to 24 h of IAA treatments, whereas it was up-regulated at 12 h and down-regulated at 3 h in tomato leaves (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)). The expression level of SlbZIP39 was up-regulated at 24 h and moderately induced at 3 h to 12 h in GA3 treatments (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)). However, the level of SlbZIP39 transcription was relatively responsive to ABA treatment and up-regulated at 3 h in leaves but declined at later intervals (<xref ref-type="fig" rid="fig2">Figure 2</xref>(c)). Here, we found that SlbZIP39 responded at the same time interval after treatments</p><p>but SlbZIP39 was more affected by NaCl, dehydration of fruits, GA3, and ABA than others. We inferred that SlbZIP39 in tomato may respond to abiotic stresses and hormonal treatments.</p></sec><sec id="s3_2"><title>3.2. Expression Profiles of SlbZIP39 Gene in Different Tissues of Tomato</title><p>We transgenically generated overexpression of SlbZIP39 under the 35S promoter in tomato plants. Transgenic tomato plants were obtained from three independent lines (L-1, L-4, L-9) (<xref ref-type="fig" rid="fig3">Figure 3</xref>(c)). Plant heights of one-month-old WT and OE were measured for physiological processes. The SlbZIP39 overexpressing plants showed decreased plant height compared to the wild-type (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a), <xref ref-type="fig" rid="fig3">Figure 3</xref>(b)). The expression profiles of SlbZIP39 in wild-type tomato were analyzed by qRT-PCR in various plant tissues, including roots, stems, leaves, shoots, flowers, buds, sepals, petals, stamens, and pistils, respectively (<xref ref-type="fig" rid="fig3">Figure 3</xref>(d)). The transcripts of SlbZIP39 are documented as moderately high in stems, leaves, shoots, petioles, flowers, buds, and pistils; the highest transcripts of SlbZIP39 accumulate in stamens, followed by petals and sepals. However, the lower expression level of SlbZIP39 was expressed in roots and pedicles (<xref ref-type="fig" rid="fig3">Figure 3</xref>(d)). Moreover, we analyzed fruit development stages by using qRT-PCR (<xref ref-type="fig" rid="fig3">Figure 3</xref>(e)). The expression profiles of SlbZIP39 in fruit developmental stages, consisting of immature green, mature green, and breaker stages, were explored. However, the transcripts of SlbZIP39 were highly expressed at the immature green stage (IM), followed by the mature green stage (MG) and the breaker stage (Br, Br5) (<xref ref-type="fig" rid="fig3">Figure 3</xref>(e)). These results showed that SlbZIP39 may affect plant architecture and fruit development processes.</p></sec><sec id="s3_3"><title>3.3. Phenotypical Characters of SlbZIP39 Overexpressing in Tomato Plants</title><p>The objectives of this study were to document and compare WT and OE plants under normal conditions. Numerous physiological parameters were measured, including plant height, flowering times, fruit weight, fruit length, and seed number, respectively. The SlbZIP39 overexpression plant showed earlier flowering times than the WT (<xref ref-type="fig" rid="fig4">Figure 4</xref>(c)). In addition, the fruit size of SlbZIP39-OE was smaller than the WT fruits (<xref ref-type="fig" rid="fig4">Figure 4</xref>(d)). In tomato, SlbZIP39 overexpression of fruit was decreased in fruit weight, fruit diameter, and the number of seeds compared to WT (Figures 4(e)-(g)). In our results, overexpression of SlbZIP39 significantly differed in fruit weight, seed numbers, and inflorescence architecture (<xref ref-type="fig" rid="fig4">Figure 4</xref>). These data suggest that overexpression of SlbZIP39 may regulate seed number and fruit development in tomato.</p></sec><sec id="s3_4"><title>3.4. Tissue Specificity of SlbZIP Genes Expression Patterns during Fruits Development</title><p>Fruit development can be identified in several stages according to the number of days after anthesis and color. So, we investigated the expression levels of four SlbZIP genes in SlbZIP39-OE and WT at different fruit developmental stages. To verify the specific expression of SlbZIP39, the expression levels of SlbZIP04 (Solyc01g079480.2), SlbZIP07 (Solyc01g100460.2), SlbZIP10 (Solyc01g109880.2)</p><p>and SlbZIP34 (Solyc04g080740.1) were analyzed but they belong to group IV and contain sequences with close homology to SlbZIP39, as indicated in the phylogenetic tree database [<xref ref-type="bibr" rid="scirp.124688-ref30">30</xref>] . In our results, SlbZIP04 and SlbZIP07 mRNA levels were significantly up-regulated at IM and MG fruit stages, whereas they were moderately up-regulated at Br and Br-5 fruit stages than in WT (<xref ref-type="fig" rid="fig5">Figure 5</xref>(a) and <xref ref-type="fig" rid="fig5">Figure 5</xref>(b)). In addition, SlbZIP10 transcript levels were abundantly up-regulated at MG and Br compared to WT fruit (<xref ref-type="fig" rid="fig5">Figure 5</xref>(c)). SlbZIP10 expression was slightly up-regulated at IM and Br-5 than in WT fruit (<xref ref-type="fig" rid="fig5">Figure 5</xref>(c)). Furthermore, SlbZIP34 transcripts were up-regulated at Br and had similar expression patterns in IM, MG, and Br-5 than in WT fruit developmental stages (<xref ref-type="fig" rid="fig5">Figure 5</xref>(d)). Significantly, SlbZIP04 and SlbZIP10 mRNA levels were predominantly up-regulated by SlbZIP39-OE and WT in fruit developmental stages (<xref ref-type="fig" rid="fig5">Figure 5</xref>(a) and <xref ref-type="fig" rid="fig5">Figure 5</xref>(c)). The transcript levels of the SlbZIP transcription factor</p><p>were predominantly different fruit developmental stages between SlbZIP39-OE and wild-type. These results assume that SlbZIP39 may be concerned with the expression patterns of closely related bZIP genes.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>A number of bZIP transcription factors in plant growth and development are key processes that may participate in responses to environmental stresses. Abscisic acid (ABA) is a universal plant hormone because of its significant effects on the regulation of plant growth and development [<xref ref-type="bibr" rid="scirp.124688-ref31">31</xref>] . Nevertheless, the role of bZIP transcription factors has been involved in oxidative stress, light-dependent, and unfolded protein responses in all eukaryotes [<xref ref-type="bibr" rid="scirp.124688-ref32">32</xref>] .</p><p>In tomato, SlAREB1 and SlAREB2 function in response to abiotic and biotic stresses, and may act as a link between ABA signal responses and other plant hormones; SlAREB1 improves resistance to deficit and salt stress [<xref ref-type="bibr" rid="scirp.124688-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref4">4</xref>] . Overexpression of LebZIP2 might have been involved in tolerance to herbicide and oxidative stress and cell development of Nicotiana benthamiana [<xref ref-type="bibr" rid="scirp.124688-ref33">33</xref>] . However, expression of LebZIP2 was increased by NaCl and mannitol treatments, whereas, it responded to ABA treatment [<xref ref-type="bibr" rid="scirp.124688-ref25">25</xref>] . The transcripts of SlbZIP38 and SlbZIP1 were expressed by NaCl, ABA, and GA treatments in tomato [<xref ref-type="bibr" rid="scirp.124688-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref6">6</xref>] . Furthermore, overexpression of MusabZIP53 was strongly increased by drought stress and ABA treatment in bananas [<xref ref-type="bibr" rid="scirp.124688-ref34">34</xref>] . Similarly, the expression level of SlbZIP39 responded to NaCl treatment in tomato (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). Besides, SlbZIP39 was slightly induced by D-mannitol treatment in tomato leaves (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). The present work revealed that the expression of SlbZIP39 was also up-regulated as GA3 treatment, whereas it responded to IAA and ABA treatment (Figures 2(a)-(c)). Additionally, overexpression of ABF2 has been shown to induce ABA sensitivity and dehydration tolerance in Arabidopsis [<xref ref-type="bibr" rid="scirp.124688-ref35">35</xref>] . In our research, we performed experiments to document the dehydration tolerance of fruits compared with leaves but they were affected by dehydration treatments (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c) and <xref ref-type="fig" rid="fig1">Figure 1</xref>(d)). The transcript level of SlbZIP39 was down-regulated by the dehydration of fruits (<xref ref-type="fig" rid="fig1">Figure 1</xref>(d)). This indicated that transcription factors of SlbZIP39 may respond to abiotic stress and hormone treatments in tomato.</p><p>In expression analysis, SlbZIP39 was detected in the different tissues of tomato (<xref ref-type="fig" rid="fig3">Figure 3</xref>). We observed that expression patterns of SlbZIP39 were abundantly induced by sepals, petals, and stamens tissues (<xref ref-type="fig" rid="fig3">Figure 3</xref>(d)). The transcript of SlbZIP39 is expressed in immature green fruits (<xref ref-type="fig" rid="fig3">Figure 3</xref>(e)). Previous reports documented that the expression patterns of SlbZIP38, SlbZIP1 and LebZIP2 were expressed in all tomato tissues [<xref ref-type="bibr" rid="scirp.124688-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref25">25</xref>] . Moreover, overexpression of CabZIP1 is expressed in flowers and is involved in the plant development of Arabidopsis [<xref ref-type="bibr" rid="scirp.124688-ref36">36</xref>] . In Arabidopsis, the overexpression of AtbZIP3 and AtbZIP24 stimulated plant development [<xref ref-type="bibr" rid="scirp.124688-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref37">37</xref>] . Furthermore, overexpression of MubZIP53 has been linked to banana growth retardation [<xref ref-type="bibr" rid="scirp.124688-ref34">34</xref>] . In the present study, overexpression of SlbZIP39 decreased plant growth in tomato (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a) and <xref ref-type="fig" rid="fig3">Figure 3</xref>(b)). At the mRNA level, SlbZIP39 was expressed in all tomato tissues (<xref ref-type="fig" rid="fig3">Figure 3</xref>(d) and <xref ref-type="fig" rid="fig3">Figure 3</xref>(e)). Therefore, we suggest that it might be involved in the regulation of plant growth and development in tomato.</p><p>In our study, overexpression of SlbZIP39 developed in the inflorescence of tomato (<xref ref-type="fig" rid="fig4">Figure 4</xref>(a)). In addition to the significant decrease in fruit weight, fruit diameter, and seed number, the number of inflorescence in overexpressing SlbZIP39 was increased, whereas the flowering time was earlier, compared to the wild-type (Figures 4(b)-(g)). SlAGO7 overexpression is involved in tomato inflorescence architecture [<xref ref-type="bibr" rid="scirp.124688-ref38">38</xref>] . In tomato, SlGRAS24 and SlGRAS40 responded to fruit sizes in the overexpression line [<xref ref-type="bibr" rid="scirp.124688-ref39">39</xref>] [<xref ref-type="bibr" rid="scirp.124688-ref40">40</xref>] . Moreover, the silencing of SlGRAS2 is affected by smaller fruit sizes in tomato [<xref ref-type="bibr" rid="scirp.124688-ref41">41</xref>] . Overexpression of SlAGL11 was dramatically influenced by tomato fruit size [<xref ref-type="bibr" rid="scirp.124688-ref42">42</xref>] . The transcription factor SlAREB1 is expressed in fruit tissues and is involved in the fruit development of tomato [<xref ref-type="bibr" rid="scirp.124688-ref43">43</xref>] . In this study, we found that overexpression of SlbZIP39 may be involved in fruit and seed development (<xref ref-type="fig" rid="fig4">Figure 4</xref>(d) and <xref ref-type="fig" rid="fig4">Figure 4</xref>(g)). For qPCR analysis, we performed the expression levels of SlbZIP04, SlbZIP07, SlbZIP10, and SlbZIP34 (Group IV) during fruit development (<xref ref-type="fig" rid="fig5">Figure 5</xref>). The transcripts of SlbZIP04 and SlbZIP07 were up-regulated at IM and MG fruit stages (<xref ref-type="fig" rid="fig5">Figure 5</xref>(a) and <xref ref-type="fig" rid="fig5">Figure 5</xref>(b)). Furthermore, SlbZIP10 and SlbZIP34 were predominantly up-regulated at the Br fruit stage (<xref ref-type="fig" rid="fig5">Figure 5</xref>(c) and <xref ref-type="fig" rid="fig5">Figure 5</xref>(d)). These data suggest that SlbZIP39 may be involved in the expression patterns of closely related bZIP genes.</p></sec><sec id="s5"><title>5. Conclusion</title><p>In this study, we cloned and performed abiotic and hormonal treatments on tomato plants expressing SlbZIP39 under greenhouse conditions. Our results have showed that evaluating the effects of overexpressing plants and wild-type fruits at developmental stages is related to bZIP transcription factors. We analyzed Group-IV bZIP transcription factors in tomato and expressed them in fruit developmental stages. However, overexpression of SlbZIP39 was necessary to further confirm the transcription levels of the fruit size gene in tomato. Our experimental results revealed that overexpression of SlbZIP39 might be regulated by fruit size and plant architecture.</p></sec><sec id="s6"><title>Acknowledgements</title><p>We would like to thank my supervisor, Professor Zhengguo Li from the School of Life Sciences, Chongqing University. I am greatly thankful to the Government of Myanmar, and China Scholarship Council (CSC) for their permission for my Ph.D. degree.</p></sec><sec id="s7"><title>Authors’ Contributions</title><p>Conceptualization, Y Y L, M K T and M M K; formal analysis, Y Y L and K H Y; investigation, Y Y L and M M K; data curation, Y Y L and M K T; writing-original draft preparation, Y Y L and K H Y; writing-review and editing, M K T and M M K; funding acquisition, Y Y L. All the authors have read and approved the final manuscript.</p></sec><sec id="s8"><title>Funding</title><p>This research was supported by the National Key Research and Development Program of China (No.2016YFD0400101), and the National Natural Science Foundation of China (Nos.3177270 and 31572175).</p></sec><sec id="s9"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest.</p></sec><sec id="s10"><title>Cite this paper</title><p>Lwin, Y.Y., Thu, M.K., Yee, K.H. and Khin, M.M. (2023) Effect of Overexpression of SlbZIP39 on Plant Architecture and Fruit Size in Tomato (Solanum lycopersicum L.). Open Access Library Journal, 10: e9969. https://doi.org/10.4236/oalib.1109969</p></sec><sec id="s11"><title>Abbreviations</title><p>ABA: Abscisic acid</p><p>bZIP: Basic leucine zipper</p><p>GA: Gibberellic acid</p><p>IAA: Indole-3-acetic acid</p><p>NaOCl: Sodium hypochlorite</p><p>MS: Murashige and Skoog</p><p>TF: Transcription factor</p><p>WT: Wild-type</p><p>OE: Overexpression</p><p>qRT-PCR: Quantitative Real-time PCR</p></sec></body><back><ref-list><title>References</title><ref id="scirp.124688-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Yoshida, T., Fujita, Y., Sayama, H., Kidokoro, S., Maruyama, K., Mizoi, J., et al. (2010) AREB1, AREB2, and ABF3 Are Master Transcription Factors That Cooperatively Regulate ABRE-Dependent ABA Signaling Involved in Drought Stress Tolerance and Require ABA for Full Activation. The Plant Journal, 61, 672-685.  
https://doi.org/10.1111/j.1365-313X.2009.04092.x</mixed-citation></ref><ref id="scirp.124688-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Barbosa, E.G.G., Leite, J.P., Marin, S.R.R., Marinho, J.P., et al. (2013) Overexpression of the ABA-Dependent AREB1 Transcription Factor from Arabidopsis thaliana Improves Soybean Tolerance to Water Deficit. Plant Molecular Biology Reporter, 31, 719-730. https://doi.org/10.1007/s11105-012-0541-4</mixed-citation></ref><ref id="scirp.124688-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Wang, Z., Su, G., Li, M., Ke, Q., Kim, S.Y., Li, H., et al. (2016) Overexpressing Arabidopsis ABF3 Increases Tolerance to Multiple Abiotic Stresses and Reduces Leaf Size in Alfalfa. Plant Physiology &amp; Biochemistry, 109, 199-208.  
https://doi.org/10.1016/j.plaphy.2016.09.020</mixed-citation></ref><ref id="scirp.124688-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Sanagi, M., Lu, Y., Aoyama, S., Morita, Y., Mitsuda, N., Ikeda, M., et al. (2018) Sugar-Responsive Transcription Factor bZIP3 Affects Leaf Shape in Arabidopsis Plants. Plant Biotechnology, 35, 167-170.  
https://doi.org/10.5511/plantbiotechnology.18.0410a</mixed-citation></ref><ref id="scirp.124688-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Assun&amp;atilde;o, A.G.L., Herrero, E., Lin, Y.F., Huettel, B., Talukdar, S., Smaczniak, C., et al. (2010) Arabidopsis thalianaa Transcription Factors bZIP19 and bZIP23 Regulate the Adaptation to Zinc Deficiency. The Proceedings of the National Academy of Sciences, 107, 10296-10301. https://doi.org/10.1073/pnas.1004788107</mixed-citation></ref><ref id="scirp.124688-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Shen, H., Cao, K. and Wang, X. (2008) AtbZIP16 and AtbZIP68, Two New Members of GBFs, Can Interact with Other G Group bZIPs in Arabidopsis thaliana. BMB Reports, 41, 132-138. https://doi.org/10.5483/BMBRep.2008.41.2.132</mixed-citation></ref><ref id="scirp.124688-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Hanson, J., Hanssen, M., Wiese, A., Hendriks, M.M.W.B. and Smeekens, S. (2008) The Sucrose Regulated Transcription Factor bZIP11 Affects Amino Acid Metabolism by Regulating the Expression of Asparagine Synthetase 1 and Proline Dehydrogenase 2. The Plant Journal, 53, 935-949.  
https://doi.org/10.1111/j.1365-313X.2007.03385.x</mixed-citation></ref><ref id="scirp.124688-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Matiolli, C.C., Tomaz, J.P., Duarte, G.T., Prado, F.M., et al. (2011) The Arabidopsis bZIP Gene AtbZIP63 Is a Sensitive Integrator of Transient Abscisic Acid and Glucose Signals. Plant Physiology, 157, 692-705. https://doi.org/10.1104/pp.111.181743</mixed-citation></ref><ref id="scirp.124688-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Zou, M., Guan, Y., Ren, H., Zhang, F. and Chen, F. (2008) A bZIP Transcription Factor, OsABI5, Is Involved in Rice Fertility and Stress Tolerance. Plant Molecular Biology, 66, 675-683. https://doi.org/10.1007/s11103-008-9298-4</mixed-citation></ref><ref id="scirp.124688-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Kang, J.Y., Choi, H.I., Im, M.Y. and Kim, S.Y. (2002) Arabidopsis Basic Leucine Zipper Proteins That Mediate Stress-Responsive Abscisic Acid Signaling. The Plant Cell, 14, 343-357. https://doi.org/10.1105/tpc.010362</mixed-citation></ref><ref id="scirp.124688-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Hsieh, W.P., Hsieh, H.L. and Wu, S.H. (2012) Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development. The Plant Cell, 24, 3997-4011. https://doi.org/10.1105/tpc.112.105478</mixed-citation></ref><ref id="scirp.124688-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Gao, S.Q., Chen, M., Xu, Z.S., Zhao, C.P., Li, L., Xu, H.J., et al. (2011) The Soybean GmbZIP1 Transcription Factor Enhances Multiple Abiotic Stress Tolerances in Transgenic Plants. Plant Molecular Biology, 75, 537-553.  
https://doi.org/10.1007/s11103-011-9738-4</mixed-citation></ref><ref id="scirp.124688-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Cifuentes-esquivel, N., Celiz-Balboa, J., Henriquez-Valencia, C., Mitina, I., Arrano-Salinas, P., Moreno, A.A., et al. (2018) bZIP17 Regulates the Expression of Genes Related to Seed Storage and Germination, Reducing Seed Susceptibility to Osmotic Stress. Journal of Cellular Biochemistry, 119, 6857-6868.  
https://doi.org/10.1002/jcb.26882</mixed-citation></ref><ref id="scirp.124688-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Seong, E.S., Kwon, S.S., Ghimire, B.K., Yu, C.Y., Cho, D.H., Lim, J.D., et al. (2008) LebZIP2 Induced by Salt and Drought Stress and Transient Overexpression by Agrobacterium. BMB Reports, 41, 693-698.  
https://doi.org/10.5483/BMBRep.2008.41.10.693</mixed-citation></ref><ref id="scirp.124688-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Yanez, M., Caceres, S., Orellana, S., Bastias, A., Verdugo, I., Ruiz-Lara, S. and Casaretto, J.A. (2009) An Abiotic Stress-Responsive bZIP Transcription Factor from Wild and Cultivated Tomatoes Regulates Stress-Related Genes. Plant Cell Reports, 28, 1497-1507. https://doi.org/10.1007/s00299-009-0749-4</mixed-citation></ref><ref id="scirp.124688-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Tu, M., Wang, X., Feng, T., Sun, X., Wang, Y., Huang, L., et al. (2016) Plant Science Expression of a Grape (Vitis vinifera) bZIP Transcription Factor, VlbZIP36, in Arabidopsis thaliana Confers Tolerance of Drought Stress during Seed Germination and Seedling Establishment. Plant Science, 252, 311-323.  
https://doi.org/10.1016/j.plantsci.2016.08.011</mixed-citation></ref><ref id="scirp.124688-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Tu, M., Wang, X., Zhu, Y., Wang, D., Zhang, X., Cui, Y., et al. (2017) VlbZIP30 of Grapevine Functions in Drought Tolerance via the Abscisic Acid Core Signaling Pathway. 1-56. https://doi.org/10.1101/231811</mixed-citation></ref><ref id="scirp.124688-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Fillatti, J.J., Kiser, J., Rose, R. and Comai, L. (1987) Efficient Transfer of a Glyphosate Tolerance Gene into Tomato Using a Binary Agrobacterium tumefaciens Vector. Biotechnology, 5, 726-730. https://doi.org/10.1038/nbt0787-726</mixed-citation></ref><ref id="scirp.124688-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Li, D., Fu, F., Zhang, H. and Song, F. (2015) Genome-Wide Systematic Characterization of the bZIP Transcriptional Factor Family in Tomato (Solanum lycopersicum L.). BMC Genomics, 16, Article No. 771. https://doi.org/10.1186/s12864-015-1990-6</mixed-citation></ref><ref id="scirp.124688-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Banerjee, A. and Roychoudhury, A. (2017) Abscisic-Acid-Dependent Basic Leucine Zipper bZIP Transcription Factors in Plant Abiotic Stress. Protoplasma, 254, 3-16.  
https://doi.org/10.1007/s00709-015-0920-4</mixed-citation></ref><ref id="scirp.124688-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Guedes Correa, L.G., Riano-Pachon, D.M., Guerra Schrago, C., Viicentini dos Santos, R., Mueller-Roeber, B., et al. (2008) The Role of bZIP Transcription Factors in Green Plant Evolution: Adaptive Features Emerging from Four Founder Genes. PLOS ONE, 3, e2944. https://doi.org/10.1371/journal.pone.0002944</mixed-citation></ref><ref id="scirp.124688-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Seong, E.S., Yoo, J.H., Kim, N.J., Choi, J.H., Lee, J.G., Ghimire, B.K., Chung, I.M. and Yu, C.Y. (2016) Morphological Changes and Increase of Resistance to Oxidative Stress by Overexpression of the LebZIP2 Gene in Nicotiana benthamiana. Russian Journal of Plant Physiolology, 63, 124-131.  
https://doi.org/10.1134/S1021443716010143</mixed-citation></ref><ref id="scirp.124688-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Shekhawat, U.K.S. and Ganapathi, T.R. (2014) Transgenic Banana Plants Overexpressing MusabZIP53 Display Severe Growth Retardation with Enhanced Sucrose and Polyphenol Oxidase Activity. Plant Cell, Tissue and Organ Culture, 116, 387-402. https://doi.org/10.1007/s11240-013-0414-z</mixed-citation></ref><ref id="scirp.124688-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Kim, S., Kang, J.Y., Cho, D.I., Park, J.H. and Kim, S.Y. (2004) ABF2, an ABRE-Binding bZIP Factor, Is an Essential Component of Glucose Signaling and Its Overexpression Affects Multiple Stress Tolerance. The Plant Journal, 40, 75-87.  
https://doi.org/10.1111/j.1365-313X.2004.02192.x</mixed-citation></ref><ref id="scirp.124688-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Lee, S.C., Choi, H.W., Hwang, I.S., Choi, D.S. and Hwang, B.K. (2006) Functional Roles of the Pepper Pathogen-Induced bZIP Transcription Factor, CAbZIP1, in Enhanced Resistance to Pathogen Infection and Environmental Stresses. Planta, 224, 1209-1225. https://doi.org/10.1007/s00425-006-0302-4</mixed-citation></ref><ref id="scirp.124688-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Yang, O., Popova, O.V., Süthoff, U., Lüking, I., Dietz, K. and Golldack, D. (2009) The Arabidopsis Basic Leucine Zipper Transcription Factor AtbZIP24 Regulates Complex Transcriptional Networks Involved in Abiotic Stress Resistance. Gene, 436, 45-55. https://doi.org/10.1016/j.gene.2009.02.010</mixed-citation></ref><ref id="scirp.124688-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Lin, D., Xiang, Y., Xian, Z. and Li, Z. (2016) Ectopic Expression of SlAGO7 Alters Leaf Pattern and Inflorescence Architecture and Increases Fruit Yield in Tomato. Physiologia Plantarum, 157, 490-506. https://doi.org/10.1111/ppl.12425</mixed-citation></ref><ref id="scirp.124688-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Huang, W., Peng, S., Xian, Z., Lin, D., Hu, G., Yang, L., Ren, M. and Li, Z. (2017) Overexpression of a Tomato miR171 Target Gene SlGRAS24 Impacts Multiple Agronomical Traits via Regulating Gibberellin and Auxin Homeostasis. Plant Biotechnology Journal, 15, 472-488. https://doi.org/10.1111/pbi.12646</mixed-citation></ref><ref id="scirp.124688-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Liu, Y., Huang, W., Xian, Z., Hu, N., Lin, D., Ren, H., Chen, J., Su, D. and Li, Z. (2017) Overexpression of SlGRAS40 in Tomato Enhances Tolerance to Abiotic Stresses and Influences Auxin and Gibberellin Signaling. Frontiers in Plant Science, 8, 1659. https://doi.org/10.3389/fpls.2017.01659</mixed-citation></ref><ref id="scirp.124688-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Li, M., Wang, X., Li, C., Li, H., Zhang, J. and Ye, Z. (2018) Silencing GRAS2 Reduces Fruit Weight in Tomato. Journal of Integrative Plant Biology, 60, 498-513.  
https://doi.org/10.1111/jipb.12636</mixed-citation></ref><ref id="scirp.124688-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Huang, B., Routaboul, J.M., Liu, M., Deng, W., Maza, E., Mila, I., et al. (2017) Overexpression of the Class D MADS-Box Gene Sl-AGL11 Impacts Fleshy Tissue Differentiation and Structure in Tomato Fruits. Journal of Experimental Botany, 68, 4869-4884. https://doi.org/10.1093/jxb/erx303</mixed-citation></ref><ref id="scirp.124688-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Bastias, A., Yanez, M., Osorio, S., Arabona, V., Gomez-Cadenas, A., Fernie, A.R. and Casaretto, J.A. (2014) The Transcription Factor AREB1 Regulates Primary Metabolic Pathways in Tomato Fruits. Journal of Experimental Botany, 65, 2351-2363.  
https://doi.org/10.1093/jxb/eru114</mixed-citation></ref><ref id="scirp.124688-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Liu, J., Chen, N., Chen, F., Cai, B., Santo, S.D., Tornielli, G.B., et al. (2014) Genome Wide Analysis and Expression Profile of the bZIP Transcription Factor Gene Family in Grapevine (Vitis vinifera). BMC Genomics, 15, Article No. 281.  
http://www.biomedcentral.com/1471-2164/15/281  
https://doi.org/10.1186/1471-2164-15-281</mixed-citation></ref><ref id="scirp.124688-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, M., Liu, Y., Shi, H., Guo, M., Chai, M., He, Q., et al. (2018) Evolutionary and Expression Analyses of Soybean Basic Leucine Zipper Transcription Factor Family. BMC Genomics, 19, 159. https://doi.org/10.1186/s12864-018-4511-6</mixed-citation></ref><ref id="scirp.124688-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Wei, K., Chen, J., Wang, Y., Chen, Y., Chen, S., Lin, Y., et al. (2012) Genome-Wide Analysis of bZIP-Encoding Genes in Maize. DNA Research, 19, 463-476.  
https://doi.org/10.1093/dnares/dss026</mixed-citation></ref><ref id="scirp.124688-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Nijhawan, A., Jain, M., Tyagi, A.K. and Khurana, J.P. (2008) Genomic Survey and Gene Expression Analysis of the Basic Leucine Zipper Transcription Factor Family in Rice. Plant Physiology, 146, 333-350. https://doi.org/10.1104/pp.107.112821</mixed-citation></ref><ref id="scirp.124688-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Jakoby, M., Weisshaar, B., Droge-Laser, W., Vicente-carbajosa, J., Tiedemann, J., Kroj, T. and Parcy, F. (2002) bZIP Transcription Factors in Arabidopsis. Trends in Plant Science, 7, 106-111. https://doi.org/10.1016/S1360-1385(01)02223-3</mixed-citation></ref><ref id="scirp.124688-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Zhu, M., Meng, X., Cai, J., Li, G., Dong, T. and Li, Z. (2018) Basic Leucine Zipper Transcription Factor SlbZIP1 Mediates Salt and Drought Stress Tolerance in Tomato. BMC Plant Biology, 18, 83. https://doi.org/10.1186/s12870-018-1299-0</mixed-citation></ref><ref id="scirp.124688-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Pan, Y., Hu, X., Li, C., Xu, X., Su, C., Li, J., et al. (2017) SlbZIP38, a Tomato bZIP Family Gene Downregulated by Abscisic Acid, Is a Negative Regulator of Drought and Salt Stress Tolerance. Genes, 8, 402. https://doi.org/10.3390/genes8120402</mixed-citation></ref><ref id="scirp.124688-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Hsieh, T.H., Li, C.W., Su, R.C., Cheng, C.P., Sanjaya and Tsai, Y.C. (2010) A Tomato bZIP Transcription Factor, SlAREB, Is Involved in Water Deficit and Salt Stress Response. Planta, 231, 1459-1473. https://doi.org/10.1007/s00425-010-1147-4</mixed-citation></ref><ref id="scirp.124688-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Orellana, S., Ya&amp;ntilde;ez, M., Espinoza, A., Verdugo, I., González, E., Ruiz-Lara, S. and Casaretto, J.A. (2010) The Transcription Factor SlAREB1 Confers Drought, Salt Stress Tolerance and Regulates Biotic and Abiotic Stress-Related Genes in Tomato. Plant Cell &amp; Environment, 33, 2191-2208.  
https://doi.org/10.1111/j.1365-3040.2010.02220.x</mixed-citation></ref><ref id="scirp.124688-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, L., Zhang, L., Xia, C., Zhao, G., Liu, J., Jia, J. and Kong, X. (2015) A Novel Wheat bZIP Transcription Factor, TabZIP60, Confers Multiple Abiotic Stress Tolerances in Transgenic Arabidopsis. Physiologia Plantarum, 153, 538-554.  
https://doi.org/10.1111/ppl.12261</mixed-citation></ref><ref id="scirp.124688-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Alonso, R., O&amp;ntilde;ate-Sánehez, L., Weltmeier, F., et al. (2009) A Pivotal Role of the Basic Leucine Zipper Transcription Factor bZIP53 in the Regulation of Arabidopsis Seed Maturation Gene Expression Based on Heterodimerization and Protein Complex Formation. The Plant Cell, 21, 1747-1761.  
https://doi.org/10.1105/tpc.108.062968</mixed-citation></ref></ref-list></back></article>