<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2023.134011</article-id><article-id pub-id-type="publisher-id">AiM-124565</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  &lt;i&gt;Escherichia coli&lt;/i&gt; Pathotypes in Children with Acute Diarrhea in an Informal Settlement in Nairobi, Kenya
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Moureen</surname><given-names>Jepleting</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Winnie</surname><given-names>Mutai</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Victor</surname><given-names>Moses Musyoki</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Beatrice</surname><given-names>Oduor</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Charchil</surname><given-names>Ayodo</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Robert</surname><given-names>Mugoh</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Samuel</surname><given-names>Kariuki</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Sylvia</surname><given-names>Omulo</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib></contrib-group><aff id="aff4"><addr-line>Centre for Microbiology Research, Kenya Medical Research Institute, Nairobi, Kenya</addr-line></aff><aff id="aff1"><addr-line>Washington State University Global Health-Kenya, Nairobi, Kenya</addr-line></aff><aff id="aff5"><addr-line>Paul G. Allen School for Global Health, Washington State University, Pullman, USA</addr-line></aff><aff id="aff2"><addr-line>University of Nairobi Institute of Tropical and Infectious Diseases, Nairobi, Kenya</addr-line></aff><aff id="aff3"><addr-line>Department of Medical Microbiology, University of Nairobi, Kenya</addr-line></aff><pub-date pub-type="epub"><day>07</day><month>04</month><year>2023</year></pub-date><volume>13</volume><issue>04</issue><fpage>181</fpage><lpage>192</lpage><history><date date-type="received"><day>28,</day>	<month>March</month>	<year>2023</year></date><date date-type="rev-recd"><day>24,</day>	<month>April</month>	<year>2023</year>	</date><date date-type="accepted"><day>27,</day>	<month>April</month>	<year>2023</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Diarrhea is among the leading causes of morbidity and mortality in children aged &lt; 5 years globally. In underdeveloped countries, diarrheagenic 
  Escherichia coli (DEC) accounts for 30% - 40% of childhood diarrhea cases. To identify the pathotypes involved in diarrheal outbreaks in Kenya, we analyzed archived 
  E. coli isolates from children &lt; 5 years old presenting with diarrhoea at three outpatient facilities in an informal settlement between January 2017 and September 2018. 
  E. coli confirmation and antimicrobial susceptibility testing were done using the VITEK
  <sup>&#174;</sup>2 instrument. Pathotype identification was performed via conventional polymerase chain reaction. Of 175 
  E. coli isolates, 48 (27%) were DEC pathotypes, with enteroaggregative 
  E. coli (EAEC) predominating (71%, 34/48). Enterohemorrhagic (EHEC) and enteropathogenic 
  E. coli (EPEC) represented 19% and 10% of isolates, respectively. Enteroinvasive and enterotoxigenic pathotypes were not identified. All DEC isolates were susceptible to amikacin, ertapenem, imipenem, meropenem and tigecycline. Conversely, most (&gt;80%) isolates were resistant to ampicillin, ampicillin-sulbactam and sulfamethoxazole-trimethoprim. Half of all EAEC and EPEC strains were resistant to cefazolin while half of EHEC isolates were resistant to ciprofloxacin and moxifloxacin. In total, 18 resistance phenotypes were identified with “ampicillin-cefazolin-ampicillin/ sulbactam-sulfamethoxazole/trimethoprim” predominating (33%, 16/48). The majority (81%) of DEC isolates were multidrug-resistant, with extended-spectrum beta-lactamase production identified in 8% of these isolates. This study highlights the predominance of Enteroaggregative 
  E. coli and multidrug resistance of DEC pathotypes. Studying the epidemiology of diarrheal disease and antimicrobial resistance surveillance, will aid in identifying dominant etiological agents of diarrhea and newly emerging resistant strains in informal settlements.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;E. coli&lt;/i&gt; Pathotypes</kwd><kwd> Children</kwd><kwd> Diarrhoea</kwd><kwd> Informal Settlement</kwd><kwd> Multidrug Resistance</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Diarrhoea is the second leading cause of death among children &lt; 5 years of age. It accounts for one out of twenty seven child fatalities globally, with 80% of these occurring in low-middle-income countries [<xref ref-type="bibr" rid="scirp.124565-ref1">1</xref>] . In Kenya, diarrhoea is responsible for 17% of all childhood diseases, with children &lt; 5 years experiencing, on average, three incidences of diarrhoea annually [<xref ref-type="bibr" rid="scirp.124565-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref3">3</xref>] . The common etiologies of diarrhoea are bacteria, viruses, and parasites. Among bacteria, diarrheagenic Escherichia coli (DEC) strains are responsible for 30% - 40% of acute diarrhoea episodes, and drive periodic infections and diarrheal outbreaks worldwide [<xref ref-type="bibr" rid="scirp.124565-ref2">2</xref>] . The introduction of the rotavirus and cholera vaccines reduced the burden of diarrhea in children by 52% - 59% globally [<xref ref-type="bibr" rid="scirp.124565-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref5">5</xref>] . However, bacteria-associated diarrhea remains a problem in informal settlements, which have poor sanitation and hygiene, and variable access to vaccines.</p><p>Five common DEC pathotypes with distinct virulence and pathogenic characteristics have been described. These include enteroaggregative E. coli (EAEC), enterohemorrhagic E. coli (EHEC), enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), and enterotoxigenic E. coli (ETEC) [<xref ref-type="bibr" rid="scirp.124565-ref6">6</xref>] . These are associated with, among others, travellers’ diarrhoea, haemorrhagic colitis, haemolytic-uremic syndrome and acute and persistent diarrhoea [<xref ref-type="bibr" rid="scirp.124565-ref6">6</xref>] .</p><p>Antibiotic-resistant DEC isolates have been reported globally complicating the management of bacterial diarrhoea [<xref ref-type="bibr" rid="scirp.124565-ref7">7</xref>] . In Kenya, the first multidrug-resistant EAEC infection was reported in Malindi in 1997 [<xref ref-type="bibr" rid="scirp.124565-ref8">8</xref>] and is currently widely disseminated. Recent studies have reported high rates of resistance to ampicillin (AMP) and sulfamethoxazole/trimethoprim (SXT) among DEC strains [<xref ref-type="bibr" rid="scirp.124565-ref9">9</xref>] , indicating increased transmission and the possible emergence of novel resistant strains. Nevertheless, frequent monitoring of DEC pathotypes is not conducted, and diarrhoea infections are treated empirically, potentially enhancing the selection of resistant strains. Identifying these pathogens is critical, particularly in informal settlements where diarrhoea outbreaks are commonly reported [<xref ref-type="bibr" rid="scirp.124565-ref10">10</xref>] , and where inadequate sanitation, poor hygiene and limited access to clean water can enhance their transmission and maintenance [<xref ref-type="bibr" rid="scirp.124565-ref11">11</xref>] . This study investigated the DEC pathotypes associated with acute diarrhoea infections and their antimicrobial susceptibility profiles among children attending three outpatient healthcare facilities within the Mukuru informal settlement in Nairobi, Kenya, to guide the management of E. coli-related diarrhoea.</p></sec><sec id="s2"><title>2. Materials and Methods</title><p>Study population. We analysed archived E. coli isolates from stool samples of children aged &lt; 5 years, who presented with diarrhoea at three outpatient clinics—Mukuru Kwa Njenga, Mukuru Kwa Reuben, and Municipal County Council—located within the Mukuru informal settlement in Nairobi County. These children were enrolled in an enteric fever surveillance study [<xref ref-type="bibr" rid="scirp.124565-ref12">12</xref>] . E. coli isolates collected between January 2017 and September 2018 were included.</p><p>Isolate revival. Isolates were retrieved from −80˚C freezer and thawed at room temperature for 20 min. These were then plated on MacConkey agar (Oxoid, UK) and incubated at 37˚C for 18 h. Single colonies were obtained from each plate and sub-cultured on Mueller Hinton agar (Oxoid, UK) at 37˚C for 18 h. Confirmatory identification of pure isolates was done using the VITEK<sup>&#174;</sup>2 Gram-negative identification cards (Biomerieux, France).</p><p>DNA extraction. Once confirmed as E. coli, isolates were sub-cultured overnight on Mueller Hinton agar. Single colonies were collected from each plate and emulsified in 1 mL of Invitrogen DNase/RNase free water (Thermo Fisher Scientific, USA) in a sterile microcentrifuge tube and boiled at 95˚C for 12 min. Upon cooling, the suspension was centrifuged for 5 min at 15,366 &#215;g and 200 &#181;L of the supernatant containing DNA transferred into a sterile Eppendorf tube for downstream analyses.</p><p>Molecular analysis. The Applied Biosystems PCR machine (Thermo Fisher, USA) was used to amplify genes coding for elt (heat labile enterotoxins), est (heat stable enterotoxins), stx (shiga toxin), aggR (activator aggregative adherence regulator), aspU (secreted protein U gene), ipaH (invasion plasmid antigen), and eae (intimin) using select primers (<xref ref-type="table" rid="table1">Table 1</xref>). Polymerase chain reaction (PCR) was done following the protocol by Toma et al. [<xref ref-type="bibr" rid="scirp.124565-ref13">13</xref>] , i.e., initial denaturation at 94˚C, 30 s, 30 cycles of amplification at 94˚C for 30 s, annealing at 55˚C (EPEC), 53˚C (EAEC), 58˚C (EHEC), 56˚C (ETEC), 66˚C (EIEC) for 1 min, initial extension at 72˚C for 2 min, and final extension at 72˚C for 7 min. Clinical isolates containing DEC virulence genes were used as positive controls and E. coli ATCC 25922 was used as a negative control [<xref ref-type="bibr" rid="scirp.124565-ref10">10</xref>] .</p><p>Amplified PCR products were run on a 2.5% Hi-Res Standard Agarose gel (Agarose 0.5 &#215; Tris-borate-EDTA) for 1 h. The gel was stained using 0.5 &#181;g/mL ethidium bromide and visualized under an ultraviolet illuminator. PCR amplicon sizes were confirmed using a 1 kb Invitrogen ladder (Thermo Fisher, USA).</p><p>Antibiotic susceptibility testing. All DEC isolates were tested for susceptibility to 17 antibiotics—belonging to 11 antibiotic classes [<xref ref-type="bibr" rid="scirp.124565-ref16">16</xref>] —using the VITEK<sup>&#174;</sup>2 AST-GN71 cards. Interpretation of antibiotic susceptibility results was based on the 2020 Clinical and Laboratory Standards Institute (CLSI) guidelines [<xref ref-type="bibr" rid="scirp.124565-ref17">17</xref>] . Quality control testing for the VITEK<sup>&#174;</sup>2 cards was done using manufacturer</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Diarrheagenic E. coli pathotypes PCR primer sequences</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Pathotype</th><th align="center" valign="middle" >Target</th><th align="center" valign="middle" >Sequence</th><th align="center" valign="middle" >Size</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >EAEC</td><td align="center" valign="middle" >aggR<sup>ᶲ</sup></td><td align="center" valign="middle" >F: GTATACACAAAAGAAGGAAGC R: ACAGAATCGTCAGCATCAGC</td><td align="center" valign="middle" >254 bp</td></tr><tr><td align="center" valign="middle" >aspu<sup>†</sup></td><td align="center" valign="middle" >F: GCCTTTGCGGGTGGTAGCGG R: AACCCATTCGGTTAGAGCAC</td><td align="center" valign="middle" >282 bp</td></tr><tr><td align="center" valign="middle" >EHEC</td><td align="center" valign="middle" >stx<sup>†</sup></td><td align="center" valign="middle" >F: AGCTGCAAGTGCGGGTCTG R: TACGGGTTATGCCTGCAAGTTCAC</td><td align="center" valign="middle" >518 bp</td></tr><tr><td align="center" valign="middle" >EIEC</td><td align="center" valign="middle" >ipaH<sup>*</sup><sup> </sup></td><td align="center" valign="middle" >F: GTTCCTTGACCGCCTTTCCGATACCGC R: GCCGGTCAGCCACCCTCTGAGAGTAC</td><td align="center" valign="middle" >600 bp</td></tr><tr><td align="center" valign="middle" >EPEC</td><td align="center" valign="middle" >eae<sup>ᶲ</sup></td><td align="center" valign="middle" >F: CTGAACGGCGATTACGCGAA R: CCAGACGATACGATCCAG</td><td align="center" valign="middle" >881 bp</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >ETEC</td><td align="center" valign="middle" >est<sup>ᶲ</sup></td><td align="center" valign="middle" >F: TTAATAGCACCCGGTACAAGCAGG R: CCTGACTCTTCAAAAGAGAAAATTAC</td><td align="center" valign="middle" >147 bp</td></tr><tr><td align="center" valign="middle" >elt<sup>ᶲ</sup></td><td align="center" valign="middle" >F: TCTCTATGTGCATACGGAGC R: CCATACTGATTGCCGCAAT</td><td align="center" valign="middle" >322 bp</td></tr></tbody></table></table-wrap><p>Enteroaggregative-(EAEC), enterohemorrhagic-(EHEC), enteroinvasive-(EIEC), enteropathogenic-(EPEC) and enterotoxigenic E. coli (ETEC). <sup>ᶲ</sup> [<xref ref-type="bibr" rid="scirp.124565-ref13">13</xref>] , <sup>†</sup> [<xref ref-type="bibr" rid="scirp.124565-ref14">14</xref>] , * [<xref ref-type="bibr" rid="scirp.124565-ref15">15</xref>] .</p><p>recommended ATCC strains. Multidrug resistance was defined as resistance to at least one antibiotic in three or more antibiotic classes.</p><p>Data analysis. Data was analysed using frequency distributions and proportions for pathotypes and AST results on SPSS version 21 and Microsoft Excel Spreadsheet Software (2016).</p><p>Ethics statement. This study was approved by the Kenyatta National Hospital-University of Nairobi Ethics and Research Committee (P512/09/2020).</p></sec><sec id="s3"><title>3. Results</title><p>Diarrheagenic E. coli pathotypes</p><p>Of the 175 E. coli isolates analysed, 48 (27%) were pathogenic including 34 EAEC (71%), nine EHEC (19%), and five EPEC (10%). EIEC and ETEC pathotypes were not identified. Among EAEC isolates, only the aggR gene was detected.</p><p>Antibiotic susceptibility profiles of E. coli pathotypes</p><p>All DEC isolates were fully susceptible to amikacin, ertapenem, imipenem, meropenem and tigecycline. Most (&gt;80%) were resistant to ampicillin, ampicillin-sulbactam and sulfamethoxazole-trimethoprim. All EAEC and EPEC isolates were resistant to cefazolin while EHEC where &lt; 50% of isolates were. In general, &lt;30% of EAEC and EHEC isolates were resistant to ceftriaxone, cefepime, gentamycin and tobramycin; EPEC strains were susceptible to these antibiotics, and ciprofloxacin. All EHEC isolates were susceptible to nitrofurantoin (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><p>Resistance phenotypes</p><p>In total, 18 resistance phenotypes were identified among the 48 isolates (<xref ref-type="table" rid="table2">Table 2</xref>). The most common resistance phenotype was “AMP-CEZ-SAM-SXT”, which</p><disp-formula id="scirp.124565-formula10"><graphic  xlink:href="//html.scirp.org/file/2-2271917x2.png?20230427091338382"  xlink:type="simple"/></disp-formula><p>AMP, ampicillin; ATM, aztreonam; CIP, ciprofloxacin; CRO, ceftriaxone; CEZ, cefazolin; FEP, cefepime; NIT, nitrofurantoin; GEN, gentamicin; MXF, moxifloxacin; SAM, ampicillin-sulbactam; SXT, sulfamethoxazole-trimethoprim; TOB, tobramycin.</p><p><xref ref-type="fig" rid="fig1">Figure 1</xref>. Proportion of resistant diarrheagenic E. coli pathotypes identified among children &lt; 5 years old in the Mukuru informal settlement, Nairobi.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Resistance phenotypes of diarrheagenic E. coli isolates</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Resistance phenotype</th><th align="center" valign="middle" >EAEC N = 34 n (%)</th><th align="center" valign="middle" >EHEC N = 9 n (%)</th><th align="center" valign="middle" >EPEC N = 5 n (%)</th><th align="center" valign="middle" >Total N = 48 n (%)</th></tr></thead><tr><td align="center" valign="middle" >AMP-ATM-CIP-CRO-CEZ-FEP-MXF</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (11)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >AMP-ATM-CIP-CRO-CEZ-FEP-MXF-SAM-SXT</td><td align="center" valign="middle" >1 (3)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >AMP-ATM-CIP-CRO-CEZ-FEP-MXF-SXT</td><td align="center" valign="middle" >1 (3)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >AMP-CEZ-GEN-MXF-SAM-SXT-TOB</td><td align="center" valign="middle" >1 (3)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >AMP-CEZ-MXF-SAM</td><td align="center" valign="middle" >1 (3)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >AMP-CEZ-MXF-SAM-SXT</td><td align="center" valign="middle" >1 (3)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (20)</td><td align="center" valign="middle" >2 (4)</td></tr><tr><td align="center" valign="middle" >AMP-CEZ-NIT-GEN-SXT-TOB</td><td align="center" valign="middle" >1 (3)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >AMP-CEZ-NIT-MXF-SAM-SXT</td><td align="center" valign="middle" >1 (3)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >AMP-CEZ-NIT-SAM-SXT</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (20)</td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >AMP-CEZ-SAM-SXT</td><td align="center" valign="middle" >13 (38)</td><td align="center" valign="middle" >1 (11)</td><td align="center" valign="middle" >2 (40)</td><td align="center" valign="middle" >16 (33)</td></tr><tr><td align="center" valign="middle" >AMP-CIP-CEZ-GEN-MXF-SAM-SXT-TOB</td><td align="center" valign="middle" >4 (12)</td><td align="center" valign="middle" >1 (11)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >5 (10)</td></tr><tr><td align="center" valign="middle" >AMP-CIP-CEZ-MXF-SAM-SXT</td><td align="center" valign="middle" >4 (12)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >4 (8)</td></tr><tr><td align="center" valign="middle" >AMP-CIP-CRO-CEZ-FEP-MXF-SAM-TOB</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (11)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >AMP-CIP-MXF-SAM-SXT</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >2 (22)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >2 (4)</td></tr><tr><td align="center" valign="middle" >AMP-MXF-SAM-SXT</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (11)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >AMP-SAM-SXT</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (11)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (2)</td></tr><tr><td align="center" valign="middle" >CEZ</td><td align="center" valign="middle" >4 (12)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1 (20)</td><td align="center" valign="middle" >5 (10)</td></tr><tr><td align="center" valign="middle" >SXT</td><td align="center" valign="middle" >2 (6)</td><td align="center" valign="middle" >1 (11)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >3 (6)</td></tr></tbody></table></table-wrap><p>Enteroaggregative-(EAEC), enterohemorrhagic-(EHEC), enteroinvasive-(EIEC), enteropathogenic-(EPEC) and enterotoxigenic E. coli (ETEC). AMP, ampicillin; ATM, aztreonam; CIP, ciprofloxacin; CRO, ceftriaxone; CEZ, cefazolin; FEP, cefepime; NIT, nitrofurantoin; GEN, gentamicin; MXF, moxifloxacin; SAM, ampicillin-sulbactam; SXT, sulfamethoxazole-trimethoprim; TOB, tobramycin.</p><p>was observed in 33% of isolates, and was the only phenotype identified in all three pathotypes. “AMP-CIP-CEZ-GEN-MXF-SAM-SXT-TOB” and “CEZ” were the next most common phenotypes each accounting for a 10% representation. Overall, 81% of all DEC were multidrug-resistant. Four (8%) of the 48 isolates tested positive for ESBL-production two EAEC (6%, n = 34) and two EHEC (22%, n = 9) isolates.</p></sec><sec id="s4"><title>4. Discussion</title><p>Diarrheagenic E. coli are among the primary causes of diarrhea in low-middle-income countries [<xref ref-type="bibr" rid="scirp.124565-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref18">18</xref>] . The overall diarrhea burden associated with DEC is not well defined in Sub-Saharan Africa due to poor testing infrastructure [<xref ref-type="bibr" rid="scirp.124565-ref19">19</xref>] . This study reports a proportion of 27% of DEC, higher than what was previously reported in four provinces in Kenya, Zambia and South Africa [<xref ref-type="bibr" rid="scirp.124565-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref21">21</xref>] . However, this is lower than the proportions reported in Uganda and central regions of Kenya [<xref ref-type="bibr" rid="scirp.124565-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref23">23</xref>] . The distribution of DEC pathotypes varies geographically due to seasonal variations, animal interactions and poor sanitation and hygiene [<xref ref-type="bibr" rid="scirp.124565-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref24">24</xref>] . Moreover, host factors such as malnutrition and HIV status are associated with some DEC pathotypes [<xref ref-type="bibr" rid="scirp.124565-ref22">22</xref>] contributing to the regional and global variation of these pathotypes. The most effective therapy for DEC-related diarrhea is vaccination, but the immunological heterogeneity of the strains has, for instance, challenged the development of ETEC vaccine [<xref ref-type="bibr" rid="scirp.124565-ref25">25</xref>] .</p><p>Three E. coli pathotypes were associated with diarrhoea among children aged &lt; 5 years in our study population. EAEC was the common pathotype, consistent with previous studies in Kenya and Uganda [<xref ref-type="bibr" rid="scirp.124565-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref24">24</xref>] . EAEC is an emerging pathogen responsible for acute and persistent diarrhea across all ages worldwide [<xref ref-type="bibr" rid="scirp.124565-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref27">27</xref>] , although a higher prevalence is reported among young children in developing nations [<xref ref-type="bibr" rid="scirp.124565-ref28">28</xref>] . Poor sanitation, inadequate water supply and compromised hygiene—conditions that are prevalent in informal settlements and which promote recurrent diarrheal episodes among children—are some of the risk factors associated with EAEC infections in children [<xref ref-type="bibr" rid="scirp.124565-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref29">29</xref>] . Further, EAEC strains may persist in water for almost 60 days at standard storage temperatures, enhancing their transmission [<xref ref-type="bibr" rid="scirp.124565-ref29">29</xref>] .</p><p>EHEC, which was the second most common pathotype, is typically a zoonotic food-borne pathogen which causes bloody diarrhea and kidney failure through the expression of a Type III secretion system and Shiga toxins, respectively [<xref ref-type="bibr" rid="scirp.124565-ref30">30</xref>] . In India, living in close quarters with domestic animals has been associated with increased risk of EHEC infections in humans [<xref ref-type="bibr" rid="scirp.124565-ref31">31</xref>] . Environmental transmission could also be a source for EHEC infection in children especially during their explorative stages [<xref ref-type="bibr" rid="scirp.124565-ref32">32</xref>] . In the Mukuru informal settlement, only 23% and 12% of households keep cats and dogs, respectively, with &lt;10% owning livestock, suggesting that contact with domestic animals may not be a significant risk factor for EHEC infections in this setting [<xref ref-type="bibr" rid="scirp.124565-ref33">33</xref>] . Nevertheless, its comparatively lower detection relative to EAEC may indicate low-level exposure to animal faeces within the environment or an alternative exposure.</p><p>EPEC was the least reported pathotype in this study contrary to earlier studies done in Kenya, Nigeria, India, and Qatar [<xref ref-type="bibr" rid="scirp.124565-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref34">34</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref35">35</xref>] . EPEC is a recurrent agent of diarrhoea and is associated with high mortality among children age &lt; 11 months [<xref ref-type="bibr" rid="scirp.124565-ref36">36</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref37">37</xref>] . A previous study in four counties in Kenya reported an overall prevalence of 51% among children &lt; 5 years [<xref ref-type="bibr" rid="scirp.124565-ref20">20</xref>] suggesting that its epidemiology might be changing. This may explain the decreasing number of reports of its occurrence in industrialized countries than initially described [<xref ref-type="bibr" rid="scirp.124565-ref38">38</xref>] . In Kenya, the changing epidemiology may be attributed to overall improvements in water, sanitation, and hygiene, advocacy for exclusive breasting among infants and the introduction of zinc supplements for the management of childhood diarrhea [<xref ref-type="bibr" rid="scirp.124565-ref9">9</xref>] .</p><p>More than half of all DEC pathotypes were resistant to ampicillin, ampicillin-sulbactam, cefazolin and sulfamethoxazole-trimethoprim, consistent with previous studies in Kenya and Nigeria [<xref ref-type="bibr" rid="scirp.124565-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref39">39</xref>] . Most of these antibiotics are inexpensive oral formulations that are easily accessible and may thus be frequently used within this population. Further, most EHEC isolates were resistant to ciprofloxacin, an antibiotic to which increasing resistance has been reported among Salmonella sp. isolated in the same study area. This suggests possible gene transfer between bacteria in this setting and, possibly, antibiotic selective pressure [<xref ref-type="bibr" rid="scirp.124565-ref40">40</xref>] . In Kenya, antibiotic therapy for infant or childhood diarrhoea is recommended for the treatment of dysentery and salmonellosis, while oral rehydration solutions and zinc sulphate are recommended for the management of DEC-related diarrhoea [<xref ref-type="bibr" rid="scirp.124565-ref41">41</xref>] . However, low diagnostic capacities in low-middle income countries promote empiric treatment of childhood diarrhoea with antibiotics, which likely contributes to the emergence of resistant strains [<xref ref-type="bibr" rid="scirp.124565-ref42">42</xref>] . For informal settlements, where dense populations and unsanitary environmental conditions can facilitate the transmission of multidrug-resistant bacteria [<xref ref-type="bibr" rid="scirp.124565-ref43">43</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref44">44</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref45">45</xref>] , antibiotic stewardship efforts are best complemented with water, sanitation and hygiene interventions to reduce childhood diarrhea-related deaths.</p><p>We observed resistance—albeit low—to aminoglycosides (gentamicin and tobramycin), fluoroquinolones (ciprofloxacin and moxifloxacin) and a 4<sup>th</sup>-generation cephalosporin (cefepime) among EAEC and EHEC isolates, in contrast to studies in Kenya and Burkina Faso that reported complete susceptibility to these antibiotics [<xref ref-type="bibr" rid="scirp.124565-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref46">46</xref>] . Further, we found a low occurrence of ESBL-positive DEC pathotypes (in EHEC and EAEC only) unlike in the Burkina Faso and Uganda studies [<xref ref-type="bibr" rid="scirp.124565-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref46">46</xref>] . Even at low proportions, ESBL-producing E. coli are an important cause of life-threatening infections in informal settlements, whose spread is facilitated by poor sanitation and hygiene, hospitalization and indiscriminate antibiotic use which are prevalent is these settings [<xref ref-type="bibr" rid="scirp.124565-ref47">47</xref>] . Their occurrence, therefore, present a public health threat that necessitates interventions to curb further emergence and spread within communities.</p><p>The observed susceptibility to carbapenems and amikacin may be due to limited access to these antibiotics as they are not prescribed at outpatient clinics in Kenya. However, misuse of locally available β-lactam antibiotics such as ceftriaxone, ampicillin and amoxycillin may select for carbapenemase-expressing strains. For instance, hospital and community colonization with carbapenem resistant Enterobacterales have been recently reported in Kenya [<xref ref-type="bibr" rid="scirp.124565-ref16">16</xref>] , suggesting changing antimicrobial resistance trends that requires active surveillance, monitoring and antimicrobial stewardship in the community and hospital set ups.</p><p>Multidrug resistance was common among the DEC isolates, as has been shown in studies in Kenya, Qatar, Iran and Burkina Faso [<xref ref-type="bibr" rid="scirp.124565-ref34">34</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref48">48</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref49">49</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref50">50</xref>] . The observed resistance to penicillin, sulfonamide, cephalosporin, and quinolone drug combinations has been reported in other countries at variable levels [<xref ref-type="bibr" rid="scirp.124565-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref50">50</xref>] . Interestingly, recent studies in Kenya that involve DEC isolates have not reported multidrug resistance phenotypes that include cephalosporin and quinolone drug combinations [<xref ref-type="bibr" rid="scirp.124565-ref39">39</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref48">48</xref>] , suggesting the possible emergence of novel strains. In contrast, other studies in Africa have reported multidrug-resistant phenotypes that involved penicillin, sulfonamide, colistin and tetracycline drug combinations [<xref ref-type="bibr" rid="scirp.124565-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref39">39</xref>] [<xref ref-type="bibr" rid="scirp.124565-ref46">46</xref>] . Since our antibiotic panel did not include colistin and tetracycline we did not identify these phenotypes and cannot, therefore, confirm their presence in our study population.</p><p>Our study had a few limitations. By using archived isolates, we were unable to collect other data (e.g., participant demographics, persistent vs. acute diarrhea, location, antibiotic use, or coinfections) that may have helped to explain the observed findings. Further, the isolates analyzed in this study were collected from sick children who presented themselves at the study facilities, who represent a non-random subset of the population living in the Mukuru informal settlement. Consequently, our results may not be generalizable the entire child population in this setting. Lastly, given that the DEC strains isolated may have been a secondary cause of diarrhea among the enrolled children, we were unable to conclusively assess the severity of these pathogens in this population. Longitudinal cohort studies that include a randomized population of children may be best suited to address these limitations.</p></sec><sec id="s5"><title>5. Conclusion</title><p>This study found that EAEC contributes most to DEC-related diarrheal infections among children living in the Mukuru informal settlement in Kenya. The presence of multidrug resistant strains, particularly phenotypes that are resistant to cephalosporin and quinolone drug combinations, suggests that enhanced water, sanitation, and hygiene programs remain the best strategy for preventing the emergence and spread of diarrhoeal diseases in these settings. Understanding the epidemiology of diarrheal disease and improving antimicrobial resistance surveillance can help identify the etiological agents of diarrhea and identify newly emerging resistant strains before they disseminate widely. This will inform targeted treatment guidelines for better management of childhood diarrhea and form a basis for future vaccine interventions.</p></sec><sec id="s6"><title>Acknowledgements</title><p>We acknowledge the Centre for Microbiology Research in KEMRI for providing the samples analyzed in this study, Washington State University Global Health-Kenya and the University of Nairobi for providing the resources to analyse these samples.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>Jepleting, M., Mutai, W., Musyoki, V.M., Oduor, B., Ayodo, C., Mugoh, R., Kariuki, S. and Omulo, S. (2023) Escherichia coli Pathotypes in Children with Acute Diarrhea in an Informal Settlement in Nairobi, Kenya. Advances in Microbiology, 13, 181-192. https://doi.org/10.4236/aim.2023.134011</p></sec></body><back><ref-list><title>References</title><ref id="scirp.124565-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2020) Children: Improving Survival and Well-Being. https://www.who.int/news-room/fact-sheets/detail/children-reducing-mortality</mixed-citation></ref><ref id="scirp.124565-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Saka, H.K., Dabo, N.T., Muhammad, B., García-Soto, S., Ugarte-Ruiz, M. and Alvarez, J. (2019) Diarrheagenic Escherichia coli Pathotypes from Children Younger than 5 Years in Kano State, Nigeria. Frontiers in Public Health, 7, Article 348. https://doi.org/10.3389/fpubh.2019.00348</mixed-citation></ref><ref id="scirp.124565-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Kenya National Bureau of Statistics (2008) Kenya Demographic and Health Survey 2008-2009.</mixed-citation></ref><ref id="scirp.124565-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Das, J.K., Tripathi, A., Ali, A., Hassan, A., Dojosoeandy, C. and Bhutta, Z.A. (2013) Vaccines for the Prevention of Diarrhea Due to Cholera, Shigella, ETEC and Rotavirus. BMC Public Health, 13, Article No. S11. https://doi.org/10.1186/1471-2458-13-S3-S11</mixed-citation></ref><ref id="scirp.124565-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Burnett, E., Parashar, U.D. and Tate, J.E. (2020) Global Impact of Rotavirus Vaccination on Diarrhea Hospitalizations and Deaths among Children &lt; 5 Years Old: 2006-2019. The Journal of Infectious Diseases, 222, 1731-1739. https://doi.org/10.1093/infdis/jiaa081</mixed-citation></ref><ref id="scirp.124565-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Acosta, G.J., et al. (2016) Diarrheagenic Escherichia coli: Prevalence and Pathotype Distribution in Children from Peruvian Rural Communities. The American Journal of Tropical Medicine and Hygiene, 95, 574-579. https://doi.org/10.4269/ajtmh.16-0220</mixed-citation></ref><ref id="scirp.124565-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2017) Global Antimicrobial Resistance Surveillance System (GLASS) Report.</mixed-citation></ref><ref id="scirp.124565-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Sang, W.K., et al. (1997) Multidrug-Resistant Enteroaggregative Escherichia coli Associated with Persistent Diarrhea in Kenyan Children. Emerging Infectious Diseases, 3, 373-374.</mixed-citation></ref><ref id="scirp.124565-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Evalyne, K. (2017) Characterization and Antimicrobial Susceptibility Pattern of Diarrheagenic E. coli in Thika Level 5 Hospital. Master’s Thesis, Jomo Kenyatta University of Agriculture and Technology, Thika.</mixed-citation></ref><ref id="scirp.124565-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Nganga, G.W. (2018) Bacterial and Parasitic Co-Infections, Antimicrobial Susceptibility and ESBL Genes Carriage in Bacteria Isolated from Children below 5 Years with Diarrhea Attending Mukuru Slum Health Clinics. Master’s Thesis, Jomo Kenyatta University of Agriculture and Technology, Thika.</mixed-citation></ref><ref id="scirp.124565-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Nguyen, T.Y.C., et al. (2021) Diarrhoea among Children Aged under Five Years and Risk Factors in Informal Settlements: A Cross-Sectional Study in Cape Town, South Africa. International Journal of Environmental Research and Public Health, 18, Article 6043. https://doi.org/10.3390/ijerph18116043</mixed-citation></ref><ref id="scirp.124565-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Kariuki, S., et al. (2020) High Relatedness of Invasive Multi-Drug Resistant Non-Typhoidal Salmonella Genotypes among Patients and Asymptomatic Carriers in Endemic Informal Settlements in Kenya. PLOS Neglected Tropical Diseases, 14, e0008440. https://doi.org/10.1371/journal.pntd.0008440</mixed-citation></ref><ref id="scirp.124565-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Toma, C., et al., (2003) Multiplex PCR Assay for Identification of Human Diarrheagenic Escherichia coli. Journal of Clinical Microbiology, 41, 2669-2671. https://doi.org/10.1128/JCM.41.6.2669-2671.2003</mixed-citation></ref><ref id="scirp.124565-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Escherich, T. (1988) The Intestinal Bacteria of the Neonate and Breast-Fed Infant. Reviews of Infectious Diseases, 10, 1220-1225. https://doi.org/10.1093/clinids/10.6.1220</mixed-citation></ref><ref id="scirp.124565-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Kotloff, K.L., et al. (2012) The Global Enteric Multicenter Study (GEMS) of Diarrheal Disease in Infants and Young Children in Developing Countries: Epidemiologic and Clinical Methods of the Case/Control Study. Clinical Infectious Diseases, 55, S232-S245. https://doi.org/10.1093/cid/cis753</mixed-citation></ref><ref id="scirp.124565-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Ita, T., et al., (2022) Prevalence of Colonization with Multidrug-Resistant Bacteria in Communities and Hospitals in Kenya. Scientific Reports, 12, Article No. 22290. https://doi.org/10.1038/s41598-022-26842-3</mixed-citation></ref><ref id="scirp.124565-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Clinical &amp; Laboratory Standards Institute (2020) CLSI M100-ED29: 2021 Performance Standards for Antimicrobial Susceptibility Testing. 30th Edition.</mixed-citation></ref><ref id="scirp.124565-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2017) Diarrhoeal Disease.</mixed-citation></ref><ref id="scirp.124565-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Kariuki, S., Kering, K., Wairimu, C., Onsare, R. and Mbae, C. (2022) Antimicrobial Resistance Rates and Surveillance in Sub-Saharan Africa: Where Are We Now? Infection and Drug Resistance, 15, 3589-3609. https://doi.org/10.2147/IDR.S342753</mixed-citation></ref><ref id="scirp.124565-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Sang, W.K., Oundo, V. and Schnabel, D. (2012) Prevalence and Antibiotic Resistance of Bacterial Pathogens Isolated from Childhood Diarrhoea in Four Provinces of Kenya. The Journal of Infection in Developing Countries, 6, 572-578. https://doi.org/10.3855/jidc.2196</mixed-citation></ref><ref id="scirp.124565-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Chiyangi, H., et al. (2017) Identification and Antimicrobial Resistance Patterns of Bacterial Enteropathogens from Children Aged 0-59 Months at the University Teaching Hospital, Lusaka, Zambia: A prospective Cross Sectional Study. BMC Infectious Diseases, 17, Article No. 117. https://doi.org/10.1186/s12879-017-2232-0</mixed-citation></ref><ref id="scirp.124565-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Masiga, F., Kigozi, E., Najjuka, C.F., Kajumbula, H. and Kateete, D.P. (2022) Diarrhoeagenic Escherichia coli Isolated from Children with Acute Diarrhoea at Rakai Hospital, Southern Uganda. African Health Sciences, 22, 581-588. https://doi.org/10.4314/ahs.v22i1.67</mixed-citation></ref><ref id="scirp.124565-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Mbuthia, O.W., Mathenge, S.G., Oyaro, M.O. and Ng’ayo, M.O. (2018) Etiology and Pathogenicity of Bacterial Isolates: A Cross Sectional Study among Diarrheal Children below Five Years in Central Regions of Kenya. The Pan African Medical Journal, 31, Article 88. https://doi.org/10.11604/pamj.2018.31.88.15644</mixed-citation></ref><ref id="scirp.124565-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Shah, M., et al. (2016) Prevalence, Seasonal Variation, and Antibiotic Resistance Pattern of Enteric Bacterial Pathogens among Hospitalized Diarrheic Children in Suburban Regions of Central Kenya. Tropical Medicine and Health, 44, Article No. 39. https://doi.org/10.1186/s41182-016-0038-1</mixed-citation></ref><ref id="scirp.124565-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Qadri, F., et al. (2020) Safety and Immunogenicity of the Oral, Inactivated, Enterotoxigenic Escherichia coli Vaccine ETVAX in Bangladeshi Children and Infants: A Double-Blind, Randomised, Placebo-Controlled Phase 1/2 Trial. The Lancet Infectious Diseases, 20, 208-219. https://doi.org/10.1016/S1473-3099(19)30571-7</mixed-citation></ref><ref id="scirp.124565-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Olaniran, A.O., Kistnasamy, E.J. and Ramlal, P.S. (2017) An Ecological Study of Diarrhoeagenic E.coli Associated with Indiscriminate Waste Dumps and under Five Diarrhoea in Six Informal Settlements in Durban, eThekwini Municipality, South Africa. International Journal of Environment and Waste Management, 20, 300-323. https://doi.org/10.1504/IJEWM.2017.10011365</mixed-citation></ref><ref id="scirp.124565-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Raghavan, P.R., Roy, S., Thamizhmani, R. and Purushothaman, A.S. (2017) Diarrheagenic Escherichia coli Infections among the Children of Andaman Islands with Special Reference to Pathotype Distribution and Clinical Profile. Journal of Epidemiology and Global Health, 7, 305-308.</mixed-citation></ref><ref id="scirp.124565-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Rajan, A., et al. (2018) Novel Segment- and Host-Specific Patterns of Enteroaggregative Escherichia coli Adherence to Human Intestinal Enteroids. mBio, 9, e02419-17. https://doi.org/10.1128/mBio.02419-17</mixed-citation></ref><ref id="scirp.124565-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Vasudevan, P., Annamalai, T., Sartori, L., Hoagland, T. and Venkitanarayanan, K. (2003) Behavior of Enteroaggregative Escherichia coli in Bottled Spring and Mineral Water. Journal of Food Protection, 66, 497-500. https://doi.org/10.4315/0362-028X-66.3.497</mixed-citation></ref><ref id="scirp.124565-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Cameron, E.A., Curtis, M.M., Kumar, A., Dunny, G.M. and Sperandio, V. (2018) Microbiota and Pathogen Proteases Modulate Type III Secretion Activity in Enterohemorrhagic Escherichia coli. mBio, 9, e02204-18. https://doi.org/10.1128/mBio.02204-18</mixed-citation></ref><ref id="scirp.124565-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Shrivastava, A.K., Mohakud, N.K., Panda, S., Patra, S.D., Kumar, S. and Sahu, P.S. (2020) Major Enteropathogens in Humans, Domestic Animals, and Environmental Soil Samples from the Same Locality: Prevalence and Transmission Considerations in Coastal Odisha, India. Epidemiology and Health, 42, Article ID: e2020034. https://doi.org/10.4178/epih.e2020034</mixed-citation></ref><ref id="scirp.124565-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Ferens, W.A. and Hovde, C.J. (2011) Escherichia coli O157:H7: Animal Reservoir and Sources of Human Infection. Foodborne Pathogens and Disease, 8, 465-487. https://doi.org/10.1089/fpd.2010.0673</mixed-citation></ref><ref id="scirp.124565-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Mbae, C., et al. (2020) Factors Associated with Occurrence of Salmonellosis among Children Living in Mukuru Slum, an Urban Informal Settlement in Kenya. BMC Infectious Diseases, 20, Article No. 422. https://doi.org/10.1186/s12879-020-05134-z</mixed-citation></ref><ref id="scirp.124565-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Eltai, N.O., Al Thani, A.A., Al Hadidi, S.H., Al Ansari, K. and Yassine, H.M. (2020) Antibiotic Resistance and Virulence Patterns of Pathogenic Escherichia coli Strains Associated with Acute Gastroenteritis among Children in Qatar. BMC Microbiology, 20, Article No. 54. https://doi.org/10.1186/s12866-020-01732-8</mixed-citation></ref><ref id="scirp.124565-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Ifeanyi, C.I.C., Ikeneche, N.F., Bassey, B.E., Al-Gallas, N., Aissa, R.B. and Boudabous, A. (2015) Diarrheagenic Escherichia coli Pathotypes Isolated from Children with Diarrhea in the Federal Capital Territory Abuja, Nigeria. The Journal of Infection in Developing Countries, 9, 165-174. https://doi.org/10.3855/jidc.5528</mixed-citation></ref><ref id="scirp.124565-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Chen, H.D. and Frankel, G. (2005) Enteropathogenic Escherichia coli: Unravelling Pathogenesis. FEMS Microbiology Reviews, 29, 83-98. https://doi.org/10.1016/j.femsre.2004.07.002</mixed-citation></ref><ref id="scirp.124565-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Kotloff, K.L., et al. (2013) Burden and Aetiology of Diarrhoeal Disease in Infants and Young Children in Developing Countries (the Global Enteric Multicenter Study, GEMS): A Prospective, Case-Control Study. Lancet (London, England), 382, 209-222. https://doi.org/10.1016/S0140-6736(13)60844-2</mixed-citation></ref><ref id="scirp.124565-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Nataro, P.J. and Kaper, B.J. (2010) Diarrheagenic Escherichia coli. Journal of Clinical Microbiology, 68, 203-207.</mixed-citation></ref><ref id="scirp.124565-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Omondi, E. (2018) Prevalence, Virulence Factors and Drug Resistance of Enteroaggregative Escherichia coli Isolated from Children under Five Years Old in Kiambu County Hospital. Master’s Thesis, Kenyatta University, Nairobi.</mixed-citation></ref><ref id="scirp.124565-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Kariuki, S., et al. (2019) Multidrug-Resistant Nontyphoidal Salmonella Hotspots as Targets for Vaccine Use in Management of Infections in Endemic Settings. Clinical Infectious Diseases, 68, S10-S15. https://doi.org/10.1093/cid/ciy898</mixed-citation></ref><ref id="scirp.124565-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Ministry of Health Republic of Kenya (2016) Basic Pediatric Protocol. 4th Edition, 25.</mixed-citation></ref><ref id="scirp.124565-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Kariuki, S., Wairimu, C. and Mbae, C. (2021) Antimicrobial Resistance in Endemic Enteric Infections in Kenya and the Region, and Efforts towards Addressing the Challenges. The Journal of Infectious Diseases, 224, S883-S889. https://doi.org/10.1093/infdis/jiab457</mixed-citation></ref><ref id="scirp.124565-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Okeke, I.N., Lamikanra, A. and Edelman, R. (1999) Socioeconomic and Behavioral Factors Leading to Acquired Bacterial Resistance to Antibiotics in Developing Countries. Emerging Infectious Diseases, 5, 18-27. https://doi.org/10.3201/eid0501.990103</mixed-citation></ref><ref id="scirp.124565-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Mukokinya, M.A., Opanga, S., Oluka, M. and Godman, B. (2018) Dispensing of Antimicrobials in Kenya: A Cross-Sectional Pilot Study and Its Implications. Journal of Pharmacy Practice and Research, 7, 77-82. https://doi.org/10.4103/jrpp.JRPP_17_88</mixed-citation></ref><ref id="scirp.124565-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Omulo, S., et al. (2021) Carriage of Antimicrobial-Resistant Bacteria in a High-Density Informal Settlement in Kenya is Associated with Environmental Risk-Factors. Antimicrobial Resistance &amp; Infection Controlol, 10, Article No. 18. https://doi.org/10.1186/s13756-021-00886-y</mixed-citation></ref><ref id="scirp.124565-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Konaté, A., et al. (2017) Epidemiology and Antibiotic Resistance Phenotypes of Diarrheagenic Escherichia coli Responsible for Infantile Gastroenteritis in Ouagadougou, Burkina Faso. European Journal of Microbiology and Immunology, 7, 168-175. https://doi.org/10.1556/1886.2017.00014</mixed-citation></ref><ref id="scirp.124565-ref47"><label>47</label><mixed-citation publication-type="other" xlink:type="simple">Fulgenzio, C. et al. (2021) Impact of Prior Antibiotic Use in Primary Care on Escherichia coli Resistance to Third Generation Cephalosporins: A Case-Control Study. Antibiotics, 10, Article 451. https://doi.org/10.3390/antibiotics10040451</mixed-citation></ref><ref id="scirp.124565-ref48"><label>48</label><mixed-citation publication-type="other" xlink:type="simple">County, T., et al. (2016) Epidemiology of Antimicrobial Resistance among Escherichia coli Strains in Trans-Nzoia County, Kenya. Journal of Microbiology and Infectious Diseases, 6, 107-112.</mixed-citation></ref><ref id="scirp.124565-ref49"><label>49</label><mixed-citation publication-type="other" xlink:type="simple">Abbasi, E., Mondanizadeh, M., van Belkum, A. and Ghaznavi-Rad, E. (2020) Multi-Drug-Resistant Diarrheagenic Escherichia coli Pathotypes in Pediatric Patients with Gastroenteritis from Central Iran. Infection and Drug Resistance, 13, 1387-1396. https://doi.org/10.2147/IDR.S247732</mixed-citation></ref><ref id="scirp.124565-ref50"><label>50</label><mixed-citation publication-type="other" xlink:type="simple">Konaté, A., et al. (2017) Molecular Characterization of Diarrheagenic Escherichia coli in Children Less than 5 Years of Age with Diarrhea in Ouagadougou, Burkina Faso. European Journal of Microbiology and Immunology, 7, 220-228. https://doi.org/10.1556/1886.2017.00011</mixed-citation></ref></ref-list></back></article>