<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">GEP</journal-id><journal-title-group><journal-title>Journal of Geoscience and Environment Protection</journal-title></journal-title-group><issn pub-type="epub">2327-4336</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/gep.2023.112002</article-id><article-id pub-id-type="publisher-id">GEP-123206</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Rhizosphere Soil Fungal Diversity and Soil Physicochemical Properties of Different Vegetations in Tundra of Changbai Mountain
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ran</surname><given-names>Hao</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Li</surname><given-names>Yang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yihui</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Dalian Minzu University College of Environment and Bioresources, Dalian, China</addr-line></aff><aff id="aff2"><addr-line>Dalian Huali Jingang Pharmaceutical Co., Ltd., Dalian, China</addr-line></aff><pub-date pub-type="epub"><day>21</day><month>02</month><year>2023</year></pub-date><volume>11</volume><issue>02</issue><fpage>13</fpage><lpage>29</lpage><history><date date-type="received"><day>7,</day>	<month>January</month>	<year>2023</year></date><date date-type="rev-recd"><day>20,</day>	<month>February</month>	<year>2023</year>	</date><date date-type="accepted"><day>23,</day>	<month>February</month>	<year>2023</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  By studying the diversity and community structure of rhizosphere soil fungi of different plants in the tundra on the northern slope of Changbai Mountain, it provides theoretical support for the restoration of environmental degradation and in-depth study of fungal diversity in the tundra of Changbai Mountain. High-throughput sequencing technology was used to determine the ITS1 region of fungal amplicons, so as to analyze the diversity of fungal communities in the rhizosphere soil of six plants in the tundra of Changbai Mountain, and to analyze the correlation between the environment and the diversity and 
  richness of fungal communities in combination with relevant soil physical and chemical factors. The diversity and richness of fungal community in the rhizosphere soil of six plants in Changbai Mountain tundra were different. The Simpson and Shannon indexes of 
  Saxifraga stolonifera Curt were the highest, and the richness of fungal community in 
  Dryas octopetala was the highest. The analysis of fungal community composition showed that the fungal colonies in plant rhizosphere soil samples mainly belonged to Ascomycota and Basidiomycota, which were the main dominant phyla. 
  Mortierella, 
  Fusarium and Sordariomycetes are common fungal genera in the rhizosphere soil of six plants, but their abundances are different among different plants. Water content was negatively correlated with fungal diversity, and TP was positively correlated with fungal community diversity. There were some differences in the composition and diversity of rhizosphere soil fungal communities of six plants in Changbai Mountain tundra. Ascomycota and Basidiomycota were 
  the main soil fungal phyla in the rhizosphere of six plants in Changbai Moun
  tain tundra. The results could provide theoretical guidance for ecological protection of Changbai Mountain tundra.
 
</p></abstract><kwd-group><kwd>Changbai Mountain</kwd><kwd> Rhizosphere Soil</kwd><kwd> Fungal Diversity</kwd><kwd> Soil Environmental Factors</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Changbai Mountain is the highest mountain system in the eastern margin of Eurasia. The main peak Baiyun Peak is also the first peak in Northeast China. The only alpine tundra in Northeast China is of great significance for maintaining regional animal and plant habitats, biodiversity and regional ecological balance  (Wu et al., 2002) . However, the degradation of the tundra caused by climate problems is a serious problem facing the tundra at present. The ecosystem of the tundra is changing due to global warming, and forests have appeared in some places. This change may further aggravate global warming, which will change the physical and chemical properties and biodiversity of the tundra zone to some extent  (Bjorkman et al., 2018) . The tundra zone of Changbai Mountain is also facing the phenomenon of forest invasion of tundra zone, but there are still abundant tundra plants, which are the dominant plants in the tundra zone of the northern slope of Changbai Mountain and play an important role in maintaining the ecological balance of the tundra zone of Changbai Mountain  (Alexander et al., 2016) . Rhizosphere soil fungi are important components of soil-plant ecosystem  (Philippot et al., 2013) , composition and diversity of fungal community structure affect plant growth and development  (Coats &amp; Rumpho, 2014) . Although soil nutrients  (Zhou et al., 2017;   Leewis et al., 2022)  and water content  (Lin et al., 2021)  have a certain effect on soil microbial community structure. However, the characteristics of the soil itself and the root exudates of the vegetation have a greater impact on the fungal community structure and diversity  (Gao et al., 2021;   Hu et al., 2019) . Fungal diversity is of great significance in maintaining ecological balance, fungal diversity is closely related to climate, vegetation types and soil nutrients  (Huang et al., 2023) . By studying the diversity of different plant rhizosphere soil fungi, we can further understand the fungal community structure, but also conducive to understanding changes in the environment for the ecological restoration of Changbai Mountain tundra to provide theoretical support.</p><p>In recent years, high-throughput sequencing technology has been widely used in the study of fungal diversity and community structure with the advantages of high sequencing throughput and high accuracy  (Dong et al., 2017) .  Chen et al. (2021)  used high-throughput sequencing technology to explore the differences in fungal community composition in the rhizosphere soil of medicinal Yinxing from different producing areas.  Wu et al. (2021)  studied the rhizosphere and non-rhizosphere soils of Artemisia argyi, and found that there were some differences in the composition and diversity of fungal communities between rhizosphere and non-rhizosphere soils.  Zhang et al. (2021)  analyzed the fungal community diversity in rhizosphere soil of 6 halophytes in Ebinur Lake wetland and found that soil physical and chemical factors had significant effects on the fungal diversity in rhizosphere soil. At present, the study of forest soil fungal community in Changbai Mountain is more common in  Yao et al. (2007)  and  Yang et al. (2009) , However, there are few studies on soil fungal community diversity in Changbai Mountain tundra zone, and most of them focus on the effects of tourism  (Wang, 2022)  and human disturbance  (Zhang et al., 2022)  on soil fungal community. The use of high-throughput sequencing technology to analyze the same period in Changbai Mountain tundra different plant rhizosphere soil fungal community diversity and richness of research is rarely reported.</p><p>In this paper, the rhizosphere soils of six dominant plants, Orosta. chys fimbriata (Turcz.) Berg, Saxifraga stolonifera Curt, Dryas octopetala, Rhondodendron aureum, Vaccinium uliginosum, Rhondodendron confertissimum collected from the tundra zone of Changbai Mountain were studied. The diversity and community structure of fungi in rhizosphere soil of different plants were studied, and the correlation between environmental factors and them was analyzed. The potential influence mechanism of fungal community in rhizosphere soil of different vegetation on plant growth in tundra of Changbai Mountain was explored, which provided theoretical guidance for ecological environment protection in Changbai Mountain.</p></sec><sec id="s2"><title>2. Research Area and Research Methods</title><sec id="s2_1"><title>2.1. Overview of the Study Area</title><p>Changbai Mountain tundra is located at an altitude of more than 2000 m, belonging to the upper part of the volcanic vertebral body, cold and windy. It is covered with snow for at least six months of the year  (Wang et al., 2014) . According to the vegetation condition, the tundra belt is divided into two sub-belts. The upper tundra subzone is located at an altitude of more than 2300 m. The main features are cold and foggy, precipitation and wind. The average temperature was lower than −20˚C in January, 8˚C - 10˚C in July, and the frost-free period was less than 60 days. The soil is alpine desert soil. The lower tundra subzone is located at 2000 - 2300 m, cold and windy. The active accumulated temperature of ≥10˚C is 300˚C - 500˚C, and the annual precipitation is 1100 - 1300 mm, soil is alpine tundra soil and Mossy lichens mainly. The main plants are Orosta. chys fimbriata (Turcz.) Berg, Saxifraga stolonifera Curt, Dryas octopetala, Rhondodendron aureum, Vaccinium uliginosum, Rhondodendron confertissimum et al.  (Chen et al., 1983) .</p></sec><sec id="s2_2"><title>2.2. Sampling</title><p>In this study, three-point sampling method was used to sample the rhizosphere soil of six dominant plants in the tundra of Changbai Mountain in September 2022. The rhizosphere soil of six dominant plants, namely, Orosta. chys fimbriata (Turcz.) Berg, Saxifraga stolonifera Curt, Dryas occtopetala, Rhondodendron aureum, Vaccinium uliginosum, Rhondodendron confertissimum, was sampled at a fixed point. Specific sampling information is shown in <xref ref-type="table" rid="table1">Table 1</xref>. Three plant community areas were randomly selected for each plant, and the rhizosphere soil of three plants was selected for each community area. A total of 9 soil samples were collected for each plant. The 9 soil samples were mixed well as the rhizosphere soil samples of a plant, label after filling in sterile ziplock bag. Fungal Taxonomy Laboratory, College of Environment and Resources, Dalian Minzu University, Divide the soil sample into two parts: A natural air drying, grinding, 4 mm nylon sieve screening, determination of soil physical and chemical properties; the other is stored in a −80˚C refrigerator for high-throughput sequencing.</p></sec><sec id="s2_3"><title>2.3. Extraction of Soil Total DNA</title><p>Using the TGuide S96 Magnetic Soil/Stool DNA Kit (Tiangen Biotech (Beijing) Co. Ltd.) total DNA of soil samples was extracted with three replicates for each sample and diluted total DNA was used as template, Using standard specific primers for ITS1: ITS1F (CTTGGTCATTTAGAGGAAGTAA) R</p><p>(GCTGCGTTCTTCATCGATGC) Amplification.PCR reaction mixture (25 μL): 2 &#215; PCRmix 10 μL, Upstream and downstream primers 1 μL each, template 3 μL, Replenishment ddH<sub>2</sub>O to 25 μL. PCR reaction condition: 95˚C 5 min; 95˚C 30 s, 50˚C 30 s, 72˚C 40 s, 25 cycles; 72˚C 7 min. After detected by 1.8% agarose gel electrophoresis. Five PCR products belonging to the same sample were mixed</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Sampling information of tundra zone in Changbai Mountain</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sample names</th><th align="center" valign="middle" >Vegetation species</th><th align="center" valign="middle" >Longitude</th><th align="center" valign="middle" >Latitude</th><th align="center" valign="middle" >Season</th><th align="center" valign="middle" >Soi Type</th><th align="center" valign="middle" >ASL</th></tr></thead><tr><td align="center" valign="middle" >A1</td><td align="center" valign="middle" >Orosta. chys fimbriata (Turcz.) Berg</td><td align="center" valign="middle" >128.0772</td><td align="center" valign="middle" >42.0684</td><td align="center" valign="middle" >Summer</td><td align="center" valign="middle" >Tundra soils</td><td align="center" valign="middle" >2203 &#177; 5</td></tr><tr><td align="center" valign="middle" >B1</td><td align="center" valign="middle" >Saxifraga stolonifera Curt</td><td align="center" valign="middle" >128.0772</td><td align="center" valign="middle" >42.0685</td><td align="center" valign="middle" >Summer</td><td align="center" valign="middle" >Tundra soils</td><td align="center" valign="middle" >2117 &#177; 5</td></tr><tr><td align="center" valign="middle" >C1</td><td align="center" valign="middle" >Rhondodendron confertissimum</td><td align="center" valign="middle" >128.0771</td><td align="center" valign="middle" >42.0683</td><td align="center" valign="middle" >Summer</td><td align="center" valign="middle" >Tundra soils</td><td align="center" valign="middle" >2176 &#177; 5</td></tr><tr><td align="center" valign="middle" >D1</td><td align="center" valign="middle" >Vaccinium uliginosum</td><td align="center" valign="middle" >128.0774</td><td align="center" valign="middle" >42.0683</td><td align="center" valign="middle" >Summer</td><td align="center" valign="middle" >Tundra soils</td><td align="center" valign="middle" >2235 &#177; 5</td></tr><tr><td align="center" valign="middle" >E1</td><td align="center" valign="middle" >Dryas octopetala</td><td align="center" valign="middle" >128.0772</td><td align="center" valign="middle" >42.0684</td><td align="center" valign="middle" >Summer</td><td align="center" valign="middle" >Tundra soils</td><td align="center" valign="middle" >2206 &#177; 5</td></tr><tr><td align="center" valign="middle" >F1</td><td align="center" valign="middle" >Rhondodendron aureum</td><td align="center" valign="middle" >128.0774</td><td align="center" valign="middle" >42.0683</td><td align="center" valign="middle" >Summer</td><td align="center" valign="middle" >Tundra soils</td><td align="center" valign="middle" >2223 &#177; 5</td></tr></tbody></table></table-wrap><p>The different capital letter abbreviations represent different vegetation species. A1: Orosta. chys fimbriata (Turcz.) Berg; B1: Saxifraga stolonifera Curt; C1: Rhondodendron confertissimum; D1: Vaccinium uliginosum; E1: Dryas octopetala; F1: Rhondodendron aureum. The same as below.</p><p>evenly into one sample and sent to Qingdao Biomarker Technologies Technology Co., Ltd. for high-throughput sequencing.</p></sec><sec id="s2_4"><title>2.4. Soil Physical and Chemical Properties</title><p>The soil moisture content (SM), total nitrogen (TN), total phosphorus (TP), nitrate nitrogen (NO<sub>3</sub>), available phosphorus (AP) and ammonium nitrogen ( NH 4 + ) were measured by conventional soil analysis methods  (Chen, 2005;   Bao, 2018;   Li, 2008) .</p></sec><sec id="s2_5"><title>2.5. Bioinformatics Analysis</title><p>Data preprocessing after removing barcodes and primers, FLASH, QIIME, MOTHUR and other software were used to obtain valid data. OTUs were divided with a similarity of 0.97 and representative sequences were selected. Species annotation and statistics were performed on the representative sequences of OTUs. SPSS26.0 was used for data analysis and C Programming Language was used for drawing.</p></sec></sec><sec id="s3"><title>3. Results and Analysis</title><sec id="s3_1"><title>3.1. Sequencing Results of Soil Fungal Samples</title><p>After Illumina Novaseq high-throughput sequencing and optimization, a total of 453,217 effective sequences were obtained from fungi in rhizosphere soil samples of 6 plants. On the basis of an average of 75,536 Clean Reads generated by each sample, the samples were clustered and annotated to obtain 2981 ASVs (amplicon sequence variants).</p><p>According to the dilution curve (<xref ref-type="fig" rid="fig1">Figure 1</xref>), it can be seen that the curve tends to be gentle with the increase of the number of sequencing, that is, the number of new OTUs will not increase with the increase of sequencing depth, indicating that the test has obtained the vast majority of sample information, which can reflect the microbial community composition of soil samples, and the sequencing data is reasonable.</p></sec><sec id="s3_2"><title>3.2. Statistical Analysis of Fungal Community Richness Diversity</title><p>It can be seen from <xref ref-type="table" rid="table1">Table 1</xref> that the coverage rate of sequencing depth index of each sample was above 0.997, indicating that the sequencing amount was sufficient to cover the colony composition of the sample. After merging according to 97% similarity, the number of fungal OUTs in 6 groups of samples were 289, 524, 637, 913, 936 and 472, respectively, The Sequence of OUT Number in 6 Rhizosphere Soils in Changbai Mountain Tundra: XNM &gt; ZSYJ &gt; MZDJ &gt; HEC &gt; NPDJ &gt; WS. Alpha diversity was used to analyze the richness and diversity of fungal communities in the soil, and the richness index (Ace) of different plant rhizosphere fungal communities was ranked as follows: XNM &gt; ZSYJ &gt; MZDJ &gt; HEC &gt; NPDJ &gt; WS. Shannon’s diversity index and Simpson’s diversity index showed the following order: HEC &gt; WS &gt; XNM &gt; ZSYJ &gt; MZDJ &gt; NPDJ.</p><p>The results showed that the fungal diversity in the rhizosphere soil of Saxifraga stolonifera Curt was more abundant than that of Rhondodendron aureum at the same altitude, which may be due to the selectivity of Rhondodendron aureum roots to rhizosphere soil fungi  (Li, 2017) . Rhondodendron aureum rhizosphere growth reduced the diversity of soil fungi, so that the types of soil fungal communities tend to be single, and the number of species decreased.</p></sec><sec id="s3_3"><title>3.3. Analysis of Soil Fungal Community Structure</title><p>Species composition analysis can reflect the community structure of samples at taxonomic level. As shown in <xref ref-type="table" rid="table2">Table 2</xref>, the fungi in the rhizosphere soil of the six Changbai Mountain tundra zones belong to 14 phyla, 51 classes, 113 orders, 239 families and 475 genera. (<xref ref-type="table" rid="table3">Table 3</xref>) As shown in <xref ref-type="fig" rid="fig2">Figure 2</xref>, Ascomycota and Basidiomycota were the main groups of rhizosphere soil of different plants in the six tundra zones of Changbai Mountain. The order of relative abundance was MZDJ (63.68%) &gt; HEC (54.68%) &gt; WS (50.62%) &gt; ZSYJ (44.21%) &gt; XNM (40.79%) &gt; NPDJ (14.46%) and NPDJ (67.96%) &gt; XNM (47.46%) &gt; ZSYJ (46.84%) &gt; MZDJ (31.13%) &gt; HEC (28.53%) &gt; WS (27.09%). Mortierellomycota comes second with a relative abundance of 1.5% to 10%. In addition, Fungi _ unclassified and other groups with relative abundance of about 3% - 8% were not clearly classified in GenBank. As shown in <xref ref-type="fig" rid="fig2">Figure 2</xref>, Agaricomycetes, Tremellomycetes, Eurotiomycetes, Sordariomycetes, Archaeorhizomycetes, Dothideomycetes and Mortierellomycetes are the dominant fungal groups in the soil community, The order of total relative abundance was MZDJ (87.62%) &gt; NPDJ (85.41%) &gt; XNM (74.53%) &gt; ZSYJ (63.47%) &gt; WS (59.36%) &gt; HEC (56.82%). In addition, Fungi _</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Rhizosphere soil fungal community richness and diversity index of six species in tundra of Changbai Mountain</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Plant</th><th align="center" valign="middle" >OUT</th><th align="center" valign="middle" >ACE</th><th align="center" valign="middle" >Chao1</th><th align="center" valign="middle" >Simpson</th><th align="center" valign="middle" >Shannon</th><th align="center" valign="middle" >PD_whole_tree</th><th align="center" valign="middle" >Coverage</th></tr></thead><tr><td align="center" valign="middle" >WS</td><td align="center" valign="middle" >289</td><td align="center" valign="middle" >289.0000</td><td align="center" valign="middle" >289.0000</td><td align="center" valign="middle" >0.9782</td><td align="center" valign="middle" >6.8355</td><td align="center" valign="middle" >70.1160</td><td align="center" valign="middle" >1.0000</td></tr><tr><td align="center" valign="middle" >HEC</td><td align="center" valign="middle" >524</td><td align="center" valign="middle" >524.4172</td><td align="center" valign="middle" >524.0000</td><td align="center" valign="middle" >0.9869</td><td align="center" valign="middle" >7.5808</td><td align="center" valign="middle" >111.0295</td><td align="center" valign="middle" >1.0000</td></tr><tr><td align="center" valign="middle" >MZDJ</td><td align="center" valign="middle" >637</td><td align="center" valign="middle" >643.2204</td><td align="center" valign="middle" >638.4468</td><td align="center" valign="middle" >0.9296</td><td align="center" valign="middle" >5.5522</td><td align="center" valign="middle" >99.7943</td><td align="center" valign="middle" >0.9998</td></tr><tr><td align="center" valign="middle" >ZSYJ</td><td align="center" valign="middle" >913</td><td align="center" valign="middle" >920.8701</td><td align="center" valign="middle" >913.8520</td><td align="center" valign="middle" >0.9754</td><td align="center" valign="middle" >6.6351</td><td align="center" valign="middle" >144.6320</td><td align="center" valign="middle" >0.9997</td></tr><tr><td align="center" valign="middle" >XNM</td><td align="center" valign="middle" >936</td><td align="center" valign="middle" >943.6074</td><td align="center" valign="middle" >937.0145</td><td align="center" valign="middle" >0.9776</td><td align="center" valign="middle" >6.7682</td><td align="center" valign="middle" >157.6711</td><td align="center" valign="middle" >0.9997</td></tr><tr><td align="center" valign="middle" >NPDJ</td><td align="center" valign="middle" >472</td><td align="center" valign="middle" >472.5118</td><td align="center" valign="middle" >472.9130</td><td align="center" valign="middle" >0.8090</td><td align="center" valign="middle" >4.5424</td><td align="center" valign="middle" >122.6454</td><td align="center" valign="middle" >0.9999</td></tr></tbody></table></table-wrap><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Statistical table of species of rhizosphere soil fungal community of six species</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Plant</th><th align="center" valign="middle" >Kindom</th><th align="center" valign="middle" >Phylum</th><th align="center" valign="middle" >Class</th><th align="center" valign="middle" >Order</th><th align="center" valign="middle" >Family</th><th align="center" valign="middle" >Genus</th><th align="center" valign="middle" >Species</th></tr></thead><tr><td align="center" valign="middle" >WS</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" >90</td><td align="center" valign="middle" >111</td><td align="center" valign="middle" >124</td></tr><tr><td align="center" valign="middle" >HEC</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >64</td><td align="center" valign="middle" >115</td><td align="center" valign="middle" >164</td><td align="center" valign="middle" >202</td></tr><tr><td align="center" valign="middle" >MZDJ</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >65</td><td align="center" valign="middle" >134</td><td align="center" valign="middle" >224</td><td align="center" valign="middle" >300</td></tr><tr><td align="center" valign="middle" >ZSYJ</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >36</td><td align="center" valign="middle" >80</td><td align="center" valign="middle" >155</td><td align="center" valign="middle" >265</td><td align="center" valign="middle" >373</td></tr><tr><td align="center" valign="middle" >XNM</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >40</td><td align="center" valign="middle" >85</td><td align="center" valign="middle" >173</td><td align="center" valign="middle" >295</td><td align="center" valign="middle" >406</td></tr><tr><td align="center" valign="middle" >NPDJ</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >36</td><td align="center" valign="middle" >66</td><td align="center" valign="middle" >127</td><td align="center" valign="middle" >172</td><td align="center" valign="middle" >203</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >51</td><td align="center" valign="middle" >113</td><td align="center" valign="middle" >239</td><td align="center" valign="middle" >475</td><td align="center" valign="middle" >744</td></tr></tbody></table></table-wrap><p>unclassified and other groups were not clearly classified in GenBank, and their relative abundance was ranked as WS (8.27%) &gt; HEC (7.46%) &gt; ZSYJ (3.25%) &gt; XNM (2.81%) &gt; MZDJ (2.26%) &gt; NPDJ (2.24%).</p></sec><sec id="s3_4"><title>3.4. Taxonomic Analysis of Fungal Flora in Rhizosphere Soil of Different Plants</title><p>R software was used to cluster the samples according to their abundance information in each soil treatment, and the classification units and samples were sorted according to the clustering results to draw a heat map. Through clustering, it is possible to distinguish between high abundance and low abundance taxa. Red and blue represent the abundance of the genus. The more biased red indicates the higher abundance, and the more biased blue indicates the lower abundance. The relative abundances of Monoblepharomycota, Aphelidiomycota, Blastocladiomycota, Zoopagomycota, Basidiomycota, Kickxellomycota, Chytridiomycota, Glomeromycota, Rozellomycota, Ascomycota, Mucoromycota and Unclassified unclassified fungi of soil fungi in 6 samples were displayed according to different colors by Heatmap. According to the relative abundance characteristics of fungi in 6 samples, the fungi were clustered according to the similarity of fungi. The highest similarity of fungi in Dryas octopetala and Rhondodendron confertissimum rhizosphere soil was clustered into the first category. and then clustered with Vaccinium uliginosum into the second category; the similarity between Orosta. chys fimbriata (Turcz.) Berg and Saxifraga stolonifera Curt</p><p>rhizosphere soil fungi was the closest to the third category. Rhondodendron aureum is a separate category.</p><p>According to <xref ref-type="fig" rid="fig3">Figure 3</xref>, the relative abundance of Glomeromycota in Orosta. chys fimbriata (Turcz.) Berg samples was the highest; the relative abundance of comb gate was the highest in Saxifraga stolonifera Curt samples. The relative abundance of Ascomycota was the highest in Rhondodendron confertissimum samples. Basidiomycete and Monoblepharomycota had the highest relative abundance in Vaccinium uliginosum samples. The relative abundance of Aphelidiomycota was the highest in Dryas octopetala samples. The relative abundance of Zoopagomycota and Blastocladia in Rhondodendron aureum was the highest. Therefore, the relative abundance and distribution of soil fungi varied greatly among different plants in the same natural zone  (Weber et al., 2015) .</p></sec><sec id="s3_5"><title>3.5. Correlation Analysis between Fungal Diversity and Environmental Factors</title><p>RDA (Redundancy analysis) is a ranking method based on the development of correspondence analysis. RDA is mainly used to reflect the relationship between flora or samples and environmental factors. Redundancy analysis showed that Cutaneotrichosporon and Trichosporon were negatively correlated with NH 4 + , Fusarium was positively correlated with moisture content and negatively correlated with TN and TP. Entoloma and Mortierella were negatively correlated with NO3 and positively correlated with NH 4 + . The rhizosphere soil moisture content of Saxifraga stolonifera Curt was the highest, and the fungal diversity index was also the highest, indicating that the moisture content could enrich the growth of fungi to a certain extent. Orosta. chys fimbriata (Turcz.) Berg and Rhondodendron aureum were significantly positively correlated with NH 4 + . Dryas octopetala and Vaccinium uliginosum were positively correlated with NO<sub>3</sub>. However, Rhondodendron confertissimum is positively correlated with TN and TP (<xref ref-type="fig" rid="fig4">Figure 4</xref>). Through correlation analysis, the relationship between fungal community diversity and environmental factors in rhizosphere soil of six plants was obtained. The results are shown in the table. The correlation between most environmental factors and diversity index of rhizosphere soil of six plants in tundra of Changbai Mountain was not significant. AP was positively correlated with Shannon index and negatively correlated with Simpson index. TP was positively correlated with Shannon, Simpson, Chao1 index, ACE index and OTU number. WC was negatively correlated with Shannon, Simpson, Chao1 index, ACE index and OTU number (<xref ref-type="table" rid="table4">Table 4</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion and Results</title><sec id="s4_1"><title>4.1. Diversity and Richness of Fungal Community in Rhizosphere Soil of 6 Plants in Tundra of Changbai Mountain</title><p>High throughput sequencing technology can analyze soil fungal colony information accurately, systematically and comprehensively  (Lou et al., 2018) . The diversity of fungal community in rhizosphere soil of 6 plant species in tundra of Changbai Mountain was analyzed by high-throughput sequencing technology. A total of 2981 OTUs were obtained, including 14 phyla, 51 classes, 113 orders, 239 families, 475 genera and 744 species. Trichosporonaceae, Entolomataceae, Archaeorhizomycetaceae, Mortierellaceae, Nectriaceae, debaryomycetaceae, etc. are dominant. Rhizosphere soil fungi of six different plants in Changbai Mountain tundra were analyzed. The results showed that the community structure and diversity of rhizosphere soil fungi of six different plants were different. The overall trend of community richness and diversity was XNM &gt; ZSYJ &gt; MZDJ &gt; HEC &gt; NPDJ &gt; WS. In community composition, the dominant phyla of fungi in rhizosphere soil of 6 plants were Basidiomycota and Ascomycota. The fungal communities in the rhizosphere soils of Orosta. chys fimbriata (Turcz.) Berg and Saxifraga stolonifera Curt were close to each other. The fungal communities in</p><p>the rhizosphere soils of Vaccinium uliginosum and Dryas octopetala were close to each other. However, the fungal community diversity in the rhizosphere soils of Rhondodendron aureum and Rhondodendron confertissimum was quite</p><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Correlation analysis between fungal diversity index and physicochemical properties species</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Indexes</th><th align="center" valign="middle" >Shannon</th><th align="center" valign="middle" >Simpson</th><th align="center" valign="middle" >Chao1</th><th align="center" valign="middle" >ACE</th><th align="center" valign="middle" >OTUs</th></tr></thead><tr><td align="center" valign="middle" >WC</td><td align="center" valign="middle" >−0.343</td><td align="center" valign="middle" >−0.229</td><td align="center" valign="middle" >−0.246</td><td align="center" valign="middle" >−0.325</td><td align="center" valign="middle" >−0.196</td></tr><tr><td align="center" valign="middle" >NOXN</td><td align="center" valign="middle" >−0.418</td><td align="center" valign="middle" >0.150</td><td align="center" valign="middle" >0.171</td><td align="center" valign="middle" >−0.054</td><td align="center" valign="middle" >0.246</td></tr><tr><td align="center" valign="middle" >AP</td><td align="center" valign="middle" >0.507</td><td align="center" valign="middle" >−0.400</td><td align="center" valign="middle" >−0.371</td><td align="center" valign="middle" >0.179</td><td align="center" valign="middle" >−0.164</td></tr><tr><td align="center" valign="middle" >TN</td><td align="center" valign="middle" >−0.332</td><td align="center" valign="middle" >0.343</td><td align="center" valign="middle" >0.300</td><td align="center" valign="middle" >−0.404</td><td align="center" valign="middle" >0.104</td></tr><tr><td align="center" valign="middle" >TP</td><td align="center" valign="middle" >0.382</td><td align="center" valign="middle" >0.232</td><td align="center" valign="middle" >0.179</td><td align="center" valign="middle" >0.032</td><td align="center" valign="middle" >0.125</td></tr><tr><td align="center" valign="middle" >NH4N</td><td align="center" valign="middle" >0.057</td><td align="center" valign="middle" >−0.357</td><td align="center" valign="middle" >−0.361</td><td align="center" valign="middle" >0.079</td><td align="center" valign="middle" >−0.09</td></tr></tbody></table></table-wrap><p>different. Selectivity of plant roots to rhizosphere fungi will lead to significant differences in community composition and structure of rhizosphere fungi  (Hartmann et al., 2009) . Plant roots have certain selectivity to rhizosphere soil fungi  (Jocrgensen &amp; Wichern, 2008) . The fungal diversity in the rhizosphere soil of Dryas octopetala was more abundant than that of Orosta. chys fimbriata (Turcz.) Berg, and different plants in the same natural zone still had selectivity to the fungal groups colonized in the rhizosphere  (Tang et al., 2018) .</p><p>Soil NH 4 + is an important environmental factor affecting fungal community structure, and has a significant effect on fungal growth and reproduction  (Zhang et al., 2021) . In this study, Cutaneotrichosporon and Trichosporon were negatively correlated with NH 4 + . Fusarium was positively correlated with moisture content and negatively correlated with TN and TP. Entoloma and Mortierella were negatively correlated with NO<sub>3</sub> and positively correlated with NH 4 + . The rhizosphere soil moisture content of Saxifraga stolonifera Curt was the highest, and the fungal diversity index was also the highest, indicating that the moisture content could enrich the growth of fungi to a certain extent. Orosta. chys fimbriata (Turcz.) Berg and Rhondodendron aureum were highly correlated with NH 4 + , showing a significant positive correlation. Dryas octopetala and Vaccinium uliginosum were positively correlated with NO<sub>3</sub>. Rhondodendron confertissimum was positively correlated with TN and TP. In this study, Mortierella was distributed in the rhizosphere soil of 6 plant species and the relative abundance was relatively high, which indicated that Mortierella had strong survival ability in alpine environment  (Telagathoti et al., 2021) .</p></sec><sec id="s4_2"><title>4.2. Relationship between Fungal Community Diversity and Environmental Factors in Rhizosphere Soil of Different Plants in Tundra of Changbai Mountain</title><p>The response of fungi to seasonal changes, soil physical and chemical properties and vegetation types is different, and soil environmental factors are the main factors affecting soil fungal diversity  (de Vries et al., 2006) . By analyzing the relationship between fungal diversity and soil environmental factors, it can indirectly reflect whether the soil is healthy, and has important guiding significance in the dynamic succession of soil fungal community and restoration of ecological environment  (Bridge &amp; Newsham, 2009) . It can also provide a solid theoretical basis for the ecological protection of Changbai Mountain tundra. The results of this study showed that water content was negatively correlated with fungal community diversity, which was consistent with the findings of Wang  (Wei et al., 2021)  that soil water content beyond the limit would limit the survival of fungi. This study found that TP was positively correlated with fungal community richness, which is similar to the existing results  (Yang et al., 2017) . This study found that soil NO<sub>3</sub> had a great influence on the dominant genera of fungi, which was similar to the results of Ding Jianli et al.  (Ding et al., 2017)  who found that soil NO<sub>3</sub> had an important effect on the composition of fungal community in black soil. Dominant bacteria are important factors in determining the balance of fungal community in plant rhizosphere soil and can affect the composition and structure of fungal community  (Luo et al., 2018) . Ascomycota are mostly saprophytic bacteria  (Yelle et al., 2008) . It can decompose hard-to-degrade substances such as lignin and keratin  (Grinhut et al., 2007) . Thus promoting soil nutrient cycling, improve soil quality, and alpine environment is very easy to grow  (Egidi et al., 2019) . At the phylum level, the fungi in the rhizosphere soil of the six plants were mainly Ascomycota, followed by Basidiomycota, indicating that the dominant flora was significantly affected by environmental factors, which was consistent with the results of Sun Qian et al.  (Feng et al., 2016)  and Gao Zhiyuan et al.  (Soka &amp; Ritchie, 2016) .</p></sec><sec id="s4_3"><title>4.3. Results</title><p>This study showed that NO<sub>3</sub> was negatively correlated with Mortierella, and positively correlated with Trichosporon, Candida humicola and Sordaria. TN and TP were positively correlated with Archaeorhizomyces. The water content was positively correlated with Fusarium, which indicated that the adaptability of fungi to the environment was different, and they were sensitive to the change of environmental factors, which led to the change of fungal community structure. Fungi play the role of decomposers, participate in the degradation of organic matter, soil nutrient transformation and circulation process, can increase soil fertility  (Soka &amp; Ritchie, 2016) . In this study, the ITS1 region of fungi in the rhizosphere soil of six tundra plants was sequenced, and it was proved that the dominant phylum of fungi in the root zone was Ascomycota, which could be used for the subsequent study of secondary metabolites of cold-resistant fungi to improve the survival threshold of alpine plants. This provides a new idea for maintaining ecological stability in the tundra of Changbai Mountain.</p></sec></sec><sec id="s5"><title>Acknowledgements</title><p>We thank the College of Environment and Resources of Dalian Minzu University for its strong support for this experiment, and thank Rui Sun and Yan Zhang for their help in sample collection and experimental operation.</p></sec><sec id="s6"><title>Authors’ Contributions</title><p>Hao Ran was responsible for the sample collection and pretreatment of the experiment. Yang Li prepared the soil physical and chemical factors and assisted Wang Yihui in the determination of soil physical and chemical factors.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>Hao, R., Yang, L., &amp; Wang, Y. H. (2023). Rhizosphere Soil Fungal Diversity and Soil Physicochemical Properties of Different Vegetations in Tundra of Changbai Mountain. Journal of Geoscience and Environment Protection, 11, 13- 29. https://doi.org/10.4236/gep.2023.112002</p></sec></body><back><ref-list><title>References</title><ref id="scirp.123206-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Alexander, J. M., Lembrechts, J. J., Cavieres, L. A. et al. (2016). Plant Invasions into Mountains and Alpine Ecosystems: Current Status and Future Challenges. Alpine Botany, 126, 89-103. https://doi.org/10.1007/s00035-016-0172-8</mixed-citation></ref><ref id="scirp.123206-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Bao, S. D. (2018). Soil Analysis in Agricultural Chemistry. China Agriculture Press. (In Chinese with English Abstract)</mixed-citation></ref><ref id="scirp.123206-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Bjorkman, A.-D., Myers-Smith, I.-H., Elmendorf, S.-C. et al. (2018). Plant Functional Trait Change across a Warming Tundra Biome. Nature, 562, 57-62. https://doi.org/10.1038/s41586-018-0563-7</mixed-citation></ref><ref id="scirp.123206-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Bridge, P.-D., &amp; Newsham, K.-K. (2009). Soil Fungal Community Composition at Mars Oasis, a southern Maritime Antarctic Site, Assessed by PCR Amplification and Cloning. Fungal Ecology, 2, 66-74. https://doi.org/10.1016/j.funeco.2008.10.008</mixed-citation></ref><ref id="scirp.123206-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Chen, L. X. (2005). Soil experiment and practice course. Harbin: Northeast Forestry University Press. (In Chinese with English abstract)</mixed-citation></ref><ref id="scirp.123206-ref6"><label>6</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Chen</surname><given-names> P.</given-names></name>,<name name-style="western"><surname> Yang</surname><given-names> C.-B.</given-names></name>,<name name-style="western"><surname> &amp; Zhang</surname><given-names> Y. </given-names></name>,<etal>et al</etal>. (<year>1983</year>)<article-title>. Ecogeographical Distribution of Soil Fauna in the Alpine Tundra of Northern Changbai Mountains</article-title><source> Forest Ecosystem Research</source><volume> 3</volume>,<fpage> 119</fpage>-<lpage>132</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.123206-ref7"><label>7</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Chen</surname><given-names> R.</given-names></name>,<name name-style="western"><surname> Liu</surname><given-names> Z.-Q.</given-names></name>,<name name-style="western"><surname> &amp; Wang</surname><given-names> D.-D. </given-names></name>,<etal>et al</etal>. (<year>2021</year>)<article-title>. Microbial Diversity of Rhizosphere Soil of Ginkgo Biloba from Different Habitats Was Compared Based on High-Throughput Sequencing</article-title><source> Pharmaceutical Biotechnology</source><volume> 28</volume>,<fpage> 117</fpage>-<lpage>122</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.123206-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Coats, V.-C., &amp; Rumpho, M.-E. (2014). The Rhizosphere Microbiota of Plant Invaders: An Overview of Recent Advances in the Microbiomics of Invasive Plants. Frontiers in Microbiology, 5, Article 368. https://doi.org/10.3389/fmicb.2014.00368</mixed-citation></ref><ref id="scirp.123206-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">de Vries, F.-T., Hoffland, E., van Eekeren, N. et al. (2006). Fungal/Bacterial Ratios in Grasslands with Contrasting Nitrogen Management. Soil Biology and Biochemistry, 38, 2092-2103. https://doi.org/10.1016/j.soilbio.2006.01.008</mixed-citation></ref><ref id="scirp.123206-ref10"><label>10</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Ding</surname><given-names> J.-L.</given-names></name>,<name name-style="western"><surname> Jiang</surname><given-names> X.</given-names></name>,<name name-style="western"><surname> Ma</surname><given-names> M.-C. et al. </given-names></name>,<etal>et al</etal>. (<year>2017</year>)<article-title>. Structure of Soil Fungal Communities under Long-Term Inorganic and Organic Fertilization in Black Soil of Northeast China</article-title><source> Journal of Plant Nutrition and Fertilizer</source><volume> 23</volume>,<fpage> 914</fpage>-<lpage>923</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.123206-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Dong, L., Xu, J., Zhang, L. et al. (2017). High-Throughput Sequencing Technology Reveals That Continuous Cropping of American Ginseng Results in Changes in the Microbial Community in Arable Soil. Chinese Medicine, 12, Article No. 18. https://doi.org/10.1186/s13020-017-0139-8</mixed-citation></ref><ref id="scirp.123206-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Egidi, E., Delgado-Baquerizo, M., Plett, J.-M. et al. (2019). A Few Ascomycota taxa Dominate Soil Fungal Communities Worldwide. Nature Communications, 10, Article No. 2369. https://doi.org/10.1038/s41467-019-10373-z</mixed-citation></ref><ref id="scirp.123206-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Feng, L., Liu, S., Wu, W. et al. (2016). Dominant Genera of Cyanobacteria in Lake Taihu and Their Relationships with Environmental Factors. Journal of Microbiology, 54, 468- 476. https://doi.org/10.1007/s12275-016-6037-4</mixed-citation></ref><ref id="scirp.123206-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Gao, Y., Liu, L., Zhu, P. et al. (2021). Patterns and Dynamics of the Soil Microbial Community with Gradual Vegetation Degradation in the Yellow River Delta, China. Wetlands, 41, Article No. 9. https://doi.org/10.1007/s13157-021-01414-9</mixed-citation></ref><ref id="scirp.123206-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Grinhut, T., Hadar, Y., &amp; Chen, Y. (2007). Degradation and Transformation of Humic Substances by Saprotrophic Fungi: Processes and Mechanisms. Fungal Biology Reviews, 21, 179-189. https://doi.org/10.1016/j.fbr.2007.09.003</mixed-citation></ref><ref id="scirp.123206-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Hartmann, A., Schmid, M., van Tuinen, D. et al. (2009). Plant-Driven Selection of Microbes. Plant and Soil, 321, 235-257. https://doi.org/10.1007/s11104-008-9814-y</mixed-citation></ref><ref id="scirp.123206-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Hu, H., Li, M., Wang, G. et al. (2019). Water-Soluble Mercury Induced by Organic Amendments Affected Microbial Community Assemblage in Mercury-Polluted Paddy Soil. Chemosphere, 236, Article ID: 124405. https://doi.org/10.1016/j.chemosphere.2019.124405</mixed-citation></ref><ref id="scirp.123206-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Huang, L., Hu, H., Bao, W. K. et al. (2023). Shifting Soil Nutrient Stoichiometry with Soil of Variable Rock Fragment Contents and Different Vegetation Types. Catena, 220, Article ID: 106717. https://doi.org/10.1016/j.catena.2022.106717</mixed-citation></ref><ref id="scirp.123206-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Jocrgensen, R.-G., &amp; Wichern, F. (2008). Quantitative Assessment of the Fungal Contribution to Microbial Tissue in Soil. Soil Biology and Biochemistry, 40, 2977-2991. https://doi.org/10.1016/j.soilbio.2008.08.017</mixed-citation></ref><ref id="scirp.123206-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Leewis, M.-C., Lawrence, C. R., Schulz, M. S., Tfaily, M. M., Ayala-Ortiz, C. O., Flores, G. E., Mackelprang, R., &amp; McFarland, J. W. (2022). The Influence of Soil Development on the Depth Distribution and Structure of Soil Microbial Communities. Soil Biology and Biochemistry, 174, Article ID: 108808. https://doi.org/10.1016/j.soilbio.2022.108808</mixed-citation></ref><ref id="scirp.123206-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Li, L. (2017). Study on Soil Microorganism of Subalpine Tundra in Changbai Mountain. PhD Thesis, Jilin University. (In Chinese with English abstract)</mixed-citation></ref><ref id="scirp.123206-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Li, Z.-G. (2008). [Soil and Environmental Microbial Research Method]. Science Press. (In Chinese with English abstract)</mixed-citation></ref><ref id="scirp.123206-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Lin, C., Li, X., Zhang, J. et al. (2021). Effects of Degraded Degradation of Alpine Wetland on Soil Organic Carbon and Total Nitrogen in the Yellow River Source Zone, West China. Journal of Mountain Science, 18, 694-705. https://doi.org/10.1007/s11629-020-6117-0</mixed-citation></ref><ref id="scirp.123206-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Lou, J., Yang, L., Wang, H. et al. (2018). Assessing Soil Bacterial Community and Dynamics by Integrated High-Throughput Absolute Abundance Quantification. PeerJ, 6, e4514. https://doi.org/10.7717/peerj.4514</mixed-citation></ref><ref id="scirp.123206-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Luo, X., Zhang, H.-Y., Liu, M.-Y. et al. (2018). Study Review on Microbial Community Diversity in Paddy Soils. Journal of Anhui Agricultural Sciences, 46, 42-43, 47. (In Chinese with English Abstract)</mixed-citation></ref><ref id="scirp.123206-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Philippot, L., Raaijmakers, J. M., Lemanceau, P. et al. (2013). Going Back to the Roots: The Microbial Ecology of the Rhizosphere. Nature Reviews Microbiology, 11, 789-799. https://doi.org/10.1038/nrmicro3109</mixed-citation></ref><ref id="scirp.123206-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Soka, G. E., &amp; Ritchie, M. E. (2016). Contributions of AM Fungi and Soil Organic Matter to Plant Productivity in Tropical Savanna Soils under Different Land Uses. Rhizosphere, 1, 45-52. https://doi.org/10.1016/j.rhisph.2016.06.004</mixed-citation></ref><ref id="scirp.123206-ref28"><label>28</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Tang</surname><given-names> D.-L.</given-names></name>,<name name-style="western"><surname> Tu</surname><given-names> X.-L.</given-names></name>,<name name-style="western"><surname> Fu</surname><given-names> C. et al. </given-names></name>,<etal>et al</etal>. (<year>2018</year>)<article-title>. Illumina Miseq Sequencing-Based Fungal Community of Rhizosphere Soils along Root of Ramie</article-title><source> Southwest China Journal of Agricultural Sciences</source><volume> 31</volume>,<fpage> 2160</fpage>-<lpage>2164</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.123206-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Telagathoti, A., Probst, M., &amp; Peintner, U. (2021). Habitat, Snow-Cover and Soil pH, Affect the Distribution and Diversity of Mortierellaceae Species and Their Associations to Bacteria. Frontiers in Microbiology, 12, Article 669784. https://doi.org/10.3389/fmicb.2021.669784</mixed-citation></ref><ref id="scirp.123206-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Wang, Y. (2022). Effects of Tourism Disturbance on Plant Diversity and Soil Microorganisms in Changbai Mountain Tundra. Master’s Thesis, Jilin University. (In Chinese with English abstract)</mixed-citation></ref><ref id="scirp.123206-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Wang, Z. H., Yin, X. Q., Jiang, Y. F. et al. (2014). Structure and Diversity of Soil Fauna Communities in the Tundra of the Changbai Mountains, China. Acta Ecologica Sinica, 34, 755-765. https://doi.org/10.5846/stxb201306081438</mixed-citation></ref><ref id="scirp.123206-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Weber, C. F., King, G. M., &amp; Aho, K. (2015). Relative Abundance of and Composition within Fungal Orders Differ between Cheatgrass (Bromus tectorum) and Sagebrush (Artemisia tridentata)-Associated Soils. PLOS ONE, 10, e0117026. https://doi.org/10.1371/journal.pone.0117026</mixed-citation></ref><ref id="scirp.123206-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Wei, X. T., Shi, Y. N., Qin, F. W. et al. (2021). Effects of Experimental Warming, Precipitation Increase and Their Interaction on AM Fungal Community in an Alpine Grassland of the Qinghai-Tibetan Plateau. European Journal of Soil Biology, 102, Article ID: 103272. https://doi.org/10.1016/j.ejsobi.2020.103272</mixed-citation></ref><ref id="scirp.123206-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Wu, G., Xiao, H., Zhao, J. et al. (2002). Forest Ecosystem Services of Changbai Mountain in China. Science In China Series C-Life Sciences, 45, 21-32. https://doi.org/10.1360/02yc9003</mixed-citation></ref><ref id="scirp.123206-ref35"><label>35</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Wu</surname><given-names> Q. F.</given-names></name>,<name name-style="western"><surname> Hou</surname><given-names> L. J.</given-names></name>,<name name-style="western"><surname> He</surname><given-names> L. M. et al. </given-names></name>,<etal>et al</etal>. (<year>2021</year>)<article-title>. Illumina Next-Generation Sequencing Analysis of Microbial Diversity in Rhizosphere and Non-Rhizosphere Soils of Artemisia vulgaris L</article-title><source> Journal of Henan Agricultural University</source><volume> 55</volume>,<fpage> 928</fpage>-<lpage>935</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.123206-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Yang, H., Liu, Z. H., Lv, G. Z., Yao, X. M., Qu, B., &amp; Ma, J. R. (2009). [Taxonomic Identification and Catalogue of Forest Soil Fungi on the North Slope of Changbai Mountain]. Jiangsu Agricultural Sciences, No. 3, 372-374. (In Chinese with English Abstract)</mixed-citation></ref><ref id="scirp.123206-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Yang, T., Adams, J.-M., Shi, Y. et al. (2017). Soil Fungal Diversity in Natural Grasslands of the Tibetan Plateau: Associations with Plant Diversity and Productivity. New Phytologist, 215, 756-765. https://doi.org/10.1111/nph.14606</mixed-citation></ref><ref id="scirp.123206-ref38"><label>38</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Yao</surname><given-names> X.-M.</given-names></name>,<name name-style="western"><surname> Lv</surname><given-names> G.-Z.</given-names></name>,<name name-style="western"><surname> Yang</surname><given-names> H. et al. </given-names></name>,<etal>et al</etal>. (<year>2007</year>)<article-title>. Studies of Fungal Flora in Forest Soil of Changbai Mountains</article-title><source> Journal of Fungal Research</source><volume> 5</volume>,<fpage> 43</fpage>-<lpage>46</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.123206-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Yelle, D.-J., Ralph, J., Lu, F.-C. et al. (2008). Evidence for Cleavage of Lignin by a Brown Rot Basidiomycete. Environmental Microbiology, 10, 1844-1849. https://doi.org/10.1111/j.1462-2920.2008.01605.x</mixed-citation></ref><ref id="scirp.123206-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, M., Zeng, G., Liang, D. et al. (2022). An Analysis of the Colony Structure of Prokaryotes in the Jialing River Waters in Chongqing. International Journal of Environmental Research and Public Health, 19, Article 5525. https://doi.org/10.3390/ijerph19095525</mixed-citation></ref><ref id="scirp.123206-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, S., Luo, P., Yang, J. et al. (2021). Responses of Arbuscular Mycorrhizal Fungi Diversity and Community to 41-Year Rotation Fertilization in Brown Soil Region of Northeast China. Frontiers in Microbiology, 12, Article 742651. https://doi.org/10.3389/fmicb.2021.742651</mixed-citation></ref><ref id="scirp.123206-ref42"><label>42</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Zhang</surname><given-names> X.</given-names></name>,<name name-style="western"><surname> Chen</surname><given-names> T.</given-names></name>,<name name-style="western"><surname> Niu</surname><given-names> Y. H. et al. </given-names></name>,<etal>et al</etal>. (<year>2021</year>)<article-title>. Research on Diversity of Fungi Community in Rhizosphere Soil of Six Halophytes in Ebinur Lake Wetland</article-title><source> Acta Microbiologica Sinica</source><volume> 61</volume>,<fpage> 3965</fpage>-<lpage>3976</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.123206-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, X.-Y. (2021). Effects of Disturbance on Aboveground Vegetation Diversity and Soil in Tundra Zone of Changbai Mountain. Master’s Thesis, Jilin University. (In Chinese with English Abstract)</mixed-citation></ref><ref id="scirp.123206-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Zhou, X., Guo, Z., Chen, C. et al. (2017). Soil Microbial Community Structure and Diversity Are Largely Influenced by Soil pH and Nutrient Quality in 78-Year-Old Tree Plantations. Biogeosciences, 14, 2101-2111. https://doi.org/10.5194/bg-14-2101-2017</mixed-citation></ref></ref-list></back></article>