Background: To preserve its nutritional properties, fish must have good sanitary quality. The objective of this study was to investigate some pathogens contaminating smoked, dried, and braised fish marketed in Ouagadougou.
Methodology: Potential pathogens of
Enterobacteriaceae and
Staphylococcus were screened in eight (8) species of processed fish. The investigation of the germs was carried out following the normative methods of microbiology. The identities of the strains were determined by API 20 E (BioMerieux S.A., France) and API STAPH (BioMerieux S.A., France) kits for
Enterobacteriaceae and
Staphylococcus species respectively. The
uidA gene profile in
Escherichia coli isolates was determined by simplex PCR. The identity of
Staphylococcus aureus was confirmed by amplification of specific 23S rDNA regions and
nuc gene profile with PCR.
Results: A total of 235 fish samples were analyzed. A diversity of
Enterobacteriaceae and
Staphylococcus was detected. Twenty species of
Enterobacteriaceae were identified among which, the most frequent were
Escherichia coli,
Salmonella sp,
Raoultella ornithinolytica and
Serratia odorifera, respectively in 22.6%, 4.3%, 28.9%, 17.4% of the samples analyzed. However, eleven species of
Staphylococcus were identified among which,
Staphylococcus xylosus,
Staphylococcus aureus,
Staphylococcus lugdunensis, and
Staphylococcus sciuri were the most frequent with respective percentages of 47.7%, 23.4%, 12.8% and 10.6% of samples. For all the samples, the species frequently isolated were:
Raoultella ornithinolytica,
Escherichia coli,
Serratia odorifera,
Staphylococcus aureus,
Staphylococcus xylosus, and
Staphylococcus lugdunensis. The
uidA gene specific to
Escherichia coli was detected in 82.85% of strains (29/35). Amplification of the specific 23S rDNA region using
staur primers was observed in 98% (49/50) of the isolated
Staphylococcus aureus strains and the
nuc gene was detected in 86% of
Staphylococcus aureus strains.
Conclusion: The isolated bacteria are potential pathogens involved in foodborne illnesses and intoxications. Effective sanitary safety systems must be implemented to guarantee the sanitary quality of fish supplied to consumers.
Fish Contamination <i>Enterobacteriaceae</i> <i>Staphylococcus</i> Phenotypic and Molecular Characterization Ouagadougou1. Introduction
Fish intake presents beneficial interests for human being. Indeed, fish is one of the healthiest foodstuffs on the earth and has the least negative impact on the natural environment [1] [2]. It is also a nutritious food that adds variety to the diet. The consumption of fish is in line with nutritional recommendations to restrict the consumption of fat and saturated fatty acids in the diet. Despite its well-appreciated nutritional qualities, the benefits of fish consumption are influenced by its sanitary quality. Therefore, post-capture, fish is a perishable food [3] [4] [5]. To reduce post-capture losses, people use processing techniques including smoking, drying, and salting [6] [7] [8]. These techniques improve the stability of fish and extend their shelf life [9] [10]. However, even smoked, dried, or salted, fish can spoil or be contaminated with chemicals or microbiological pathogens [11].
In addition, the sales conditions (environment, equipment, labor, storage, and preservative) of fish are a potential source of contaminants in fish [12] [13] [14]. Foodborne diseases (FBDs) are frequently reported throughout the world, especially in developing countries. Food poisoning can occur through the ingestion of food contaminated either by a pathogen (viruses, parasites, and bacteria) [15] or by the toxins it produces [16] [17]. These foods borne diseases are one of the main public health problems [18]. According to FAO, several cases of FBDs are reported worldwide with about 420,000 deaths. Food contaminated by microorganisms accounts for 70% of foodborne illnesses. The economic cost of these foodborne diseases is very significant [19] [20]. Enterobacteriaceae such as Escherichia coli 0157 H 7, Salmonella as well as Staphylococcus aureus are among the pathogens responsible for foodborne illness [21] [22] [23]. These pathogens are frequently detected in foods [24] [25] [26] [27] especially in fish [28] [29] [30] [31] [32] as well as in patients with gastroenteritis [33] [34]. These bacteria can contaminate fish from the origin as well as at each step of the processing [35].
Braised, dried, and smoked fish have an important part in the diet of the population of Ouagadougou. A survey conducted by our laboratory team in Ouagadougou between February and July 2019 revealed microbiological contamination risks related to the conditions under which fish are sold [36]. Therefore, it is essential for us to monitor the sanitary quality of fish provided to consumers. The objective of this study was to investigate certain pathogens that contaminate smoked, dried, and braised fish marketed in Ouagadougou. Specifically, the aim was to isolate and identify potential pathogenic Enterobacteriaceae and Staphylococcus strains from smoked, dried, and braised fish.
2. Material and Methods2.1. Study Setting
The isolation of the germs was achieved at the Laboratory of Biochemistry and Applied Immunology (LABIA) of Joseph KI-ZERBO University (Ouagadougou/Burkina Faso).
Phenotypic identification of the strains was conducted at the Laboratoire National Vétérinaire (LANAVET) annex of Douala (Cameroon) and molecular identification of the strains was conducted at the Molecular and Cell Biology Laboratory, University of Buea (Cameroon).
2.2. Sampling
Sampling was conducted from July 2019 to February 2020 in the markets (50) identified in our previous survey in Ouagadougou [36]. The most consumed types of fish (smoked, dried, braised) were purchased, packaged in sterile bags. Each sample was labeled and placed in a cooler containing ice boxes and transported to the laboratory for analysis. Sampling was done in a randomized fashion.
2.3. Isolation of Enterobacteriaceae and Staphylococcus Strains from Fish Samples2.3.1. Preparation of Stock Solution and Dilutions
A quantity of 10 g of fish flesh was aseptically collected and introduced into a sterile bottle containing 90 ml of sterile peptone water. The mixture was homogenized for 1 to 2 minutes. The supernatant was collected in a sterile vial to form the 10−1 dilution stock solution. Dilutions were made from the stock solution by taking 1 ml each time added to 9 ml of sterile peptone water contained in a test tube to constitute successively, 10−2, 10−3, and 10−4 dilutions.
2.3.2. Research of Enterobacteriaceae
1) Enumeration, Isolation of Thermotolerant Coliforms and Escherichia coli
The detection of these germs was done according to the international standard ISO 4832 (2006)/NF V08-017; 1980. Inoculation was done in Violet Red Bile Agar (VRBL agar). A volume of 15 ml of VRBL previously prepared and brought to 45˚C was poured into Petri dishes. The inoculum and VRBL were homogenized by rotating the Petri dish and dried. After solidification, a second layer of 4 ml VRBL was poured to prevent the growth of any surface contamination flora. The plates were incubated in an incubator at 44˚C for 24 h ± 2 h. Typical bright red to pinkish or purple colonies with a diameter of more than 0.5 mm were enumerated according to AFNOR ISO 7218 (2007). After enumeration, some characteristic Escherichia coli colonies were plated on EMB agar and incubated at 37˚C for 24 h. After the 24-h incubation period, the strains were stored at −20˚C in cryotubes containing 20% glycerol brain broth for subsequent identification.
2) Research of Salmonella
Salmonella was detected on Xylose Lysine Desoxycholate (XLD) and Salmonella-Shigella (SS) agar media according to NF ISO 6579: 2002. The following procedure described by Edel and Kampelmacher [37] was used:
Preenrichment: 25 g of sample (fish flesh) were aseptically collected and put in 225 ml of sterile peptone water and incubated at 37˚C for 24 h;
Enrichment: 10 µl of pre-enriched peptone water for each sample was pipetted into a tube containing 10 ml of Rappaport Vassiliadis broth (Oxoid, Basingtoke, England) and incubated at 37˚C for 24 h;
Isolation: 10 µl of the enrichment broth was pipetted and inoculated onto XLD and SS agar plates by the streak method using a sterile Pasteur pipette. The dishes were incubated at 37˚C for 24 h. After incubation, suspect colonies were isolated on XLD for biochemical characterization;
Identification: suspect colonies that are red with a black center on XLD and colorless with or without a black center on SS agar were characterized using biochemical tests [38] : Gram stain, urease, indole production, glucose, lactose and mannitol fermentation, H2S and gas production, motility test.
Each strain was scraped and stored at −20˚C in cryotubes containing 20% glycerol brain broth for subsequent identification.
3) Phenotypic Identification of Escherichia coli and Other Enterobacteriaceae Strains by API 20 E Gallery
Enterobacteriaceae strains were identified using an API 20 E kit (BioMerieux S.A., Marcy l’Etoile, France). The isolates were submitted to 20 biochemical tests in microtubes containing dehydrated substrates. A bacterial suspension of McFarland turbidity equal to 0.5 was prepared and introduced into the gallery tubes. For CIT, VP, and GEL tests, the tubes and cups were filled. For the other tests, only the tubes were filled (not the cups). For the tests, ADH, LDC, ODC, H2S, URE anaerobiosis was created by filling their cups with paraffin oil (Glentham Life Sciences, Euro. Grade). The incubation box was then closed and incubated at 37˚C for 24 h.
Revelation tests requiring the addition of reagents after incubation was performed: addition of a drop of TDA, JAMES, and VP 1 + VP 2 reagents in TDA, IND, and VP microtubes respectively. The reading of the galleries was done according to the manufacturer’s Reading Table. Strains were identified on the basis of numerical profiles using the ApiwebTM software. Only isolates with a compatibility percentage higher than 80% were selected.
2.3.3. Pathogenic Staphylococcus Detection
1) Isolation and Enumeration of Pathogenic Staphylococcus
The search and isolation of Staphylococcus were performed on Mannitol Salt Agar (ISO 6888; 2003). A volume of 0.1 ml of two successive dilutions was spread on the surface of the agar in Petri dishes and incubated at 37˚C for 24 h. After incubation, all Staphylococci were enumerated according to AFNOR ISO 7218 (2007). The results allowed us to discriminate Staphylococci based on their ability to ferment or not mannitol. Mannitol fermentation induces acidification that leads to a yellow, the medium in the presence of phenol red (pH indicator). The strains were subjected to additional standard biochemical tests: catalase and DNAse tests. Suspect Staphylococcus aureus and other colonies were subcultured onto Mannitol Salt Agar and the bacterial mass of each strain was scraped off and stored in cryotubes containing 20% glycerol brain broth for subsequent identification.
2) Phenotypic Identification of Staphylococcus Strains by the API STAPH Gallery
Staphylococcus strains were identified using API Staph kit (BioMerieux S. A., Marcy l’Etoile, France). Isolates were subjected to 20 biochemical tests in microtubes containing dehydrated substrates. A bacterial suspension of 0.5 McFarland turbidity was prepared and introduced into the gallery tubes. For all tests, the microtubes were filled without exceeding the level of the tubes. For the ADH and URE tests, anaerobiosis was created by filling their cups with paraffin oil. The incubation box was then closed and incubated at 37˚C for 24 h. After incubation, the reagents NIT1, NIT2, ZYM-A, ZYM-B, VP1, and VP2, were added for revelation tests in the NIT, PAL, and VP tubes respectively. The reading of the galleries was done according to the manufacturer’s Reading Table. Strains were identified on the basis of numerical profiles using Apiweb TM software.
Isolates with a staphylococcal compatibility percentage higher than 80% were retained.
2.4. Molecular Characterization of Escherichia coli, and Staphylococcus aureus Isolates2.4.1. DNA Extraction
The total genomic DNA extraction was performed by a thermal method. For this purpose, one to three colonies of each isolate (24 h) on Muller Hinton agar plates, were picked using a sterile Pasteur pipette, then suspended in 200 μl sterile1X PBS in an Eppendorf tube and vortexed to homogenize the mixture. The cells were washed by centrifugation at 20,000 ×g for 10 min. The supernatant was removed and the pellet was used for total genomic DNA extraction. For cell lysis, the pellet was resuspended in 20 μl of nuclease-free water, frozen for 15 min, and boiled in a water bath for 10 min. The lysate was then centrifuged at 12,000 rpm in a microcentrifuge (Biofuge fresco, Thermo Scientific) for 10 min. The resulting supernatant was collected and stored at −20˚C in Eppendorf tubes for future use.
2.4.2. Detection of uidA Gene in Escherichia coli Isolates
The molecular identification of Escherichia coli was done by detecting the uidA gene encoding the production of the β-D-glucuronidase (GUD) enzyme. The uidA gene detection was done using the primers uidA-F 5' ATGCCAGTCCAGCGTTTTTGC 3' and uidA-R 5' AAAGTGTGTGGGTCAATAATCAGGAAGTG 3'. The primer oligonucleotide sequences were obtained from Inquaba Biotec West Africa Ltd., Africa’s Genomics Company.
PCR was performed with a thermal cycler (2720 Thermal Cycler, Applied Biosystem). The reaction mixture was made in 25 μl according to the OneTaq master mix indication as follows: 12.5 μl of OneTaq® Quick-Laord® 2× Master Mix with Standard Buffer (New England Biolabs®), 0.5 μl of sense primer (10 μM), 0.5 μl of reverse primer (10 μM), 2.5 μl of DNA extract, and 9 μl of Nuclease free water (DNA/DNAse/RNAse free Sterile, PCR Inhibitor free), Bioconcepts.
PCR amplification conditions were: initial denaturation at 94˚C for 90 s, and 30 cycles of (denaturation at 94˚C for 30 s, annealing at 58˚C for 25 s, and extension at 72˚C for 30 s), final extension at 72˚C for 5 min.
The amplified products were run on a 1.5% agarose gel (Agarose CSL-AG500, LE Multi-Purpose Agarose, Cleaver Scientific, UK) containing SafeviewTM Classic Cat ≠ G108, Canada (5 μl in 100 ml of agarose gel), in 1× TAE (Tris-Acetate-EDTA) buffer for 20 min at 100 V. Ten microliters (10 μl) of each amplicon were dropped into the wells of the agarose gel. PCR fragments were visualized with UV Transilluminator (UVP Transilluminator, Analytikjena, US) and photographed with Gel Doc (Gel DocTM XR+ with Image LabTM Software, Molecular Imager®). Amplicon sizes were assessed by reference to a 100 bp molecular size ladder (Gel Laoding Dye Purple (6X), SDS B7025S, 100 bp DNA Ladder N3231L, New England Biolabs®). The presence of the uidA gene is identified by the occurrence of a 1487 bp band.
2.4.3. Molecular Characterization of Staphylococcus aureus Strains by Amplification of the 23S rDNA Gene and the nuc Gene
The primers Staur4 5'ACG GAG TTACAAAGG ACGAC 3' and Staur6 5'AGCTCAGCCTTA ACGAGTAC 3' were used for the amplification of specific coding regions of the 23S ribosomal rDNA of Staphylococcus aureus species as described by [39].
The specific sense primer nucF 5'GCGATTGATGGTGATACGGT 3' and antisense primer nucR 5'AGCCAAGCCTTGACGAACTAAAGC 3' (Inquaba Biotec West Africa Ltd, Africa’s Genomics Company) were used to amplify the nuc gene encoding the coagulase-positive Staphylococcus thermostable endonuclease.
The reaction mixture was prepared in of 25 μl according to the OneTaq master mix: 12.5 μl of OneTaq® Quick-Laord® 2× Master Mix with Standard Buffer (New England Biolabs®), 0.5 μl of sense primer (10 μM), 0.5 μl of reverse primer (10 μM), 2.5 μl of DNA extract, and 9 μl of Nuclease free water (DNA/DNAse/RNAse free Sterile, PCR Inhibitor free), Bioconcepts.
PCR was performed in a thermal cycler (2720 Thermal Cycler, Applied Biosystem). The program used in the case of the Staur primers was: predenaturation 94˚C/5min, 35 cycles of (94˚C/30sec; 55˚C/40seconds; 72˚C/1.2minutes) and final extension 72˚C/5minutes. In the case of the nuc gene, the following steps were applied: initial denaturation 95˚C for 5 min, 30 cycles of (denaturation 94˚C for 60 sec, annealing 55˚C for 30 sec, extension 72˚C for 90 sec), final extension 72˚C for 5 min. Amplicons were stored at +4˚C.
For visualization of the amplified PCR fragments, 10 μl of each amplicon was loaded into agarose wells (Agarose CSL-AG500, LE Multi-Purpose Agarose, Cleaver Scientific, UK) stained with SafeviewTM Classic Cat ≠ G108, Canada (5 μl in 100 ml of agarose). Migration was done in 1× TAE (Tris-Acetate-EDTA) buffer for 20 min at 100 V to separate the fragments by electrophoresis. The bands of the amplicons were visualized under UV light with UV Transilluminator (UVP Transilluminator, Analytikjena, US) and with Gel Doc (Gel DocTM XR+ with Image LabTM Software, Molecular Imager®). Amplicon sizes were determined using a 100 bp molecular weight marker (Gel Loading Dye Purple (6×), SDS B7025S, 100 bp DNA Ladder N3231L, New England Biolabs®). The characteristic bands are 1250 bp with the Staur primer and the amplified nuc gene fragment shows a 280 bp band.
2.5. Statistical Analysis
The data were analyzed using IBM SPSS 25.0 and Sphinx Plus2 software to calculate percentages and develop tables of characteristics to highlight the most frequently reported strains and the most specific strains in regard to the sample types.
3. Results3.1. Distribution of the Types of Fish Analyzed
Figure 1 illustrates the distribution of the different categories of fish analyzed. A total of 235 fish samples were analyzed in this study. Twelve (11) kinds of fish were purchased according to their abundance on Ouagadougou markets and the most consumed by the population.
Figure 2 illustrates the pictures of some fish samples analyzed.
3.2. Phenotypic Identification of Isolated Strains3.2.1. Enterobacteriaceae Isolated from Fish Samples
The Enterobacteriaceae detected in the fish samples are presented in Table 1. The results of the biochemical tests revealed a diversity of Enterobacteriaceae species. The total coliforms enumerated averaged (4.92 ± 5.66) × 108 CFU/ml and fecal coliforms, (0.84 ± 2.27) × 103 CFU/ml. Figure 3 shows various colonies of Enterobacteriaceae isolated on specific culture media.
In total, 20 species of Enterobacteriaceae were identified. Among these potentially pathogenic strains, Escherichia coli was detected in 22.6% of samples, Salmonella sp at 4.3%, Raoultella ornithinolytica at 28.9%, and Serratia odorifera at 17.4%. The percentages of the strains correspond to the number of samples in which the strain was detected compared to the total number of samples analyzed. In addition, about 17% of the samples did not contain Enterobacteriaceae.
The difference with the reference distribution was significant (1 − p ≥ 99.99%).
The distribution of the identified strains in relation to the analyzed samples is significant with 1 − p ≥ 99.99% (Table 2). Indeed, as shown in Table 2, 29.3%
Enterobacteriaceae strains identified in fish samples
Enterobacteriaceae strains identified
Number of contaminated samples
Percentage
Cedecea davisae
29
12.3%
Raoultella ornithinolytica
68
28.9%
Salmonella enterica ssp arizonae
15
6.4%
Proteus mirabilis
17
7.2%
Serratia odorifera
41
17.4%
Salmonella spp
10
4.3%
Enterobacter cloacae
6
2.6%
Proteus vulgaris group
18
7.7%
Citrobacter braakii
7
3.0%
Serratia marcescens
13
5.5%
Serratia liquefaciens
8
3.4%
Klebsiella pneumoniae ssp pneumoniae
6
2.6%
Serratia ficaria
6
2.6%
Enterobacter gergoviae
9
3.8%
Enterobacter aerogenes
9
3.8%
Escherichia coli
53
22.6%
Kluyvera spp
6
2.6%
Cronobacter sakazakii
11
4.7%
Acinetobacter baumannii
6
2.6%
Acinetobacter calcoaceticus
6
2.6%
None
40
17.0%
and 31.7% of Serratia odorifera species were found in Oreochromis niloticus (dried) and Mormyrus rume (dried) respectively, 80.0% of Salmonella spp in Mormyrus rume (dried), 33.3% and 27.8% Proteus vulgaris group in Anguilla
Distribution of Enterobacteriaceae identified by fish category
bengalensis labiata (smoked) and Chrysichthys nigrodigitatus (dried) respectively, 85.7% Citrobacter braakii in Heterotis niloticus (smoked), 46.2% of Serratia marcescens in Chrysichthys nigrodigitatus (smoked), 55.6% of Enterobacter aerogenes in Mormyrus rume (dried), 90.9% Cronobacter sakazakii in Clarias gariepinus (smoked). Acinetobacter baumannii and Acinetobacter calcoaceticus were only detected in Oreochromis niloticus (dried). Oreochromis niloticus (smoked) was the type of fish in which most germs were detected (26.8%) followed by smoked Clarias gariepinus (23.4%). Mormyrus rume (dried) contained most Salmonella spp (80%) and smoked Clarias gariepinus most Salmonella enterica ssp arizonae (46.7%).
Figure 4 shows the profile of some Enterobacteriaceae strains on API 20 E galleries.
3.2.2. Staphylococcus Isolated from Fish Samples
Table 3 shows Staphylococcus strains isolated from fish samples analyzed. The Staphylococcus enumerated were on average (0.68 ± 1.17) × 106 CFU/ml. Figure 5 shows different strains of Staphylococcus spotted on Mannitol Salt Agar. Among eleven (11) species of Staphylococcus identified, Staphylococcus xylosus, Staphylococcus aureus, Staphylococcus lugdunensis, and Staphylococcus sciuri were the most representative with respective percentages of 47.7%, 23.4%, 12.8% and 10.6% of samples. On the other hand, no Staphylococcus was detected in 12.8% of the samples analyzed. The distribution of the identified strains in comparison to the analyzed samples was highly significant with 1 − p ≥ 99.99% (Table 4).
Distribution of Staphylococcus strains identified in fish samples
Staphylococcus strains identified
Number of contaminated samples
Percentage
Staphylococcus xylosus
112
47.7%
Staphylococcus aureus
55
23.4%
Staphylococcus lugdunensis
30
12.8%
Staphylococcus sciuri
25
10.6%
Staphylococcus intermedius
3
1.3%
Staphylococcus lentus
16
6.8%
Staphylococcus hominis
20
8.5%
Staphylococcus simulans
2
0.9%
Staphylococcus saprophyticus
7
3.0%
Staphylococcus haemolyticus
10
4.3%
Staphylococcus capitis
6
2.6%
None
30
12.8%
Distribution of identified Staphylococcus strains according to fish species
The difference with the reference distribution is highly significant 1 − p ≥ 99.99%. Cells with bold text are those for which the effective population is significantly higher or lower than the theoretical population.
Figure 6 illustrates the profiles of some Staphylococcus strains identified by the API STAPH gallery.
Table 5 illustrates the most frequently occurring strains of Enterobacteriaceae and Staphylococcus in each kind of fish. Percentages are calculated individually based on the total number of samples. For all samples, Staphylococcus xylosus, Staphylococcus aureus, and Staphylococcus lugdunensis were the most frequently mentioned Staphylococcus. Raoultella ornithinolytica, Escherichia coli, and Serratia odorifera are the Enterobacteriaceae frequently found in the samples.
Table 5 gives the modalities that are significantly different (frequency ratio). Only the most remarkable modalities are displayed (at the threshold of 1.20).
<xref ref-type="table" rid="table">Table </xref>of characteristics of the sample in relation to the most frequently identified strains (Staphylococcus and Enterobacteriaceae)
3.3. Confirmation of Isolated Strains by PCR3.3.1. Profile of Escherichia coli Strains Confirmed by uidA Gene Detection
Thirty-five (35) strains of Escherichia coli identified by the API 20 E gallery were used for molecular characterization. The uidA gene characterizing specifically Escherichia coli was detected in 82.85% of the strains (29/35). Among the tested strains, six (6) did not present the gene of interest. Figure 7 shows the agarose
gel picture of the uidA gene electrophoresis detected in some of the tested strains.
3.3.2. Confirmation of Staphylococcus aureus Strains by Detection of the Specific 23S rDNA Gene and the nuc Gene
Amplification of the 23S rDNA specific gene (Figure 8) using the staur primers was observed in 49/50 (98%) of the isolated Staphylococcus aureus strains. The nuc gene (Figure 9) was detected in 86% of the strains.
4. Discussion
Fish contributes to the improvement of the nutritional level of the population. This food can compromise the health of consumers if basic hygiene quality is not ensured. To maintain its nutritional properties, fish must have good sanitary quality. Eight (8) species of processed fish sold in the Ouagadougou markets were analyzed in this study: smoked Oreochromis niloticus, smoked Clarias gariepinus, smoked Anguilla bengalensis labiata, smoked Heterotis niloticus, dried Oreochromis niloticus, dried Chrysichthys nigrodigitatus, dried Chrysichthys nigrodigitatus, smoked Mormyrus rume, dried Mormyrus rume, braised Cyprinus carpio, braised Trachurus trachurus. In this study, a diversity of Enterobacteriaceae and Staphylococcus was detected. The study conducted by Agbeko et al. [40], Kyule et al. [41], and Guetarni & Labdi [42] also revealed a diversity of bacteria isolated from fish in Kenya, Ghana, and Algeria, respectively. Proper processing methods are expected to considerably reduce pathogens [11] [43] [44]. The presence of pathogenic microorganisms detected in fish is due to several factors. In some cases, the fish may already be infected with germs (in its gastrointestinal tract) since the source (in fish farms) [45] [46] [47]. The sanitary quality of fish after capture may be due to contamination related to poor storage conditions that favor microorganism proliferation [7].
The isolates of Enterobacteriaceae and Staphylococcus species are not specific to one type of processed fish, but their load differs from one type of fish to another. This variability could be explained by the fact that the samples come from different origins and from different processors, and sellers [36].
The isolates of Enterobacteriaceae were mainly represented in order by Raoultella ornithinolytica, Escherichia coli, and Serratia odorifera. The contamination of fish by Enterobacteriaceae is frequently mentioned in many previous studies [42] [48] [49]. Compared to the study conducted by Anihouvi et al. [50] on smoked fish in Benin, high contamination of smoked fish by Enterobacteriaceae (63.9% of the samples) and Escherichia coli detected in 27.8% of the samples was higher than the values found in this study (22.6%).
Furthermore, Elsherief et al. [51] also found high contamination (94%) of fish in their study with a significant proportion of Serratia spp, Salmonella spp., and E. coli. The detection of these germs indicates poor hygiene conditions during processing, storage, or sale. It is known that processing, transport, and storage conditions significantly affect the hygienic quality of fish [52] [53] [54] [55] [56].
Escherichia coli is a commensal bacterium found in the colon of humans and also warm-blooded animals and used as an indicator of fecal contamination in fish [57]. It is a pathogen with multiple pathovars that cause gastroenteritis disorders [58] [59] [60] [61].
Raoultella ornithinolytica and Serratia odorifera are ubiquitous in both water and soil [62] [63] [64] [65]. Therefore, their occurrence in samples could be due to contamination through soil or equipment, especially on display tables during the sale [66], but also due to lack of hygiene, because some strains have been isolated from patients suffering from diarrhea [67]. They are opportunistic pathogens. Raoultella ornithinolytica is an emerging pathogen able to cause poisoning by the production of histamine from histidine [68] [69] [70] and several hospital infections [51] [71] [72]. Serratia odorifera is rarely implicated in clinical infections but is often associated with invasive human infections [73]. Some strains that have been isolated in hospitals have shown multidrug resistance to antibiotics [74]. Their presence in fish thus constitutes a significant health risk because they can be transmitted to the consumer through contaminated food [75].
In this study, Proteus vulgaris, P. mirabilis, Enterobacter aerogenes, E. cloacae, S. liquefaciens, and C. braakii were also isolated in this study. Contamination of fish by these germs has been reported in several studies [76] and also has the ability to produce histamine [77] [78] [79]. Cronobacter sakazakii is an opportunistic pathogen involved in food poisoning [80] often isolated from fish [81] [82].
Cedecea davisae was detected in this study. To our knowledge, Cedecea davisae has not yet been detected in fish. The presence of this germ in the samples is particularly unusual. Some studies report that this bacterium has been isolated from patient blood and is involved in human bacteremia [83]. Thus, the presence of Cedecea davisae in fish could be due to human contamination (handlers).
The results of gallery identification revealed the presence of Salmonella enterica ssp arizonae as well as Salmonella spp. However, confirmation of these strains still requires additional serological tests. Some presumptive Salmonella strains obtained on the XLD culture medium were identified as Proteus vulgaris or P. mirabilis. The presumption of Salmonella in the samples requires special attention. Ava et al. [29] found high contamination of fish by Salmonella (57.8%) in their study.
Several species of Staphylococcus were identified in the analyzed fish samples. Bacteria of the genus Staphylococcus are ubiquitous [84]. Their presence in fish may be due to contamination related to handling with the hands of sellers who carry these germs during the sale [85]. It is one of the most dangerous pathogens responsible for foodborne diseases around the world [86]. The bacteria can be destroyed by cooking processes; however, it can produce various heat-stable enterotoxins in food that cause vomiting and diarrhea [87] [88] [89] [90] [91]. In addition to food poisoning related to its enterotoxins, Staphylococcus aureus also causes toxic shock syndrome, and pneumonia [92] [93].
Staphylococcus xylosus and Staphylococcus lugdunensis are also predominant species identified in this study. They are commensal bacteria of human skin [94] [95] and are also found in the environment [96] [97] [98]. Staphylococcus xylosus occurs naturally in foods and is used as a starter to ferment certain foods such as fermented sausages, and fish [99] [100] [101] [102]. Furthermore, Staphylococcus xylosus has been reported to inhibit the growth of spoilage microorganisms [103] [104] and degrade biogenic nitrites and amines in fermented sausages [105]. However, studies have reported that Staphylococcus xylosus can cause animal and human infections [106] [107] [108]. Staphylococcus lugdunensis is also known to be a potential pathogen for humans [75] [109] [110]. The presence of these germs in fish could be due to hand contamination during sales [36].
The suspected Escherichia coli isolates were confirmed by checking for the uidA gene. The results of this study indicate that 82.85% of the isolates contain the uidA gene. Sina et al. [67] detected the uidA gene in 88.89% of Escherichia coli strains tested. This variation in values could be due to mutations in the structure of the uidA gene [111]. Taha & Yassin [27] also detected the uidA gene in all strains isolated from food in Iraq. The uidA gene is generally used to specifically identify E. coli [112] [113] [114].
The use of staur primers allowed the amplification of 23S rDNA specific regions in most tested strains, thus confirming that they are Staphylococcus aureus species. This primer has been used in several studies for the identification of Staphylococcus aureus isolates [115] [116]. However, the nuc gene was detected in 86% of the Staphylococcus aureus strains tested. The nuc gene is used to identify specific strains of Staphylococcus aureus [117] [118]. Pinto et al. [119] confirmed 99% of Staphylococcus aureus strains are involved in food poisoning cases by detecting the nuc gene. These values are higher than those obtained in this study. This can be attributed to PCR inhibitors during amplification [120] [121] [122].
5. Conclusions
The isolation and identification of microorganisms that contaminate fish carried out in this study revealed a diversity of Enterobacteriaceae and Staphylococcus species. The most important species isolated were the following: Raoultella ornithinolytica, Escherichia coli, Serratia odorifera, Staphylococcus aureus, Staphylococcus xylosus, and Staphylococcus lugdunensis. The isolated Enterobacteriaceae and Staphylococcus species are not specific to one type of processed fish, but their quantity varies from one species to another. The presence of these bacteria in the fish indicates poor handling conditions of the fish at the time of sale. These isolated bacteria are potential pathogens involved in foodborne diseases and intoxications. Therefore, it would be necessary for the population to be careful in the consumption of these products. Furthermore, traders must improve the hygienic conditions of their sales and storage environments. The government services of Burkina Faso responsible for public health must pay particular attention to the monitoring of fish throughout the production and supply chain by establishing effective sanitary safety systems. This will ensure the sanitary quality of the fish supplied to consumers.
The detection of these bacteria, potentially dangerous to the health of the consumer, reveals the need to confirm the pathogenicity of these by molecular analysis by investigating the pathogenicity genes of the isolated strains with PCR.
Acknowledgements
We would like to express our gratitude to the West African Economic and Monetary Union (UEMOA) representation of our country, Burkina Faso, which funded a part of our Ph.D. thesis work at the Joseph Ki-Zerbo University, including the purchase of fish samples and the isolation of pathogenic bacteria from these fish samples. We also thank the AFRIDI project which granted us a mobility grant to carry out a part of our Ph.D. research work at the University of Douala. The financial support of the project allowed us to carry out the phenotypic and molecular identification of pathogenic bacteria isolated from fish.
Authors’ Contributions
OA performed the collection of the fish samples, and carried out the isolation and identification of the strains as well as writing the manuscript. SMG and TF supervised the work in the laboratory and the writing of the manuscript. TR, OGA and SNS and CH read and corrected the manuscript. ZC and SA read and approved the final version of the manuscript.
Conflicts of Interest
The authors declare that they have no competing interests.
Cite this paper
Ouédraogo, A., Traoré, R., Ouédraogo, G.A., Somda, N.S., Cissé, H., Ghogomu, S.M., Tchoumbougnang, F., Zongo, C. and Savadogo, A. (2023) Phenotypic and Molecular Characterization of Staphylococcaceae and Enterobacteriaceae Species Isolated from Smoked, Dried, and Braised Fish Marketed in Ouagadougou. Advances in Microbiology, 13, 48-75. https://doi.org/10.4236/aim.2023.131004
ReferencesFAO (2020) La situation mondiale des pêches et de l’aquaculture 2020. La durabilité en action. https://doi.org/10.4060/ca9229frTacon, A.G.J., Lemos, D. and Metian, M. (2020) Fish For Health: Improved Nutritional Quality of Cultured Fish for Human Consumption. Reviews in Fisheries Science & Aquaculture, 28, 449-458. https://doi.org/10.1080/23308249.2020.1762163Ayeloja, A.A. (2020) Glimpse of Fish as Perishable Staple. Al-Qadisiyah Journal for Agriculture Sciences, 10, 349-376. https://doi.org/10.33794/qjas.2020.167497Bérard, L. (1998) Le poisson: Une denrée périssable. études Rurales, 147-148, 129-138. https://doi.org/10.3406/rural.1998.3624Tavares, J., Martins, A., Fidalgo, L.G., Lima, V., Amaral, R.A., Pinto, C.A., Silva, A.M. and Saraiva, J.A. (2021) Fresh Fish Degradation and Advances in Preservation Using Physical Emerging Technologies. Foods, 10, Article 780. https://doi.org/10.3390/foods10040780Pittia, P. and Antonello, P. (2016) Safety by Control of Water Activity: Drying, Smoking and Salt or Sugar Addition. In: Prakash, V., Martín-Belloso, O., et al., Eds., Regulating Safety of Traditional and Ethnic Foods, Academic Press, Cambridge, MA, 7-28. https://doi.org/10.1016/B978-0-12-800605-4.00002-5Sikorski, Z.E. (2016) Smoked Foods: Principles and Production. In: Caballero, B., Finglas, P.M. and Toldrá, F., Eds., Encyclopedia of Food and Health, Academic Press, Cambridge, MA, 1-5. https://doi.org/10.1016/B978-0-12-384947-2.00630-9Sikorski, Z.E. and Sinkiewicz, I. (2014) SMOKING | Traditional. In: Dikeman, M. and Devine, C., Eds., Encyclopedia of Meat Sciences, 2nd Edition, Academic Press, Cambridge, MA, 321-327. https://doi.org/10.1016/B978-0-12-384731-7.00227-0Ashie, I.N.A., Smith, J.P., Simpson, B.K. and Haard, N.F. (1996) Spoilage and Shelf-Life Extension of Fresh Fish and Shellfish. Critical Reviews in Food Science and Nutrition, 36, 37-41. https://doi.org/10.1080/10408399609527720Turan, H. and Erkoyuncu, I. (2012) Salting Technology in Fish Processing. In: Bhat, R., Alias, A.K. and Paliyath, G., Eds., Progress in Food Preservation, John Wiley & Sons Ltd., Hoboken, 297-313. https://doi.org/10.1002/9781119962045.ch14Basti, A.A., Misaghi, A., Salehi, T.Z. and Kamkar, A. (2006) Bacterial Pathogens in Fresh, Smoked and Salted Iranian Fish. Food Control, 17, 183-188. https://doi.org/10.1016/j.foodcont.2004.10.001Abdoullahi, H.O., Zongo, C., Tapsoba, F., Tidjani, A. and Savadogo, A. (2016) Paramètres physicochimiques des poissons sèches vendus dans les villes de N’Djamena (Tchad) et de Ouagadougou (Burkina Faso). Revue de Microbiologie Industrielle, Sanitaire, et Environnementale, 10, 13-32.Degnon, G.R., Dougnon, T.J., Toussou, S. and Migan, S.Y. (2012) Evaluation de la qualité microbiologique et physicochimique des poissons capturés et commercialisés au port de pêche industrielle de Cotonou. International Journal of Biological and Chemical Sciences, 6, 166-174. https://doi.org/10.4314/ijbcs.v6i1.15Ouedraogo, A.S., Oueda, A., Gneme, A., Savadogo, G.L., Barro, N. and Kabre, G.B. (2018) Handling Conditions and Microbial Contamination of Fish from Ouagadougou Markets in Burkina Faso. African Journal of Microbiology Research, 12, 866-872. https://doi.org/10.5897/AJMR2016.7934Watari, T., Takayuki, M., Ba, T., Okada, A., Nishikawa, K., Otsuki, K., Nobuhiro, B.A., Ba, N., Abe, H., Nakano, Y., Soshi, B.A., Ba, T. and Amano, Y. (2021) A Review of Food Poisoning Caused by Local Food in Japan. Journal of General and Family Medicine, 22, 15-23. https://doi.org/10.1002/jgf2.384Dietrich, R., Jessberger, N., Ehling-schulz, M., Märtlbauer, E. and Granum, P.E. (2021) The Food Poisoning Toxins of Bacillus cereus. Toxins, 13, Article 98. https://doi.org/10.3390/toxins13020098Hernández-Cortez, C., Palma-Martínez, I., Gonzalez-Avila, L.U., Guerrero-Mandujano, A., Solís, C.R. and Castro-Escarpulli, G. (2017) Food Poisoning Caused by Bacteria (Food Toxins). In: Malangu, N., Ed., Poisoning: From Specific Toxic Agents to Novel Rapid and Simplified Techniques for Analysis, IntechOpen, London, 33-72. https://doi.org/10.5772/intechopen.69953Heredia, N. and García, S. (2018) Animals as Sources of Food-Borne Pathogens: A Review. Animal Nutrition, 4, 250-255. https://doi.org/10.1016/j.aninu.2018.04.006Hoffmann, S. and Ahn, J. (2021) Updating Economic Burden of Foodborne Diseases Estimates for Inflation and Income Growth (Issue ERR-297). https://www.ers.usda.gov/Jaffee, S., Henson, S., Unnevehr, L., Grace, D. and Cassou, E. (2019) The Safe Food Imperative: Accelerating Progress in Low- and Middle-Income Countries. Agriculture and Food Series, World Bank, Washington DC. https://doi.org/10.1596/978-1-4648-1345-0Fournet, N., Laurent, E., Jones, G., Tourdjman, M., Chereau, F., Horrigue, I., Nisavanh, A., Da Silva, N.J. and de Valk, H. (2021) Surveillance des toxi-infections alimentaires collectives. Données de la déclaration obligatoire, 2020.Ikeda, T., Tamate, N., Yamaguchi, K. and Makino, S. (2005) Mass Outbreak of Food Poisoning Disease Caused by Small Amounts of Staphylococcal Enterotoxins A and H. Applied and Environmental Microbiology, 71, 2793-2795. https://doi.org/10.1128/AEM.71.5.2793-2795.2005Schirone, M., Visciano, P., Tofalo, R. and Suzzi, G. (2019) Editorial: Foodborne Pathogens: Hygiene and Safety. Frontiers in Microbiology, 10, Article 1974. https://doi.org/10.3389/fmicb.2019.01974Nikiema, M.E.M., Pardos de la Gandara, M., Compaore, K.A.M., Ky Ba, A., Soro, K.D., Nikiema, P.A., Sangare, L., Weill, F.-X. and Barro, N. (2021) Contamination of Street Food with Multidrug-Resistant Salmonella, in Ouagadougou, Burkina Faso. PLOS ONE, 16, e0253312. https://doi.org/10.1371/journal.pone.0253312Rodríguez-Lázaro, D., Oniciuc, E., García, P.G., Gallego, D., Fernández-Natal, I., Dominguez-Gil, M., Eiros-Bouza, J.M., Wagner, M., Nicolau, A.I. and Hernández, M. (2017) Detection and Characterization of Staphylococcus aureus and Methicillin-Resistant S. aureus in Foods Confiscated in EU Borders. Frontiers in Microbiology, 8, Article 1344. https://doi.org/10.3389/fmicb.2017.01344Somda, S.N., Juste, I., Bonkoungou, I.J.O., Sambe-ba, B., Drabo, S.M., Wane, A.A., Sawadogo-Lingani, H. and Savadogo, A. (2021) Diversity and Antimicrobial Drug Resistance of Non-Typhoid Salmonella Serotypes Isolated in Lettuce, Irrigation Water, and Clinical Samples in Burkina Faso. Journal of Agriculture and Food Research, 5, Article ID: 100167. https://doi.org/10.1016/j.jafr.2021.100167Taha, Z.M. and Yassin, N.A. (2019) Prevalence of Diarrheagenic Escherichia coli in Animal Products in Duhok Province, Iraq. Iranian Journal of Veterinary Research, 20, 255-262.Abdel-Gawad, F.K., Eweda, W.E., El-Taweel, G.E., Shehata, S.F. and Tawab, M.I.A. (2015) Detection of Staphylococcus aureus from Fish and Water Samples Collected from Lake Qarun. International Journal of Scientific & Engineering Research, 6, 366-372.Ava, A., Faridullah, M., Lithi, U.J. and Roy, V.C. (2020) Incidence of Salmonella and Escherichia coli in Fish Farms and Markets in Dinajpur, Bangladesh. Bangladesh Journal of Scientific and Industrial Research, 55, 65-72. https://doi.org/10.3329/bjsir.v55i1.46733Kagambèga, A., Belem, S., Mcmillan, E.A., Hiott, L.M., Ramadan, H., Soro, D.K., Sharma, P., Gupta, S.K., Barro, N., Jackson, C.R. and Frye, J.G. (2021) Genome Analysis of Salmonella Strains Isolated from Imported Frozen Fish in Burkina Faso. Annals of Microbiology, 71, Article No. 32. https://doi.org/10.1186/s13213-021-01642-8Onmaz, N.E., Yildirim, Y., Karadal, F., Hizlisoy, H., Al, S., Güngör, C., Disli, H.B., Barel, M., Dişhan, A., Adil, R., Tegin, A. and Şi, E. (2020) Escherichia coli O157 in Fish: Prevalence, Antimicrobial Resistance, Biofilm Formation Capacity, and Molecular Characterization. LWT-Food Science and Technology, 133, Article ID: 109940. https://doi.org/10.1016/j.lwt.2020.109940Traoré, O., Nyholm, O., Siitonen, A., Bonkoungou, I.J.O., Traoré, A.S., Barro, N. and Haukka, K. (2015) Prevalence and Diversity of Salmonella enterica in Water, Fish, and Lettuce in Ouagadougou, Burkina Faso. BMC Microbiology, 15, Article No. 151. https://doi.org/10.1186/s12866-015-0484-7Bonkoungou, I.J.O., Somda, N.S., Traoré, O., Zoma, B.S., Garba, Z., Drabo, K.M. and Barro, N. (2021) Detection of Diarrheagenic Escherichia coli in Human Diarrheic Stool and Drinking Water Samples in Ouagadougou, Burkina Faso. African Journal of Infectious Diseases, 15, 53-58. https://doi.org/10.21010/ajid.v15i1.7Somda, N.S., Bonkoungou, O.J.I., Zongo, C., Kpoda, D.S., Tapsoba, F., Bassolé, I.H.N., Traoré1, Y. and Savadogo, A. (2017) Prevalence of Escherichia coli Virulence Genes in Patients with Diarrhea in Ouagadougou, Burkina Faso. African Journal of Clinical and Experimental Microbiology, 18, 179-185. https://doi.org/10.4314/ajcem.v18i4.1Buisson, Y. (1992) La toxi-infection alimentaire. Médecine et Maladies Infectieuses, 22, 272-281. https://doi.org/10.1016/S0399-077X(05)80132-5Ouedraogo, A., Zongo, C., Tapsoba, F., Cissé, H., Traoré, Y. and Savadogo, A. (2021) Evaluation of Contamination Risks Due to the Sale and Storage Conditions of Smoked, Dried and Fresh Fishes in Ouagadougou. Current Journal of Applied Science and Technology, 40, 42-54. https://doi.org/10.9734/cjast/2021/v40i931346Edel, W. and Kampelmacher, E.H. (1969) Salmonella Isolation in Nine European Laboratories Using a Standardized Technique. Bulletin of the World Health Organization, 41, 297-306.Poelma, P.L., Andrews, W.H. and Wildon, C.R. (1984) Recovery of Salmonella Species from Nonfat Dry Milk Rehydrated under Rapid and Reduced Pre-Enrichment Conditions: Collaborative Study. Journal of the Association of official Analytical Chemists, 67, 807-810. https://doi.org/10.1093/jaoac/67.4.807Straub, J.A., Hertel, C. and Hammes, W.P. (1999) A 23S rDNA-Targeted Polymerase Chain Reaction—Based System for Detection of Staphylococcus aureus. Meat Starter Cultures and Dairy Products, 62, 1150-1156. https://doi.org/10.4315/0362-028X-62.10.1150Agbeko, R., Aheto, D.W., Asante, D.K.A., Asare, N.K., Boateng, A.A. and Adinortey, C.A. (2022) Identification of Molecular Determinants of Antibiotic Resistance in Some Fish Farms of Ghana. Heliyon, 8, E10431. https://doi.org/10.1016/j.heliyon.2022.e10431Kyule, D.N., Maingi, J.M., Njeru, E.M. and Nyamache, A.K. (2022) Molecular Characterization and Diversity of Bacteria Isolated from Fish and Fish Products Retailed in Kenyan Markets. International Journal of Food Science, 2022, Article ID: 2379323. https://doi.org/10.1155/2022/2379323Guetarni, H. and Labdi, N. (2022) Characterization of Microorganisms in Fish and Farmed Water from Sidi M’Hamed Ben Tiba Dam (Algeria). Agricultural Science Digest, Article ID: DF-472. https://doi.org/10.18805/ag.DF-472Ghaly, A.E., Dave, D., Budge, S. and Brooks, M.S. (2010) Fish Spoilage Mechanisms and Preservation Techniques: Review. American Journal of Applied Sciences, 7, 859-877. https://doi.org/10.3844/ajassp.2010.859.877Sivertsvik, M., Jeksrud, W.K. and Rosnes, J.T. (2002) A Review of Modified Atmosphere Packaging of fish and Fishery Products—Significance of Microbial Growth, Activities and Safety. International Journal of Food Science and Technology, 37, 107-127. https://doi.org/10.1046/j.1365-2621.2002.00548.xGuzmán, M.C., De Los Angeles Bistoni, M., Tamagnini, L.M. and González, R.D. (2004) Recovery of Escherichia coli in Fresh Water Fish, Jenynsia multidentata and Bryconamericus iheringi. Water Research, 38, 2368-2374. https://doi.org/10.1016/j.watres.2004.02.016Oliveira, R.V., Peixoto, P.G., Ribeiro, D.de C., Araujo, M.C., do Santos, C.T.B., Hayashi, C., Pedreira, M.M. and Pelli, A. (2014) Klebsiella pneumoniae as a Main Cause of Infection in Nishikigoi Cyprinus carpio (carp) by Inadequate Handling. Brazilian Journal of Veterinary Pathology, 7, 86-88. http://hdl.handle.net/11449/220202Yagoub S.O. ,et al. (2009)Isolation of Enterobacteriaceae and Pseudomonas spp. from Raw Fish Sold in Fish Market in Khartoum State Journal of Bacteriology Research 1, 85-88.Costa, R.A. (2013) Escherichia coli in Seafood: A Brief Overview. Advances in Bioscience and Biotechnology, 4, 450-454. https://doi.org/10.4236/abb.2013.43A060Ullah, R., Qureshi, A.W., Sajid, A., Khan, I., Ullah, A. and Taj, R. (2021) Percentage Incidences of Bacteria in Mahseer (Tor putitora), Silver carp (Hypophthalmichthys molitrix) Fish Collected from Hatcheries and Local Markets of District Malakand and Peshawar of Khyber Pakhtunkhwa, Pakistan. Brazilian Journal of Biology, 84, e251747. https://doi.org/10.1590/1519-6984.251747Anihouvi, D.G.H., Kpoclou, Y.E., Massih, M.A., Afé, O.H.I., Assogba, M.F., Covo, M., Scippo, M.L., Djidjoho, J.H., Anihouvi, V. and Mahillon, J. (2019) Microbiological Characteristics of Smoked and Smoked-Dried Fish Processed in Benin. Food Science & Nutrition, 7, 1821-1827. https://doi.org/10.1002/fsn3.1030Haruki, Y., Hagiya, H., Sakuma, A., Murase, T., Sugiyama, T. and Kondo, S. (2014) Clinical Characteristics of Raoultella ornithinolytica Bacteremia: A Case Series and Literature Review. Journal of Infection and Chemotherapy, 20, 589-591. https://doi.org/10.1016/j.jiac.2014.05.005Abdallah-Ruiz, A., Wood, L.S., Kim, T., Schilling, W., White, S.B., Chen, B., Durango-Villadiego, A. and Silva, J.L. (2022) Microbial Indicators and Possible Focal Points of Contamination during Production and Processing of Catfish. Foods, 11, Article 2778. https://doi.org/10.3390/foods11182778Gorlach-Lira, K., Pacheco, C., Carvalho, L.C.T., Melo Júnior, H.N. and Crispim, M.C. (2013) The Influence of Fish Culture in Floating Net Cages on Microbial Indicators of Water Quality. Brazilian Journal of Biology, 73, 457-463. https://doi.org/10.1590/S1519-69842013000300001Sheng, L. and Wang, L. (2021) The Microbial Safety of Fish and Fish Products: Recent Advances in Understanding Its Significance, Contamination Sources, and Control Strategies. Comprehensive Reviews in Food Science and Food Safety, 20, 738-786. https://doi.org/10.1111/1541-4337.12671Shikongo-Nambabi, M., Shoolongela, A. and Schneider, M.B. (2012) Control of Bacterial Contamination during Marine Fish Processing. Journal of Biology and Life Science, 3, 1-17. https://doi.org/10.5296/jbls.v3i1.1033Sousa, C.L., Freitas, J.A., Loureno, L.F.H., Araujo, E.A.F. and Peixoto Joele, M.R.S. (2014) Microbiological Contamination of Surfaces in Fish Industry. African Journal of Microbiology Research, 8, 425-431. https://doi.org/10.5897/AJMR2013.6319Griffiths, F.P. and Fuller, J.E. (1936) Detection and Significance of Fish and Fillets. American Journal of Public Health, 26, 259-264. https://doi.org/10.2105/ajph.26.3.259Mainil, J. (2013) Escherichia coli Virulence Factors. Veterinary Immunology and Immunopathology, 152, 2-12. https://doi.org/10.1016/j.vetimm.2012.09.032Parin, U., Kirkan, S., Arslan, S.S. and Yuksel, H.T. (2018) Molecular Identification and Antimicrobial Resistance of Escherichia fergusonii and Escherichia coli from Dairy Cattle with Diarrhoea. Veterinarni Medicina, 63, 110-116. https://doi.org/10.17221/156/2017-VETMEDRiley, L.W. (2020) Distinguishing Pathovars from Nonpathovars: Escherichia coli. Microbiology Spectrum, 8, 1-23. https://doi.org/10.1128/microbiolspec.AME-0014-2020Weintraub, A. (2007) Enteroaggregative Escherichia coli: Epidemiology, Virulence and Detection. Journal of Medical Microbiology, 56, 4-8. https://doi.org/10.1099/jmm.0.46930-0Falade, A.O., Eyisi, O.A.L., Mabinya, L.V, Nwodo, U.U. and Okoh, A.I. (2017) Peroxidase Production and Ligninolytic Potentials of Fresh Water Bacteria Raoultella ornithinolytica and Ensifer adhaerens. Biotechnology Reports, 16, 12-17. https://doi.org/10.1016/j.btre.2017.10.001Grimont, F. and Grimont, P.A.D. (2006) The Genus Serratia. Prokaryotes, 6, 219-244. https://doi.org/10.1007/0-387-30746-X_11Kuczynski D. ,et al. (2016)Occurrence of Pathogenic Bacteria in Surface Water of an Urban River in Argentina (Reconquista River, Buenos Aires) International Journal of Aquatic Science 7, 30-38.Zou, H., Berglund, B., Xu, H., Chi, X., Zhao, Q., Zhou, Z., Xia, H., Li, X. and Zheng, B. (2020) Genetic Characterization and Virulence of a Carbapenem-Resistant Raoultella ornithinolytica Isolated from Well Water Carrying a Novel Megaplasmid Containing bla NDM-1. Environmental Pollution, 260, Article ID: 114041. https://doi.org/10.1016/j.envpol.2020.114041Hajjar, R., Sebajang, H., Schwenter, F. and Su, S. (2020) Raoultella ornithinolytica: Emergence and Resistance. Infection and Drug Resistance, 13, 1091-1104. https://doi.org/10.2147/IDR.S191387Sina, H., Dah-Nouvlessounon, D., Adjobimey, T., Boya, B., Dohoue, G.M.C., N’tcha, C., Chidikofan, V., Baba-Moussa, F., Abdoulaye, I., Adjanohoun, A. and Baba-Moussa, L. (2022) Characteristics of Escherichia coli Isolated from Intestinal Microbiota Children of 0 - 5 Years Old in the Commune of Abomey-Calavi. Journal of Pathogens, 2022, Article ID: 6253894. https://doi.org/10.1155/2022/6253894Hwang, C., Kung, H., Lee, Y., Wen, S., Chen, P., Tseng, D. and Tsai, Y.-H. (2020) Histamine Fish Poisoning and Histamine Production by Raoultella ornithinolytica in Milkfish Surimi. Journal of Food Protection, 83, 874-880. https://doi.org/10.4315/0362-028X.JFP-19-385Kanki, M., Yoda, T., Tsukamoto, T. and Shibata, T. (2002) Klebsiella pneumoniae Produces no Histamine: Raoultella planticola and Raoultella ornithinolytica Strains Are Histamine Producers. Applied and Environmental Microbiology, 68, 3462-3466. https://doi.org/10.1128/AEM.68.7.3462-3466.2002Lin, C., Kung, H., Lin, C., Tsai, H. and Tsai, Y. (2016) Histamine Production by Raoultella ornithinolytica in Mahi-Mahi Meat at Various Storage Temperatures. Journal of Food and Drug Analysis, 24, 305-310. https://doi.org/10.1016/j.jfda.2014.06.010Goodman, D.T., Murphy, D. and Dorairaj, J. (2022) Case Study: Soft Tissue Infection with Raoultella ornithinolytica. JPRAS Open, 33, 17-20. https://doi.org/10.1016/j.jpra.2022.04.004Seng, P., Boushab, B.M., Romain, F., Gouriet, F., Bruder, N., Martin, C., Paganelli, F., Bernit, E., Le Treut, Y.P., Thomas, P., Papazian, L., Raoult, D. and Stein, A. (2016) Emerging Role of Raoultella ornithinolytica in Human Infections: A Series of Cases and Review of the Literature. International Journal of Infectious Diseases, 45, 65-71. https://doi.org/10.1016/j.ijid.2016.02.014Chmel, H. (1988) Serratia odorifera Biogroup 1 Causing an Invasive Human Infection. Journal of Clinical Microbiology, 26, 1244-1245. https://doi.org/10.1128/jcm.26.6.1244-1245.1988Maphossa, V., Langa, J.C., Simbine, S., Mausse, F.E., Kenga, D., Relvas, V., Chicamba, V., Manjate, A. and Sacarlal, J. (2022) Environmental Bacterial and Fungal Contamination in High Touch Surfaces and Indoor Air of a Pediatric Intensive Care Unit in Maputo Central Hospital, Mozambique in 2018. Infection Prevention in Practice, 4, Article ID: 100250. https://doi.org/10.1016/j.infpip.2022.100250Freney, J., Brun, Y., Bes, M., Meugnier, H., Grimont, F., Grimont, P.A.D., Nerv, C. and Fleurette, J. (1988) Staphylococcus lugdunensis sp. nov. and Staphylococcus schleiferi. International Journal of Systematic Bacteriology, 38, 168-172. https://doi.org/10.1099/00207713-38-2-168Mhango, M., Mpuchane, S. and BA, G. (2010) Incidence of Indicator Organisms, Opportunistic and Pathogenic Bacteria in Fish. African Journal of Food Agriculture Nutrition and Development, 10, 4202-4218. https://doi.org/10.4314/ajfand.v10i10.62898Apun, K., Yusof, A.M. and Jugang, K. (2010) Distribution of Bacteria in Tropical Freshwater Fish and Ponds. International Journal of Environmental Health Research, 9, 37-41.Oktariani, A.F., Ramona, Y., Sudaryatma, P.E., Dewi, I.A.M.M. and Shetty, K. (2022) Role of Marine Bacterial Contaminants in Histamine Formation in Seafood Products: A Review. Microorganisms, 10, Article 1197. https://doi.org/10.3390/microorganisms10061197Tsai, Y., Chang, S., Kung, H., Wei, C. and Hwang, D.-F. (2005) Histamine Production by Enterobacter aerogenes in Sailfish and Milkfish at Various Storage Temperatures. Journal of Food Protection, 68, 1690-1695. https://doi.org/10.4315/0362-028X-68.8.1690Dumen, E. (2010) Cronobacter sakazakii (Enterobacter sakazakii): Only an Infant Problem? Kafkas Univiversitesi Veteriner Fakultesi Dergisi, 16, 171-178.Das, S.K., Kumar, S.H., Nayak, B.B. and Lekshmi, M. (2021) Isolation and Identification of Cronobacter spp. from Fish and Shellfish Sold in Retail Markets. Current Microbiology, 78, 1973-1980. https://doi.org/10.1007/s00284-021-02447-3Li, C., et al. (2020) Cronobacter spp. Isolated from Aquatic Products in China: Incidence, Antibiotic Resistance, Molecular Characteristic and CRISPR Diversity. International Journal of Food Microbiology, 335, Article ID: 108857. https://doi.org/10.1016/j.ijfoodmicro.2020.108857Akinosoglou, K., Perperis, A., Siagris, D., Goutou, P., Spiliopoulou, I., Gogos, C.A. and Marangos, M. (2012) Bacteraemia Due to Cedecea davisae in a Patient with Sigmoid Colon Cancer: A Case Report and Brief Review of the Literature. Diagnostic Microbiology and Infectious Disease, 74, 303-306. https://doi.org/10.1016/j.diagmicrobio.2012.06.019Tuazon, C.U. (1984) Skin and Skin Structure Infections in the Patient at Risk: Carrier State of Staphylococcus aureus. The American Journal of Medicine, 76, 166-171. https://doi.org/10.1016/0002-9343(84)90260-2Al-Bahry, S.N., Nallusamy, S. and Mahmoud, I. (2014) Staphylococcus aureus Contamination during Food Preparation, Processing and Handling. International Journal of Chemical Engineering and Applications, 5, 388-392. https://doi.org/10.7763/IJCEA.2014.V5.415Le Loir, Y., Baron, F. and Gautier, M. (2003) Staphylococcus aureus and Food Poisoning. Genetics and Molecular Research, 2, 63-76.Arfatahery, N., Davoodabadi, A. and Abedimohtasab, T. (2016) Characterization of Toxin Genes and Antimicrobial Susceptibility of Staphylococcus aureus Isolates in Fishery Products in Iran. Scientific Reports, 6, Article No. 34216. https://doi.org/10.1038/srep34216Hennekinne, J., De Buyser, M. and Dragacci, S. (2012) Staphylococcus aureus and Its Food Poisoning Toxins: Characterization and Outbreak Investigation. FEMS Microbiology Reviews, 36, 815-836. https://doi.org/10.1111/j.1574-6976.2011.00311.xOliveira, D., Borges, A. and Simões, M. (2018) Staphylococcus aureus Toxins and Their Molecular Activity in Infectious Diseases. Toxins, 10, Article 252. https://doi.org/10.3390/toxins10060252Simon, S.S. and Sanjeev, S. (2007) Prevalence of Enterotoxigenic Staphylococcus aureus in Wshery Products and Wshery Processing Factory Workers. Food Control, 18, 1565-1568. https://doi.org/10.1016/j.foodcont.2006.12.007Vitale, M., Scatassa, M.L., Cardamone, C., Oliveri, G., Piraino, C., Alduina, R. and Napoli, C. (2015) Staphylococcal Food Poisoning Case and Molecular Analysis of Toxin Genes in Staphylococcus aureus Strains Isolated from Food in Sicily, Italy. Foodborne Pathogens and Disease, 12, 21-23. https://doi.org/10.1089/fpd.2014.1760Dweba, C.C., Zishiri, O.T. and El Zowalaty, M.E. (2019) Isolation and Molecular Identification of Virulence, Antimicrobial and Heavy Metal Resistance Genes in Livestock-Associated Methicillin-Resistant Staphylococcus aureus. Pathogens, 8, Article 79. https://doi.org/10.3390/pathogens8020079Kadariya, J., Smith, T.C. and Thapaliya, D. (2014) Staphylococcus aureus and Staphylococcal Food-Borne Disease: An Ongoing Challenge in Public Health. BioMed Research International, 2014, Article ID: 827965. https://doi.org/10.1155/2014/827965Bieber, L. and Kahlmeter, G. (2010) Staphylococcus lugdunensis in Several Niches of the Normal Skin Flora. Clinical Microbiology and Infection, 16, 385-388. https://doi.org/10.1111/j.1469-0691.2009.02813.xHeilbronner, S. and Foster, T.J. (2021) Staphylococcus lugdunensis: A Skin Commensal with Invasive Pathogenic Potential. Clinical Microbiology Reviews, 34, e00205-20. https://doi.org/10.1128/CMR.00205-20Kessie, G., Ettayebi, M., Haddad, A.M., Shibl, A.M., Al-Shammary, F.J., Tawfik, A.F. and Al-Ahdal, M.N. (1998) Plasmid Profile and Antibiotic Resistance in Coagulase-Negative Staphylococci Isolated from Polluted Water. Journal of Applied Microbiology, 84, 417-422. https://doi.org/10.1046/j.1365-2672.1998.00358.xPlanchon, S., Gaillard-Martinie, B., Dordet-Frisoni, E., Bellon-Fontaine, M.N., Leroy, S., Labadie, J., Hébraud, M. and Talon, R. (2006) Formation of Biofilm by Staphylococcus xylosus. International Journal of Food Microbiology, 109, 88-96. https://doi.org/10.1016/j.ijfoodmicro.2006.01.016Schleifer, K.H. and Kloos, W.E. (1975) Isolation and Characterization of Staphylococci from Human Skin. International Journal of Systematic Bacteriology, 25, 50-61. https://doi.org/10.1099/00207713-25-1-50Gao, P., Wang, W., Xia, W., Xu, Y. and Jiang, Q. (2016) Lipolysis and Lipid Oxidation Caused by Staphylococcus xylosus 135 and Saccharomyces cerevisiae 31 Isolated from Suan Yu, a Traditional Chinese Low-Salt Fermented Fish. International Journal of Food Science and Technology, 51, 419-426. https://doi.org/10.1111/ijfs.12997Hua, Q., Gao, P., Xu, Y., Xia, W., Sun, Y. and Jiang, Q. (2020) Effect of Commercial Starter Cultures on the Quality Characteristics of Fermented Fish-Chili Paste. LWT-Food Science and Technology, 122, Article ID: 109016. https://doi.org/10.1016/j.lwt.2020.109016Wang, H., Xu, J., Kong, B., Liu, Q., Xia, X. and Sun, F. (2022) Purification and Characterization of the Protease from Staphylococcus xylosus A2 Isolated from Harbin Dry Sausages. Foods, 11, Article 1094. https://doi.org/10.3390/foods11081094Xu, Y., Zang, J., Regenstein, J.M. and Xia, W. (2021) Technological Roles of Microorganisms in Fish Fermentation: A Review. Critical Reviews in Food Science and Nutrition, 61, 1000-1012. https://doi.org/10.1080/10408398.2020.1750342Kindossi, J.M., Iko Afé, O.H., Vieira-Dalodé, G., Akissoé, N.H., Leroy, S., Talon, R., Anihouvi, V.B. and Hounhouigan, D.J. (2022) Improvement of Taste Enhancer Condiment Processing and Safety Using Marinade and Bio-Preservation of Cassava Fish (Pseudotolithus Sp). Journal of Culinary Science and Technology, 1-17. https://doi.org/10.1080/15428052.2022.2104770Li, P., Luo, H., Kong, B., Liu, Q. and Chen, C. (2016) Formation of Red Myoglobin Derivatives and Inhibition of Spoilage Bacteria in Raw Meat Batters by Lactic Acid Bacteria and Staphylococcus xylosus. LWT-Food Science and Technology, 68, 251-257. https://doi.org/10.1016/j.lwt.2015.12.035Li, Y., Yu, Z., Zhu, Y. and Cao, Z. (2020) Selection of Nitrite-Degrading and Biogenic Amine-Degrading Strains and Its Involved Genes. Food Quality and Safety, 4, 225-235. https://doi.org/10.1093/fqsafe/fyaa027Akhaddar, A., Elouennass, M., Naama, O. and Boucetta, M. (2010) Staphylococcus xylosus Isolated from an Otogenic Brain Abscess in an Adolescent. Surgical Infections (Larchmt), 11, 559-561. https://doi.org/10.1089/sur.2010.010Huerta, B., Barrero-Dominguez, B., Galan-Relaño, A., Tarradas, C., Maldonado, A. and Luque, I. (2016) Essential Oils in the Control of Infections by Staphylococcus xylosus in Horses. Journal of Equine Veterinary Science, 38, 19-23. https://doi.org/10.1016/j.jevs.2015.11.011Oh, W.T., Jun, J.W., Giri, S.S., Yun, S., Kim, H.J., Kim, S.G., Kim, S.W., Han, S.J., Kwon, J. and Park, S.C. (2019) Staphylococcus xylosus Infection in Rainbow Trout (Oncorhynchus mykiss) as a Primary Pathogenic Cause of Eye Protrusion and Mortality. Microorganisms, 7, Article 330. https://doi.org/10.3390/microorganisms7090330Frank, K.L., del Pozo, J.L. and Patel, R. (2008) From Clinical Microbiology to Infection Pathogenesis: How Daring to Be Different Works for Staphylococcus lugdunensis. Clinical Microbiology Reviews, 21, 111-133. https://doi.org/10.1128/CMR.00036-07Liu, P., Huang, Y., Tang, C., Chen, Y., Hsieh, K., Ger, L.-P., Chen, Y.-S. and Liu, Y.-C. (2010) Staphylococcus lugdunensis Infective Endocarditis: A Literature Review and Analysis of Risk Factors. Journal of Microbiology, Immunology and Infection, 43, 478-484. https://doi.org/10.1016/S1684-1182(10)60074-6Feng, P., Lum, R. and Chang, G.W. (1991) Identification of uidA Gene Sequences in β-D-Glucuronidase-Negative Escherichia coli. Applied and Environmental Microbiology, 57, 320-323. https://doi.org/10.1128/aem.57.1.320-323.1991Kaspar, C.W., Hartman, P.A. and Benson, A.K. (1987) Coagglutination and Enzyme Capture Tests for Detection of Escherichia coli 1-Galactosidase, 3-Glucuronidase, and Glutamate Decarboxylase. Applied and Environmental Microbiology, 53, 1073-1077. https://doi.org/10.1128/aem.53.5.1073-1077.1987Martins, M.T., Rivera, I.G., Clark, D.L., Stewart, M.H., Wolfe, R.L. and Olson, B.H. (1993) Distribution of uidA Gene Sequences in Escherichia coli Isolates in Water Sources and Comparison with the Expression of, B-Glucuronidase Activity in 4-Methylumbelliferyl-3-D-Glucuronide Media. Applied and Environmental Microbiology, 59, 2271-2276. https://doi.org/10.1128/aem.59.7.2271-2276.1993Molina, F., López-Acedo, E., Tabla, R., Roa, I., Gómez, A. and Rebollo, J.E. (2015) Improved Detection of Escherichia coli and Coliform Bacteria by Multiplex PCR. BMC Biotechnology, 15, Article No. 48. https://doi.org/10.1186/s12896-015-0168-2Hegab, O.W., Abdel-Latif, E.F. and Moawad, A.A. (2020) Isolation of Enterotoxigenic Staphylococcus aureus Harboring seb Gene and Enteropathogenic Escherichia coli (Serogroups O18, O114, and O125) from Soft and Hard Artisanal Cheeses in Egypt. Open Veterinary Journal, 10, 297-307. https://doi.org/10.4314/ovj.v10i3.8Machado, G.P., Silva, R.C., Guimarães, F.F., Salina, A. and Langoni, H. (2018) Detection of Staphylococcus aureus, Streptococcus agalactiae and Escherichia coli in Brazilian Mastitic Milk Goats by Multiplex-PCR. Pesquisa Veterinária Brasileira, 38, 1358-1364. https://doi.org/10.1590/1678-5150-pvb-55141Alarcon, B., Vicedo, B. and Aznar, R. (2006) PCR-Based Procedures for Detection and Quantification of Staphylococcus aureus and Their Application in Food. Journal of Applied Microbiology, 100, 352-364. https://doi.org/10.1111/j.1365-2672.2005.02768.xBrakstad, O.D.D.G., Aasbakk, K. and Maeland, J.A. (1992) Detection of Staphylococcus aureus by Polymerase Chain Reaction Amplification of the nuc Gene. Journal of Clinical Microbiology, 30, 1654-1660. https://doi.org/10.1128/jcm.30.7.1654-1660.1992Pinto, B., Chenoll, E. and Aznar, R. (2020) Identification and Typing of Food-Borne Staphylococcus aureus by PCR-Based Techniques. Systematic and Applied Microbiology, 28, 340-352. https://doi.org/10.1016/j.syapm.2005.01.002Hedman, J., Knutsson, R., Ansell, R., Radstrom, P. and Rasmusson, B. (2013) Pre-PCR Processing in Bioterrorism Preparedness: Improved Diagnostic Capabilities for Laboratory Response Networks. Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science, 11, 87-101. https://doi.org/10.1089/bsp.2012.0090Martin, B., Plummer, A., Linacre, A. and Henry, J. (2022) Direct PCR of Fired Shotgun Casings: A South Australian Evaluation. Australian Journal of Forensic Sciences, 54, 358-364. https://doi.org/10.1080/00450618.2020.1823475Schrader, C., Schielke, A., Ellerbroek, L. and Johne, R. (2012) PCR Inhibitors—Occurrence, Properties and Removal. Journal of Applied Microbiology, 113, 1014-1026. https://doi.org/10.1111/j.1365-2672.2012.05384.x