<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJMB</journal-id><journal-title-group><journal-title>American Journal of Molecular Biology</journal-title></journal-title-group><issn pub-type="epub">2161-6620</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajmb.2023.131003</article-id><article-id pub-id-type="publisher-id">AJMB-122156</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Insight into Genetic Diversity of Cultivated Lima Bean (&lt;i&gt;Phaseolus lunatus&lt;/i&gt; L.) in Benin
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Rose</surname><given-names>Fernande Fagbédji</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lambert</surname><given-names>Gustave Djedatin</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Chimène</surname><given-names>Nanoukon</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Geofroy</surname><given-names>Kinhoegbe</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Amed</surname><given-names>Havivi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hounnankpon</surname><given-names>Yédomonhan</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Clément</surname><given-names>Agbangla</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Laboratoire de Biologie Moléculaire et de Bioinformatique Appliquée à la Génomique (BIOGENOM), ENSBBA de Dassa-Zoumé, Université Nationale des Sciences, Technologies, Ingénierie et Mathématiques (UNSTIM), Abomey, Benin</addr-line></aff><aff id="aff3"><addr-line>Laboratoire de Botanique et Ecologie Végétale, Faculté des Sciences et Techniques (FAST), Université d’Abomey-Calavi (UAC), Abomey-Calavi, Benin</addr-line></aff><aff id="aff2"><addr-line>Ecole Normale Supérieure de l’Enseignement Technique (ENSET) de Lokossa, Université Nationale des Sciences, Technologies, Ingénierie et Mathématiques (UNSTIM), Abomey, Benin</addr-line></aff><aff id="aff4"><addr-line>Département de Génétique et des Biotechnologies, Faculté des Sciences et Techniques (FAST), Université d’Abomey-Calavi, Abomey-Calavi, Benin</addr-line></aff><pub-date pub-type="epub"><day>23</day><month>11</month><year>2022</year></pub-date><volume>13</volume><issue>01</issue><fpage>32</fpage><lpage>45</lpage><history><date date-type="received"><day>1,</day>	<month>November</month>	<year>2022</year></date><date date-type="rev-recd"><day>29,</day>	<month>November</month>	<year>2022</year>	</date><date date-type="accepted"><day>30,</day>	<month>December</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Lima bean is a tropical and subtropical legume from the genus Phaseolus which is cultivated for its importance in food and in medicine, but which remains a Neglected and Underutilized Crop in Benin. Understanding the genetic diversity of a species’ genetic resources is useful for the establishment of appropriate conservation strategies and breeding programs and for sustainable use. We use 6 out of ten SSR markers to analyze the diversity and population structure of 28 Lima bean landraces collected in Benin. A total of 28 alleles with an average of 4.16 alleles per SSR were amplified. The Polymorphic Information Content value ranged from 0.079 to 0.680 with an average of 0.408. The analysis of population structure revealed three subpopulations. PCoA revealed three well-separated clusters among the analyzed accessions in accordance with the population structure results and the clustering based on the Neighbor-Joining tree. AMOVA showed highly significant (p = 0.001) diversity among and within populations. Hence, 32% of the genetic variation was distributed among the population and 68% was distributed within populations. A high PhiP value (0.321) was found between the three sub-subpopulations indicating a high genetic differentiation between these sub-subpopulations. By exhibiting the highest average number of alleles, Shannon-Weaver information and Shannon-Weaver diversity indices, and the highest mean number of private alleles, subpopulation 1 is the main gene pool of the analyzed collection. The present study is an important starting point for the establishment of appropriate conservation strategies and breeding programs for Lima bean genetic resources.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Phaseolus lunatus&lt;/i&gt; L.</kwd><kwd> Benin</kwd><kwd> Genetic Diversity</kwd><kwd> SSR Markets</kwd><kwd> Conservation</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Lima bean (Phaseoluslunatus L.) is a tropical and subtropical legume cultivated for its edible seeds [<xref ref-type="bibr" rid="scirp.122156-ref1">1</xref>] in the home gardens or intercropped with cereals in the field [<xref ref-type="bibr" rid="scirp.122156-ref2">2</xref>]. The species is of considerable importance in food and in medicine and is considered, for this purpose, as the main source of plant protein for human nutrition [<xref ref-type="bibr" rid="scirp.122156-ref3">3</xref>]. It is consumed in various forms (pulp, paste, and dietary supplements). The Lima bean is the second agro-nomically and economically most significant species within the Phaseolus genus behind the Common bean in the world [<xref ref-type="bibr" rid="scirp.122156-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.122156-ref5">5</xref>]. In Benin, despite its importance, the legume is referenced as a Neglected and Underutilized Crop Species [<xref ref-type="bibr" rid="scirp.122156-ref6">6</xref>]. Given that nowadays, for the reason of research of profits, most producers have opted for industrial crops, on the one hand, and on the other hand, due to the lack of improved varieties. Hence, in the country, there is no research effort on Lima bean improvement.</p><p>In general, the lack of sufficient characterization of genetic resources and by ricochet the lack of genetic data constitute for any crop the main brake to any improvement program [<xref ref-type="bibr" rid="scirp.122156-ref7">7</xref>]. Genetic diversity studies by discovering and characterizing novel genes or alleles likely to be introgressed into elite germplasm seem to be the primary basis for successful plant breeding [<xref ref-type="bibr" rid="scirp.122156-ref8">8</xref>]. They offer thereby opportunities for genetic improvement and provide valuable information for effective conservation [<xref ref-type="bibr" rid="scirp.122156-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.122156-ref10">10</xref>].</p><p>Plant genetic diversity can be studied at the phenotypic and molecular level or by using agro-morphological characteristic measurements using phenotypic, molecular, or agro-morphological markers [<xref ref-type="bibr" rid="scirp.122156-ref11">11</xref>]. However, agro-morphological markers such as yield components are known to be affected by environmental factors [<xref ref-type="bibr" rid="scirp.122156-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.122156-ref13">13</xref>]. Thus, the use of genetic molecular markers has gained prominence in genetic diversity studies. These markers are not regulated through the environment, but their utilization conditions have no effects on which the plants are cultivated [<xref ref-type="bibr" rid="scirp.122156-ref14">14</xref>]. They are one of the powerful tools used in the characterization of genetic resources [<xref ref-type="bibr" rid="scirp.122156-ref15">15</xref>].</p><p>The advantage of choosing a given marker lies not only in its accessibility, the cost, in the reproducibility of the results but also in its ability in revealing polymorphisms in the nucleotide sequences [<xref ref-type="bibr" rid="scirp.122156-ref14">14</xref>]. These polymorphisms are revealed by molecular techniques such as Restriction Fragment Length Polymorphism (RFLP), Amplified Fragment Length Polymorphism (AFLP), microsatellite or Simple Sequence Repeat (SSR), Random Amplified Polymorphic DNA (RAPD), Single Nucleotide Polymorphisms (SNPs) and others [<xref ref-type="bibr" rid="scirp.122156-ref15">15</xref>].</p><p>Crops can be divided into two main categories which are stapled and underutilized also called Neglected and Underutilized Crop Species (NUS) [<xref ref-type="bibr" rid="scirp.122156-ref16">16</xref>]. The last ones are mostly wild or semi-domesticated species adapted to local environments [<xref ref-type="bibr" rid="scirp.122156-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.122156-ref18">18</xref>]. NUS is known to have not neglected commercial value and plays an important role in household income improvement. Most of them are cheap, accessible for the local population, and therefore contribute to food security and nutrition, generally more adapted to extreme soil and climatic conditions as they contain the relevant alleles and mechanisms for growth in poor environments and for resilience under [<xref ref-type="bibr" rid="scirp.122156-ref19">19</xref>]. NUS also have been recognized as potential sources of resilience traits) which can be used to improve major crops [<xref ref-type="bibr" rid="scirp.122156-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.122156-ref21">21</xref>].</p><p>In the current context of climate change and the fight against hunger and malnutrition, attention is turned to neglected and underutilized crops [<xref ref-type="bibr" rid="scirp.122156-ref22">22</xref>] like Pigeonpea, Kersting groundnut, or Lima bean [<xref ref-type="bibr" rid="scirp.122156-ref6">6</xref>]. In Benin, there has been some research directed towards the genetic diversity of NUS such as pigeon pea [<xref ref-type="bibr" rid="scirp.122156-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.122156-ref7">7</xref>] and Kersting groundnut [<xref ref-type="bibr" rid="scirp.122156-ref24">24</xref>], unlike the Lima bean which has not received any attention in terms of scientific research.</p><p>For all crops, understanding genetic diversity is useful for the establishment of appropriate conservation strategies and breeding programs and for sustainable use [<xref ref-type="bibr" rid="scirp.122156-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.122156-ref7">7</xref>]. This research was designed to analyze the genetic diversity and population structure of 28 Lima bean landraces collected in Benin using microsatellite markers, for the implementation of effective breeding and conservation programs.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Plant Material, DNA Isolation, and Quantification</title><p>A total of 28 accessions of Lima beans collected in the republic (<xref ref-type="table" rid="table1">Table 1</xref>) were analyzed. The study was carried out in the Laboratory of Molecular Biology and Bioinformatics Applied to Genomics at the National University of Sciences, Technologies Engineering and Mathematics of Abomey in Benin.</p><p>DNA was extracted from young leaves using the SDS method in accordance with [<xref ref-type="bibr" rid="scirp.122156-ref25">25</xref>] with minor modifications. Briefly, 500 mg of young leaves of Phaseoluslunatus were ground in liquid nitrogen in a mortar with 1000 &#181;l of SDS buffer (200 mM Tris-HCl, 25 mM EDTA, 250 mM NaCl, 0.5% SDS). The ground material was incubated at 37˚C in a water bath for 1 hour. After cooling at room temperature, 800 &#181;l of the phenol/chloroform/isoamyl alcohol (25:24:1) mixture was added to each sample and the whole was mixed before then being centrifuged at 15,000 rpm for 10 min at 4˚C. The supernatant was collected and mixed in equal volumes with a solution of Chloroform/isoamyl alcohol (24:1). The mixture was then centrifuged at 15,000 rpm for 10 min at 4˚C. The supernatant was once again collected in a new tube and the DNA precipitated with 0.1 volume</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Geographical distribution of the 28 accessions collected</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Accession</th><th align="center" valign="middle" >Village</th><th align="center" valign="middle" >District</th><th align="center" valign="middle" >Municipality</th></tr></thead><tr><td align="center" valign="middle" >V1</td><td align="center" valign="middle" >Cl&#232;dji</td><td align="center" valign="middle" >Ou&#232;ss&#232;</td><td align="center" valign="middle" >Ou&#232;ss&#232;</td></tr><tr><td align="center" valign="middle" >V2</td><td align="center" valign="middle" >Az&#233;hounholi</td><td align="center" valign="middle" >Adogb&#233;</td><td align="center" valign="middle" >Cov&#232;</td></tr><tr><td align="center" valign="middle" >V3</td><td align="center" valign="middle" >Yawa</td><td align="center" valign="middle" >Kpingni</td><td align="center" valign="middle" >Dassa-Zoum&#232;</td></tr><tr><td align="center" valign="middle" >V4</td><td align="center" valign="middle" >Voli</td><td align="center" valign="middle" >Adogb&#233;</td><td align="center" valign="middle" >Cov&#232;</td></tr><tr><td align="center" valign="middle" >V5</td><td align="center" valign="middle" >Kenouhou&#233;</td><td align="center" valign="middle" >Tota</td><td align="center" valign="middle" >Dogbo</td></tr><tr><td align="center" valign="middle" >V6</td><td align="center" valign="middle" >Agnivedji</td><td align="center" valign="middle" >Lokossa</td><td align="center" valign="middle" >Lokossa</td></tr><tr><td align="center" valign="middle" >V7</td><td align="center" valign="middle" >Adjoya</td><td align="center" valign="middle" >Tchetti</td><td align="center" valign="middle" >Savalou</td></tr><tr><td align="center" valign="middle" >V8</td><td align="center" valign="middle" >Dom&#232;</td><td align="center" valign="middle" >Adogb&#233;</td><td align="center" valign="middle" >Cov&#232;</td></tr><tr><td align="center" valign="middle" >V9</td><td align="center" valign="middle" >Fita</td><td align="center" valign="middle" >Kpingni</td><td align="center" valign="middle" >Dassa-Zoum&#232;</td></tr><tr><td align="center" valign="middle" >V10</td><td align="center" valign="middle" >Mal&#232;</td><td align="center" valign="middle" >Canna 1</td><td align="center" valign="middle" >Zogbodomey</td></tr><tr><td align="center" valign="middle" >V11</td><td align="center" valign="middle" >S&#232;wacomey</td><td align="center" valign="middle" >Zoungbonou</td><td align="center" valign="middle" >Hou&#233;yogb&#233;</td></tr><tr><td align="center" valign="middle" >V12</td><td align="center" valign="middle" >P&#233;n&#233;ssoulou</td><td align="center" valign="middle" >P&#233;n&#233;ssoulou</td><td align="center" valign="middle" >Bassila</td></tr><tr><td align="center" valign="middle" >V13</td><td align="center" valign="middle" >Adjoya</td><td align="center" valign="middle" >Tchetti</td><td align="center" valign="middle" >Savalou</td></tr><tr><td align="center" valign="middle" >V14</td><td align="center" valign="middle" >Akpassi</td><td align="center" valign="middle" >Akpassi</td><td align="center" valign="middle" >Bant&#232;</td></tr><tr><td align="center" valign="middle" >V15</td><td align="center" valign="middle" >Kpodav&#232;</td><td align="center" valign="middle" >Tota</td><td align="center" valign="middle" >Dogbo</td></tr><tr><td align="center" valign="middle" >V16</td><td align="center" valign="middle" >Agnivedji</td><td align="center" valign="middle" >Lokossa</td><td align="center" valign="middle" >Lokossa</td></tr><tr><td align="center" valign="middle" >V20</td><td align="center" valign="middle" >Adjoya</td><td align="center" valign="middle" >Tchetti</td><td align="center" valign="middle" >Savalou</td></tr><tr><td align="center" valign="middle" >V21</td><td align="center" valign="middle" >Zounta</td><td align="center" valign="middle" >Zoungu&#232;</td><td align="center" valign="middle" >Dangbo</td></tr><tr><td align="center" valign="middle" >V22</td><td align="center" valign="middle" >Okeola</td><td align="center" valign="middle" >Pob&#232;</td><td align="center" valign="middle" >Pob&#232;</td></tr><tr><td align="center" valign="middle" >V23</td><td align="center" valign="middle" >P&#233;n&#233;lan</td><td align="center" valign="middle" >P&#233;n&#233;ssoulou</td><td align="center" valign="middle" >Bassila</td></tr><tr><td align="center" valign="middle" >V24</td><td align="center" valign="middle" >Dogoudo</td><td align="center" valign="middle" >Canna 1</td><td align="center" valign="middle" >Zogbodomey</td></tr><tr><td align="center" valign="middle" >V25</td><td align="center" valign="middle" >Dogoudo</td><td align="center" valign="middle" >Canna 1</td><td align="center" valign="middle" >Zogbodomey</td></tr><tr><td align="center" valign="middle" >V26</td><td align="center" valign="middle" >Kajoca</td><td align="center" valign="middle" >Kpankou</td><td align="center" valign="middle" >K&#233;tou</td></tr><tr><td align="center" valign="middle" >V27</td><td align="center" valign="middle" >Yawa</td><td align="center" valign="middle" >Kpingni</td><td align="center" valign="middle" >Dassa-Zoum&#232;</td></tr><tr><td align="center" valign="middle" >V28</td><td align="center" valign="middle" >P&#233;n&#233;lan</td><td align="center" valign="middle" >P&#233;n&#233;ssoulou</td><td align="center" valign="middle" >Bassila</td></tr><tr><td align="center" valign="middle" >V29</td><td align="center" valign="middle" >Goutin</td><td align="center" valign="middle" >Adjohoun</td><td align="center" valign="middle" >Adjohoun</td></tr><tr><td align="center" valign="middle" >V30</td><td align="center" valign="middle" >chouchoubou</td><td align="center" valign="middle" >Tangui&#233;ta</td><td align="center" valign="middle" >Tangui&#233;ta</td></tr><tr><td align="center" valign="middle" >V33</td><td align="center" valign="middle" >Dogoudo</td><td align="center" valign="middle" >Canna 1</td><td align="center" valign="middle" >Zogbodomey</td></tr></tbody></table></table-wrap><p>of sodium acetate (3M, pH 7.0) and 0.7 volume of cold isopropanol and left at −20˚C for 20 min. Final centrifugation of 15 min at 15,000 rpm 4˚C will be done to recover the pellet of ADN. The pellet of ADN was washed 3 times with ethanol at 70% and once with ethanol at 100% and dried at room temperature for about 2 hours and then suspended in 1X TE storage buffer.</p><p>DNA quality was checked on agarose gel at 0.8%. Its concentration was assessed with NanoDrop Lite (Thermo Fisher Scientific) and DNA purity was accessed using the absorbance ratio (A260/A280). Based on the obtained DNA concentration, different dilution rates were applied to each sample to obtain a concentration of 5 ng/μl necessary for a PCR amplification reaction.</p></sec><sec id="s2_2"><title>2.2. SSRs Amplification and Gel Electrophoresis</title><p>A total of 10 microsatellite markers isolated and optimized for Common beans were used [<xref ref-type="bibr" rid="scirp.122156-ref26">26</xref>] (<xref ref-type="table" rid="table2">Table 2</xref>). PCR reactions were induced with 20 ng of DNA, 1 U of Taq DNA polymerase, 2.0 mM of magnesium chloride (MgCl<sub>2</sub>), 0.2 mM of each dNTP, 0.1 μM of each primer, and 1X PCR reaction buffer in a final volume of 20 ml [<xref ref-type="bibr" rid="scirp.122156-ref26">26</xref>]. The program consisted of an initial denaturation at 94˚C for 2 min, followed by 45 cycles at 94˚C for 30 s, 49˚C for, 30 s and 72˚C for 30 s and a ﬁnal extension at 72˚C for 10 min [<xref ref-type="bibr" rid="scirp.122156-ref11">11</xref>]. Amplification products were migrated on agarose gel at 2%, revealed with Ethidium Bromide, and then visualized on a UV transilluminator.</p></sec><sec id="s2_3"><title>2.3. Data Analysis</title><p>At each locus, different bands recorded an allelic composition. Thus, SSR alleles were coded as individual markers with 1 for the presence and 0 for the absence of the allele as binary data [<xref ref-type="bibr" rid="scirp.122156-ref27">27</xref>]. Genetic diversity parameters such as polymorphism rate (P), allelic diversity, and Polymorphism Information Content (PIC) were estimated. PIC value was calculated as followed: PIC = 1 − ∑ fi 2 : where fi is the frequency of each allele.</p><p>To assess genetic relationships between accessions, the dissimilarity between paired accessions was assessed using Darwin 6.0.21 software [<xref ref-type="bibr" rid="scirp.122156-ref28">28</xref>]. The generated dissimilarity matrix was used to infer a dendrogram using the Neighbor-Joining method.</p><p>The determination of the genetic groups was supported by population structure</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Characteristics of the 6 SSR markers</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Name</th><th align="center" valign="middle" >Sequences (5’-3’)</th><th align="center" valign="middle" >Motif</th><th align="center" valign="middle" >TA</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >AG1</td><td align="center" valign="middle" >F: CATGCAGAGGAAGCAGAGTG</td><td align="center" valign="middle"  rowspan="2"  >(GA)<sub>8</sub>GGTA(GA)<sub>5</sub>GGG GACG(AG)4</td><td align="center" valign="middle" >55˚C</td></tr><tr><td align="center" valign="middle" >R: GAGCGTCGTCGTTTCGAT</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >BM211</td><td align="center" valign="middle" >F: ATACCCACATGCACAAGTTTGG</td><td align="center" valign="middle"  rowspan="2"  >(CA)<sub>13 </sub></td><td align="center" valign="middle" >54˚C</td></tr><tr><td align="center" valign="middle" >R: CCACCATGTGCTCATGAAGAT</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >BM160</td><td align="center" valign="middle" >F: CGTGCTTGGCGAATAGCTTTG</td><td align="center" valign="middle"  rowspan="2"  >(GA)<sub>15 </sub> (GAA)<sub>5</sub></td><td align="center" valign="middle" >55˚C</td></tr><tr><td align="center" valign="middle" >R: CGCGGTTCTGATCGTGACTTC</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >GATS91</td><td align="center" valign="middle" >F: GAGTGCGGAAGCGAGTAGAG</td><td align="center" valign="middle"  rowspan="2"  >(GA)<sub>17</sub></td><td align="center" valign="middle" >55˚C</td></tr><tr><td align="center" valign="middle" >R: TCCGTGTTCCTCTGTCTGTG</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >BM141</td><td align="center" valign="middle" >F: TGAGGAGGAACAATGGTGGC</td><td align="center" valign="middle"  rowspan="2"  >(GA)<sub>29</sub></td><td align="center" valign="middle" >55˚C</td></tr><tr><td align="center" valign="middle" >R: CTCACAAACCACAACGCACC</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >BM164</td><td align="center" valign="middle" >F: TCTTGCGACCGAGCTTCTCC</td><td align="center" valign="middle"  rowspan="2"  >(CT)<sub>17</sub></td><td align="center" valign="middle" >55˚C</td></tr><tr><td align="center" valign="middle" >R: CTGAATCTGAGGAACGATGACCAG</td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><p>analysis using the Bayesian model-based analyses using the software package Structure v2.3.4 [<xref ref-type="bibr" rid="scirp.122156-ref29">29</xref>]. The membership of each accession was run for the value of K = 2 to K = 10 with the admixture model and correlated allele frequency. Accessions with membership probabilities greater than 0.8 were grouped together and accessions with membership probabilities below 0.8 were assigned to the admixed group. For each K, it was replicated 3 times. Each run was implemented with a length of the burn-in period of 1000 followed by 10,000 Markov Chain Monte Carlo (MCMC) replicates. The ΔK method was used to identify the optimal value of K [<xref ref-type="bibr" rid="scirp.122156-ref30">30</xref>] using the online Structure Harvester program [<xref ref-type="bibr" rid="scirp.122156-ref31">31</xref>].</p><p>Principal Coordinate Analysis (PCoA) and Molecular Variance Analysis (AMOVA) were performed using GenAlEx 6.503 software [<xref ref-type="bibr" rid="scirp.122156-ref32">32</xref>] to estimate the genetic differentiation within and among the different subpopulations. Population genetic parameters such as the average number of total alleles (Na), Shannon-Weaver information index (I), the average number of private alleles (Pa), Shannon-Weaver diversity index (h), percentage of polymorphic loci, PhiPT and allele across the different subpopulations were calculated. Data were coded as suggested in the GenAlEx 6.503 software user manual [<xref ref-type="bibr" rid="scirp.122156-ref32">32</xref>].</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><sec id="s3_1"><title>3.1. SSR Genotyping and Genetic Diversity Analysis</title><p>SSR markers are nuclear markers that are widely used in population genetic studies and provide important information for the preservation of genetic diversity [<xref ref-type="bibr" rid="scirp.122156-ref33">33</xref>]. In the present study, of the 10 SSR markers, 6 were amplified in all accessions and were therefore retained for the various analyses. The 6 SSR markers analyzed generated a total of 28 alleles with an average of 4.16 alleles per SSR. The number of alleles ranged from 2 (BM160 and GATS91) to 8 (BM141). As repeat polymorphisms revealed by SSRs or RAPD and over DNA markers result from the addition or deletion of the entire repeat units or motifs [<xref ref-type="bibr" rid="scirp.122156-ref34">34</xref>], the polymorphism revealed by these types of markers depends both on the repeat pattern, its location in the genome of the species in connection with the speed of evolution of the species and on the size of the analyzed collection [<xref ref-type="bibr" rid="scirp.122156-ref35">35</xref>]. Thus, the relatively lower number of alleles reported in this study can be explained by the size of the analyzed collection, the location of the markers, or also, the number of markers used. The polymorphic information content value which indicated the informativeness of the loci and their ability to detect differences between the genotypes [<xref ref-type="bibr" rid="scirp.122156-ref36">36</xref>] ranged from 0.079 for the GATS91 marker to 0.680 for the BM 140 marker with an average of 0.408 (<xref ref-type="table" rid="table3">Table 3</xref>). This average PIC value is relatively low and supported the low level of discrimination of the SSR markers used in the present study however BM 140 marker was found to be the most appropriate for testing genetic diversity given its high level of polymorphism. These diversity indices which are the average number of alleles per locus and the PIC reported in the present study were slightly lower than the previously reported by Gomes et al. [<xref ref-type="bibr" rid="scirp.122156-ref26">26</xref>] who reported 10.27 alleles per locus and an average PIC value</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Genetic diversity parameters of the 6 SSR markers across analyzed accessions</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >SSR markers</th><th align="center" valign="middle" >Na</th><th align="center" valign="middle" >PIC</th><th align="center" valign="middle" >P</th></tr></thead><tr><td align="center" valign="middle" >BM211</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >0.451</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle" >BM160</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0.437</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle" >GATS91</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0.079</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle" >AG1</td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >0.605</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle" >BM164</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0.197</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle" >BM141</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >0.680</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle" >Moyenne</td><td align="center" valign="middle" >4.16</td><td align="center" valign="middle" >0.408</td><td align="center" valign="middle" >100</td></tr></tbody></table></table-wrap><p>of 0.675 studying a set of 153 lima bean accessions. These findings reinforced the fact that the size of the collection influences the number of total alleles.</p><p>However, these markers, although having presented a relatively low level of discrimination, made it possible to reveal using the Neighbor-Joining tree based on the genetic distance, 3 clusters within all the 28 analyzed accessions. Cluster 1 labeled in red grouped 8 accessions, cluster 2 labeled in black grouped 6 accessions, and cluster 3, labeled in blue grouped 14 accessions (<xref ref-type="fig" rid="fig1">Figure 1</xref>). This grouping of accessions revealed potential duplicates in the analyzed collection. Indeed, an analysis of the inferred tree showed 5 pairs of duplicates (V8V9, V3V20, V27V7, V5V23, and V26V24) which exhibited the same evolutionary distance. This may be due to usual genotype exchanges among farmers.</p></sec><sec id="s3_2"><title>3.2. Population Structure and Genetic Differentiation Analysis</title><p>Revealing Lima bean population structure and genetic diversity is important for breeding efforts which is an essential step in any genetic improvement process through the identification of promising genotypes [<xref ref-type="bibr" rid="scirp.122156-ref37">37</xref>]. Data generated from SSR genotyping was used to assess the population structure of the Lima bean collection. The estimation of the delta K value, using Evanno’s method, showed the highest peak at K = 3 (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="fig" rid="fig3">Figure 3</xref>), indicating that the 28 accessions could be grouped into three sub-populations based on differences in their genetic traits. The first one labeled in red grouped 9 accessions, the second labeled in green grouped 7 accessions, and the third labeled in blue groups 12 accessions. Our results contradicted Gomes et al.’s [<xref ref-type="bibr" rid="scirp.122156-ref26">26</xref>] study in the determination of the genetic diversity and population structure from a core collection of 153 Lima beans. Maybe to our SSR markers’ low level of discrimination. According to the probability of membership, the accessions of the different subpopulations were classified as pure or admixed. To this end, 25 accessions presented a certain belonging to one of the three sub-populations. Thus, the results of the structure revealed a low level of admixture of 10.71% suggesting a non-negligible differentiation between the different sub-populations [<xref ref-type="bibr" rid="scirp.122156-ref38">38</xref>].</p><p>Analysis of Molecular Variance results revealed significant differences within and between populations (p = 0.001). 32% of the genetic variation came from</p><p>inter-population and 68% of the genetic variation came from intra-population suggesting that the genetic variation within populations was larger than that between populations [<xref ref-type="bibr" rid="scirp.122156-ref39">39</xref>]. However, a high PhiP value (0.321) was found between the three sub-subpopulations indicating a high and significative (p = 0.001) genetic differentiation between these sub-subpopulations. Comparing genetic differentiation between sub-populations showed a low differentiation between sub-populations 1 and 3 (PhiPT = 0.25). The largest index was observed between subpopulation 2 and subpopulation 3 (PhiPT = 0.47). The high level of genetic differentiation found for the Lima bean in the present study may be explained by the reproductive characteristics of this crop. According to Penha et al. [<xref ref-type="bibr" rid="scirp.122156-ref11">11</xref>] and Nasir et al. [<xref ref-type="bibr" rid="scirp.122156-ref2">2</xref>], Lima bean had a mixed system with a predominance of self-fertilization, with only 38% of natural crossing which limits gene flow and therefore increases diversity among populations. This coincided with the AMOVA results (<xref ref-type="table" rid="table4">Table 4</xref>), where 32% of the total variation was accounted for by among-subpopulation variations. Our results are consistent with Martinez et al. [<xref ref-type="bibr" rid="scirp.122156-ref40">40</xref>] who reported low gene flow between populations of Lima beans from the Yucatan Peninsula which could be due to a low rate of seed exchange among farmers which could lead to low intermix among populations [<xref ref-type="bibr" rid="scirp.122156-ref2">2</xref>].</p><p>The allelic pattern and genetic diversity indices provided insight into genetic diversity within subpopulations [<xref ref-type="bibr" rid="scirp.122156-ref41">41</xref>]. The average number of alleles (Na) ranged from 3.83 within the accessions in sub-population 1 to 1.67 in sub-population 2. The percentage of polymorphic loci ranged from 50% to 100%. Subpopulation 1 had the highest average number of alleles (Na), Shannon-Weaver information (I), Shannon-Weaver diversity (h) indices (I = 1.18 and h = 0.64) and exhibited the highest mean number of private alleles (Pa = 0.11) (<xref ref-type="table" rid="table4">Table 4</xref>) meaning that subpopulation 1 was more diverse than the two overs. As a result, subpopulation 1 could be considered as the main gene pool and could serve as a source for the</p><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Analysis of Molecular Variance (AMOVA) of the genetic variation among and within subpopulations of Lima bean using a set of 6 SSR</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Source</th><th align="center" valign="middle" >df</th><th align="center" valign="middle" >SS</th><th align="center" valign="middle" >MS</th><th align="center" valign="middle" >Est. Var.</th><th align="center" valign="middle" >%</th></tr></thead><tr><td align="center" valign="middle" >Among subpopulations</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >25.667</td><td align="center" valign="middle" >12.833</td><td align="center" valign="middle" >1.144</td><td align="center" valign="middle" >32%</td></tr><tr><td align="center" valign="middle" >Within subpopulations</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >60.369</td><td align="center" valign="middle" >2.415</td><td align="center" valign="middle" >2.415</td><td align="center" valign="middle" >68%</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >86.036</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >3.559</td><td align="center" valign="middle" >100%</td></tr></tbody></table></table-wrap><p>selection of parents to improve the existing Lima bean landraces. The number of accessions with private alleles ranged from 4 in subpopulation 2 to 9 in subpopulation 1. The number of markers with private alleles ranged from 1 (for a total of 12 accessions) to 5 (for a total of two accessions: V27 and V7) (<xref ref-type="table" rid="table5">Table 5</xref> and <xref ref-type="table" rid="table6">Table 6</xref>).</p><p>The first two axes of the PCoA expressed 43.83% of the total variation in the analyzed collection. The results revealed three well-separated clusters among the analyzed accessions in accordance with the population structure results (<xref ref-type="fig" rid="fig4">Figure 4</xref>) and coincided with the clustering based on the Neighbor-Joining tree.</p><table-wrap id="table5" ><label><xref ref-type="table" rid="table5">Table 5</xref></label><caption><title> Level of genetic diversity within the 3 subpopulations</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Pop</th><th align="center" valign="middle" >SP1</th><th align="center" valign="middle" >SP2</th><th align="center" valign="middle" >SP3</th></tr></thead><tr><td align="center" valign="middle" >N</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >12</td></tr><tr><td align="center" valign="middle" >Na</td><td align="center" valign="middle" >3.83</td><td align="center" valign="middle" >1.67</td><td align="center" valign="middle" >2.50</td></tr><tr><td align="center" valign="middle" >I</td><td align="center" valign="middle" >1.18</td><td align="center" valign="middle" >0.34</td><td align="center" valign="middle" >0.53</td></tr><tr><td align="center" valign="middle" >H</td><td align="center" valign="middle" >0.64</td><td align="center" valign="middle" >0.22</td><td align="center" valign="middle" >0.31</td></tr><tr><td align="center" valign="middle" >Pa</td><td align="center" valign="middle" >2.17</td><td align="center" valign="middle" >0.50</td><td align="center" valign="middle" >0.67</td></tr><tr><td align="center" valign="middle" >%P</td><td align="center" valign="middle" >100.00%</td><td align="center" valign="middle" >50.00%</td><td align="center" valign="middle" >83.33%</td></tr></tbody></table></table-wrap><p>SP: Subpopulation; N: Number of accessions; Na: Average number of alleles; I: Shannon-Weaver information index; h: Shannon-Weaver diversity index; Pa: Average number of private rare alleles; %P: Percentage of polymorphic loci.</p><table-wrap id="table6" ><label><xref ref-type="table" rid="table6">Table 6</xref></label><caption><title> List of accessions with 1 or more private alleles</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Accessions</th><th align="center" valign="middle" >SP</th><th align="center" valign="middle" >Number of Private alleles</th><th align="center" valign="middle" >SSR markers</th></tr></thead><tr><td align="center" valign="middle" >V12</td><td align="center" valign="middle" >SP1</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >BM211 AG1</td></tr><tr><td align="center" valign="middle" >V21</td><td align="center" valign="middle" >SP1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >BM211 BM164 BM141</td></tr><tr><td align="center" valign="middle" >V27</td><td align="center" valign="middle" >SP1</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >BM211 BM160 GATS91 AG1BM141</td></tr><tr><td align="center" valign="middle" >V29</td><td align="center" valign="middle" >SP1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >BM211 BM164 BM141</td></tr><tr><td align="center" valign="middle" >V30</td><td align="center" valign="middle" >SP1</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >BM164 BM141</td></tr><tr><td align="center" valign="middle" >V33</td><td align="center" valign="middle" >SP1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >BM211 BM164 BM141</td></tr><tr><td align="center" valign="middle" >V4</td><td align="center" valign="middle" >SP1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >BM211 BM160 BM141</td></tr><tr><td align="center" valign="middle" >V6</td><td align="center" valign="middle" >SP1</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >BM211 BM160</td></tr><tr><td align="center" valign="middle" >V7</td><td align="center" valign="middle" >SP1</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >BM211 BM160 GATS91 AG1 BM141</td></tr><tr><td align="center" valign="middle" >V22</td><td align="center" valign="middle" >SP2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BM141</td></tr><tr><td align="center" valign="middle" >V23</td><td align="center" valign="middle" >SP2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BM141</td></tr><tr><td align="center" valign="middle" >V25</td><td align="center" valign="middle" >SP2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BM141</td></tr><tr><td align="center" valign="middle" >V28</td><td align="center" valign="middle" >SP2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >GATS91</td></tr><tr><td align="center" valign="middle" >V1</td><td align="center" valign="middle" >SP3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >AG1</td></tr><tr><td align="center" valign="middle" >V13</td><td align="center" valign="middle" >SP3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BM211</td></tr><tr><td align="center" valign="middle" >V14</td><td align="center" valign="middle" >SP3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BM211</td></tr><tr><td align="center" valign="middle" >V15</td><td align="center" valign="middle" >SP3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BM211</td></tr><tr><td align="center" valign="middle" >V16</td><td align="center" valign="middle" >SP3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >AG1</td></tr><tr><td align="center" valign="middle" >V2</td><td align="center" valign="middle" >SP3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BM211</td></tr><tr><td align="center" valign="middle" >V20</td><td align="center" valign="middle" >SP3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BM141</td></tr><tr><td align="center" valign="middle" >V5</td><td align="center" valign="middle" >SP3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BM211</td></tr></tbody></table></table-wrap></sec></sec><sec id="s4"><title>4. Conclusion</title><p>In this study, we used SSR markers to assess the genetic diversity and structure of the Lima bean landrace grown in Benin. The polymorphism rate and polymorphic information content values were sufficient to reveal the existence of potential duplicates and 3 highly differentiated subpopulations in the analyzed collection. By exhibiting the highest average number of alleles, Shannon-Weaver information and Shannon-Weaver diversity indices, and the highest mean number of private alleles, subpopulation 1 is the main gene pool of the analyzed collection. The present study is an important starting point for the establishment of appropriate conservation strategies and breeding programs for Lima bean genetic resources. Knowledge of population structure and genome variation is essential for genome-wide association studies of complex traits and for the investigation of functional genes.</p></sec><sec id="s5"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s6"><title>Cite this paper</title><p>Fagb&#233;dji, R.F., Djedatin, L.G., Nanoukon, C., Kinhoegbe, G., Havivi, A., Y&#233;domonhan, H. and Agbangla, C. (2023) Insight into Genetic Diversity of Cultivated Lima Bean (Phaseolus lunatus L.) in Benin. American Journal of Molecular Biology, 13, 32-45. https://doi.org/10.4236/ajmb.2023.131003</p></sec></body><back><ref-list><title>References</title><ref id="scirp.122156-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Heuzé, V., Tran, G., Sauvant, D., Bastianelli, D. and Lebas, F. (2015) Lima Bean (Phaseolus lunatus). Feedipedia, a Program by INRA, CIRAD, AFZ, and FAO.  
http://www.feedipedia.org/node/267</mixed-citation></ref><ref id="scirp.122156-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Nasir, L., Feyissa, T. and Asfaw, Z. (2021) Genetic Diversity Analysis of Lima Bean (Phaseolus lunatus L.) Landrace from Ethiopia as Reve by ISSR Marker. SINET: Ethiopian Journal of Science, 44, 81-90. https://doi.org/10.4314/sinet.v44i1.8</mixed-citation></ref><ref id="scirp.122156-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Tchumou, M., Yao, B., Kossonou, Y.K., Adingra, K.M.D. and Tano, K. (2017) Enquête ethnobotanique sur l’importance alimentaire et socio-économique des graines de (Phaseolus lunatus (L.)) consommées au Sud et Est de la Cote d’Ivoire. International Journal of Innovation and Applied Studies, 21, 388-397.</mixed-citation></ref><ref id="scirp.122156-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Gepts, P. (2014) The Contribution of Genetic and Genomic Approaches to Plant Domestication Studies. Current Opinion in Plant Biology, 18, 51-59. 
https://doi.org/10.1016/j.pbi.2014.02.001</mixed-citation></ref><ref id="scirp.122156-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Camacho-Pérez, L., Martínez-Castillo, J., Mijangos-Cortés, J.O., Ferrer-Ortega, M., Baudoin, J.P. and Andueza-Noh, R.H. (2018) Genetic Structure of Lima Bean (Phaseolus lunatus L.) Landraces Grown in the Mayan Area. Genetic Resources and Crop Evolution, 65, 229-241. https://doi.org/10.1007/s10722-017-0525-1</mixed-citation></ref><ref id="scirp.122156-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Dansi, A., Vodouhe, R., Azokpota, P., Yedomonhan, H., Assogba, P., Adjatin, A., Loko, Y.L., Dossou-Aminon, I. and Akpagana, K. (2012) Diversity of the Neglected and Underutilized Crop Species of Importance in Benin. The Science World Journal, 2012, Article ID: 932947. https://doi.org/10.1100/2012/932947</mixed-citation></ref><ref id="scirp.122156-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Kinhoégbè, G., Djèdatin, G., Saxena, R.K., Chitikineni, A., Bajaj, P., Molla, J., Agbangla, C., Dansi, A. and Varshney, R.K. (2022) Genetic Diversity and Population Structure of Pigeonpea (Cajanus cajan [L.] Millspaugh) Landraces Grown in Benin Revealed by Genotyping-by-Sequencing. PLOS ONE, 17, e0271565.  
https://doi.org/10.1371/journal.pone.0271565</mixed-citation></ref><ref id="scirp.122156-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Dissanayake, R., Braich, S., Cogan, N., Smith, K. and Kaur, S. (2020) Characterization of Genetic and Allelic Diversity Amongst Cultivated and Wild Lentil Accessions for Germplasm Enhancement. Frontiers in Genetics, 11, Article 546.  
https://doi.org/10.3389/fgene.2020.00546</mixed-citation></ref><ref id="scirp.122156-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Khazaei, H., Caron, C.T., Fedoruk, M., Diapari, M., Vandenberg, A., Coyne, C.J., McGee, R. and Bett, K.E. (2016) Genetic Diversity of Cultivated Lentil (Lens culinaris Medik.) and Its Relation to the World’s Agro-Ecological Zones. Frontiers in Plant Science, 26, Article 1093. https://doi.org/10.3389/fpls.2016.01093</mixed-citation></ref><ref id="scirp.122156-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Cheng, J., Qin, C., Tang, X., Zhou, H., Hu, Y., Zhao, Z., Hu, K., et al. (2016) Development of a SNP Array and Its Application to Genetic Mapping and Diversity Assessment in Pepper (Capsicum spp.). Scientific Reports, 6, Article No.33293. 
https://doi.org/10.1038/srep33293</mixed-citation></ref><ref id="scirp.122156-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Penha, J.S., Lopes, A.C.A., Gomes, R.L.F., Pinheiro, J.B., Filho, J.R.A., Silvestre, E.A., Viana, J.P.G. and Martínez-Castillo, J. (2017) Estimation of Natural Outcrossing Rate and Genetic Diversity in Lima Bean (Phaseolus lunatus L. var. Lunatus) from Brazil Using SSR Markers: Implications for Conservation and Breeding. Genetic Resources and Crop Evolution, 64, 1355-1364.  
https://doi.org/10.1007/s10722-016-0441-9</mixed-citation></ref><ref id="scirp.122156-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Sharma, S., Dastagiri, M.B. and Reddy, M.N. (2017) Morphological Variation and Evaluation of Gladiolus (Gladiolus Hybridus hort.) Cultivars. Journal of Horticulture, 4, Article ID: 1000212. https://doi.org/10.4172/2376-0354.1000212</mixed-citation></ref><ref id="scirp.122156-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Chalak, A.L., Vaikar, S.L. and Barangule, S. (2018) Effect of Varying Levels of Potassium and Zinc on Yield, Yield Attributes, Quality of Pigeon Pea (Cajanus cajan L. Millsp.). International Journal of Chemical Studies, 6, 1432-1435.</mixed-citation></ref><ref id="scirp.122156-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Hasan, N., Choudhary, S., Naaz, N., Sharma, N. and Laskar, R.A. (2021) Recent Advancements in Molecular Marker-Assisted Selection and Applications in Plant Breeding Programmes. Journal of Genetic Engineering and Biotechnology, 19, Article No. 128. https://doi.org/10.1186/s43141-021-00231-1</mixed-citation></ref><ref id="scirp.122156-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Mishra, K.K., Fougat, R.S., Ballani, A., Vinita, T., Yachana, J. and Madhumati, B. (2014) Potential and Application of Molecular Markers Techniques for Plant Genome Analysis. Indian Journal of Pure &amp; Applied Biosciences, 2, 169-188.</mixed-citation></ref><ref id="scirp.122156-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Danny, H., Teresa, B., Daniela, M.O.B., Camila, N.S.O., Lidio, C., Victor, W., Lusike, W., John, M., Aurillia, M., Gamini, W.L.S., Terrence, M., Harshani, V.H.N., Ayfer, T., Saadet, T.A., Nurcan, G., Nina, L., Eliot, G. and Florence, T. (2019) The Potential of Neglected and Underutilized Species for Improving Diets and Nutrition. Planta, 250, 709-729. https://doi.org/10.1007/s00425-019-03169-4</mixed-citation></ref><ref id="scirp.122156-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Li, X. and Siddique, K.H.M. (2018) Future Smart Food—Rediscovering Hidden Treasures of Neglected and Underutilized Species for Zero Hunger in Asia. FAO, Bangkok. https://doi.org/10.18356/23b5f7ab-en</mixed-citation></ref><ref id="scirp.122156-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Li, X., Yadav, R. and Siddique, K.H.M. (2020) Neglected and Underutilized Crop Species: The Key to Improving Dietary Diversity and Fighting Hunger and Malnutrition in Asia and the Pacific. Frontiers in Nutrition, 7, Article 593711.  
https://doi.org/10.3389/fnut.2020.593711</mixed-citation></ref><ref id="scirp.122156-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">FAO, IFAD, UNICEF, WFP and WHO (2019) The State of Food Security and Nutrition in the World 2019. Safeguarding against Economic Slowdowns and Downturns. FAO, Rome.</mixed-citation></ref><ref id="scirp.122156-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Chiurugwi, T., Kemp, S., Powell, W. and Hickey, L.T. (2019) Speed Breeding Orphan Crops. Theoretical and Applied Genetics, 132, 607-616.  
https://doi.org/10.1007/s00122-018-3202-7</mixed-citation></ref><ref id="scirp.122156-ref21"><label>21</label><mixed-citation publication-type="book" xlink:type="simple">Dawson, I.K., McMullin, S., Kindt, R., Muchugi, A., Hendre, P., Lilleso, J.P.B. and Jamnadass, R. (2019) Delivering Perennial New and Orphan Crops for Resilient and Nutritious Farming Systems. In: Rosenstock, T.S., Girvetz, E. and Nowak, A., Eds., The Climate-Smart Agriculture Papers, Springer, Cham, 113-125. 
https://doi.org/10.1007/978-3-319-92798-5_10</mixed-citation></ref><ref id="scirp.122156-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Li, X. and Siddique, K.H.M. (2020) Future Smart Food: Harnessing the Potential of Neglected and Underutilized Species for Zero Hunger. Maternal &amp; Child Nutrition, 16, e13008. https://doi.org/10.1111/mcn.13008</mixed-citation></ref><ref id="scirp.122156-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Zavinon, F., Adoukonou-Sagbadja, H., Keilwagen, J., Lehnert, H. and Ordon, F.P. (2020) Genetic Diversity and Population Structure in Beninese Pigeon Pea [Cajanus cajan (L.) Huth] Landraces Collection Revealed by SSR and Genome Wide SNP Markers. Genetic Resources and Crop Evolution, 67, 191-208.  
https://doi.org/10.1007/s10722-019-00864-9</mixed-citation></ref><ref id="scirp.122156-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Akohoue, F., Achigan-Dako, E.G., Sneller, C., Van, D.A. and Sibiya, J. (2020) Genetic Diversity, SNP-Trait Associations and Genomic Selection Accuracy in a West African Collection of Kersting’s Groundnut [Macrotyloma geocarpum (Harms) Maréchal &amp; Baudet]. PLOS ONE, 15, e0234769.  
https://doi.org/10.1371/journal.pone.0234769</mixed-citation></ref><ref id="scirp.122156-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Chen, H., Rangasamy, M., Tan, S.Y., Wang, H. and Siegfried, B.D. (2010) Evaluation of Five Methods for Total DNA Extraction from Western Corn Rootworm Beetles. PLOS ONE, 5, e11963. https://doi.org/10.1371/journal.pone.0011963</mixed-citation></ref><ref id="scirp.122156-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Gaitán-Solís, E., Duque, M.C., Edwards, K.J. and Tohme, J. (2002) Microsatellite Repeats in Common Bean (Phaseolus vulgaris L.): Isolation, Characterization, and Cross-Species Amplification in Phaseolus ssp. Crop Science, 42, 2128-2136. 
https://doi.org/10.2135/cropsci2002.2128</mixed-citation></ref><ref id="scirp.122156-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Gomes, R.L.F., Costa, M.F., Alves-Pereira, A., Bajay, M.M., et al. (2020) A Lima Bean Core Collection Based on Molecular Markers. Scientia Agricola, 77, e20180140.  
https://doi.org/10.1590/1678-992x-2018-0140</mixed-citation></ref><ref id="scirp.122156-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Kempf, K., Mora-Ortiz, M., Smith, L.M.J., et al. (2016) Characterization of Novel SSR Markers in Diverse Sainfoin (Onobrychis viciifolia) Germplasm. BMC Genetics, 17, Article No. 124. https://doi.org/10.1186/s12863-016-0431-0</mixed-citation></ref><ref id="scirp.122156-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Perrier, X. and Jacquemoud-Collet, J.P. (2006) DARwin Software.  
http://darwin.cirad.fr/</mixed-citation></ref><ref id="scirp.122156-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Pritchard, J.K., Stephens, M. and Donnelly, P. (2000) Inference of Population Structure Using Multilocus Genotype Data. Genetics, 155, 945-959.  
https://doi.org/10.1093/genetics/155.2.945</mixed-citation></ref><ref id="scirp.122156-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Evanno, G., Regnaut, S. and Goudet, J. (2005) Detecting the Number of Clusters of Individuals Using the Software STRUCTURE: A Simulation Study. Molecular Ecology, 14, 2611-2620. https://doi.org/10.1111/j.1365-294X.2005.02553.x</mixed-citation></ref><ref id="scirp.122156-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Earl, D.A. and Vonholdtb, M. (2012) Structure Harvester: A Website and Program for Visualizing Structure Output and Implementing the Evanno Method. Conservation Genetics Resources, 4, 359-361. https://doi.org/10.1007/s12686-011-9548-7</mixed-citation></ref><ref id="scirp.122156-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Peakall, R. and Smouse, P.E. (2012) GenAlEx 6.5: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research—An Update. Bioinformatics, 28, 2537-2539. https://doi.org/10.1093/bioinformatics/bts460</mixed-citation></ref><ref id="scirp.122156-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Liu, Y.L., Geng, Y.P., Song, M.L., Zhang, P.F., Hou, J.L. and Wang, W. (2019) Genetic Structure and Diversity of Glycyrrhiza Populations Based on Transcriptome SSR Markers. Plant Molecular Biology Reporter, 37, 401-412. 
https://doi.org/10.1007/s11105-019-01165-2</mixed-citation></ref><ref id="scirp.122156-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Vieira, M.L., Santini, L., Diniz, A.L. and Munhoz, C.F. (2016) Microsatellite Markers: What They Mean and Why They Are So Useful. Genetics and Molecular Biology, 39, 312-328. https://doi.org/10.1590/1678-4685-GMB-2016-0027</mixed-citation></ref><ref id="scirp.122156-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Gao, C.H., Ren, X.D., Mason, A.S., Li, J., Wang, W., Xiao, M. and Fu, D. (2013) Revisiting an Important Component of Plant Genomes: Microsatellites. Functional Plant Biology, 40, 645-645. https://doi.org/10.1071/FP12325</mixed-citation></ref><ref id="scirp.122156-ref37"><label>37</label><mixed-citation publication-type="book" xlink:type="simple">Reyes-Valdés, M.H. (2013) Informativeness of Microsatellite Markers. In: Kantartzi, S., Ed., Microsatellites. Methods in Molecular Biology, Humana Press, Totowa, NJ, 259-270. https://doi.org/10.1007/978-1-62703-389-3_18</mixed-citation></ref><ref id="scirp.122156-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Jo, K.R., Cho, S., Cho, J.H., Park, H.J, Choi, J.G., Park, Y.E. and Cho, K.S. (2022) Analysis of Genetic Diversity and Population Structure among Cultivated Potato Clones from Korea and Global Breeding Programs. Scientific Reports, 12, Article No. 10462. https://doi.org/10.1038/s41598-022-12874-2</mixed-citation></ref><ref id="scirp.122156-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Pandey, J., Scheuring, D.C., Koym, J.W., Coombs, J., Novy, R.G., Thompson, A.L., Holm, D.G., Douches, D.S., Miller, J.C. and Vales, M.I. (2021) Genetic Diversity and Population Structure of Advanced Clones Selected over Forty Years by a Potato Breeding Program in the USA. Scientific Reports, 11, Article No. 8344. 
https://doi.org/10.1038/s41598-021-87284-x</mixed-citation></ref><ref id="scirp.122156-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Martinez, J.C., Ferrer, M.M. and Andueza, R. (2017) Genetic Structure of Lima Bean (Phaseolus lunatus L.) Landraces Grown in the Mayan Area. Genetic Resources and Crop Evolution, 10, 1007-1017.</mixed-citation></ref><ref id="scirp.122156-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Luo, Z.N., Brock, J., Dyer, J.M., Kutchan, T., Schachtman, D., Augustin, M., Ge, Y., Fahlgren, N. and Abdel-Haleem, H. (2019) Genetic Diversity and Population Structure of a Camelina Sativa Spring Panel. Frontiers in Plant Science, 10, Article 184.  
https://doi.org/10.3389/fpls.2019.00184</mixed-citation></ref></ref-list></back></article>