<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AE</journal-id><journal-title-group><journal-title>Advances in Entomology</journal-title></journal-title-group><issn pub-type="epub">2331-1991</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ae.2023.111001</article-id><article-id pub-id-type="publisher-id">AE-121768</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Zoonotic Pathogens Detected in Ticks in Kenyan Game Reserves
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Salim</surname><given-names>Kobo Godani</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Menza</surname><given-names>Nelson Chengo</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Margaret</surname><given-names>W. Muturi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Medical Laboratory Sciences, Kenyatta University, Nairobi, Kenya</addr-line></aff><pub-date pub-type="epub"><day>09</day><month>12</month><year>2022</year></pub-date><volume>11</volume><issue>01</issue><fpage>1</fpage><lpage>9</lpage><history><date date-type="received"><day>1,</day>	<month>October</month>	<year>2022</year></date><date date-type="rev-recd"><day>9,</day>	<month>December</month>	<year>2022</year>	</date><date date-type="accepted"><day>12,</day>	<month>December</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Little is known on tick-borne pathogens and their role in disease in game reserves in Kenya. Ticks were collected by sterile forceps from restrained cattle hide and placed into labeled falcon tubes. Ticks were screened for pathogens by High Resolution Melting (HRM) analysis and sequencing of specific RT-PCR products of 
  Anaplasma, 
  Ehrlichia, and 
  Rickettsia species. A total of 317 ticks (281 adult ticks and 36 nymphs) comprising seven species were collected around the Tsavo National Reserve (TNR) in Taita Taveta County with 
  Amblyomma gemma being the most commonly collected species (n = 135, 42.6%). From near Shimba Hill game reserve (SHNR), a total of 240 adult’s ticks were sampled, representing eight species, with again 
  Amblyomma gemma being the most sampled species (n = 156, 65%). From Tsavo, a total of three pools of 
  Rhipicephalus appendiculatus were positive for Theileria 
  parva, two pools of 
  Rhipicephaline evertsi for 
  Anaplasma platys and one pool of 
  Amblyomma variegatum nymphs for 
  Rickettsia africae. 
  Rickettsia africae, which causes African tick-bite fever, was detected in two pools of 
  Am. variegatum and one pool of 
  Amblyomma gemma collected near Shimba Hill game reserve. Rickettsia sp. and Anaplasma sp. were detected in 
  Am. gemma and 
  Rh. evertsi respectively. 
  Rickettsia aeschlimannii was detected in a pool of 
  Am. gemma. These findings highlight the risk of transmission of zoonotic pathogens to humans in regions with high human-wildlife interfaces. Of specific importance, we provide evidence of 
  R. aeschlimannii in 
  A. gemma for the first time, representing a potential new 
  R. aeschlimannii vectors.
 
</p></abstract><kwd-group><kwd>High Resolution Melting</kwd><kwd> &lt;i&gt;Amblyomma gemma&lt;/i&gt;</kwd><kwd> &lt;i&gt;Rickettsia africae&lt;/i&gt;</kwd><kwd> &lt;i&gt;Rickettsia aeschlimannii&lt;/i&gt;</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Tick-borne diseases are amongst neglected tropical diseases leading to high prevalence and distribution morbidity [<xref ref-type="bibr" rid="scirp.121768-ref1">1</xref>]. Lack of current information on the prevalence and distribution of tick-borne diseases and their vectors in sub-Saharan Africa make it difficult to assess their true impact [<xref ref-type="bibr" rid="scirp.121768-ref1">1</xref>]. Tick-borne pathogens include Ehrlichia chaffeensis, Ehrlichia ewingii, E. canis, E. ruminantium, and Anaplasma phagocytophilum [<xref ref-type="bibr" rid="scirp.121768-ref2">2</xref>]. Kyasanur Forest disease virus and Crimean-Congo hemorrhagic fever virus are some of viruses transmitted by ticks [<xref ref-type="bibr" rid="scirp.121768-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.121768-ref4">4</xref>]. The most important tick-borne diseases affecting livestock in Kenya includes theileriosis, anaplasmosis, babesiosis, and heartwater [<xref ref-type="bibr" rid="scirp.121768-ref5">5</xref>]. Omondi et al. [<xref ref-type="bibr" rid="scirp.121768-ref6">6</xref>] reported canine ehrlichiosis (E. ruminantium, Ehrlichia canis, and Ehrlichia sp), anaplasmosis (Anaplasma ovis, Anaplasma platys and A. bovis), and rickettsiosis (Rickettsia aeschlimannii) in ticks collected around Lake Victoria and Lake Baringo.</p><p>Encroachment of human settlements into the game areas by the pastoral communities has led to the emergence and re-emergence of tick-borne zoonotic diseases [<xref ref-type="bibr" rid="scirp.121768-ref7">7</xref>]. Other activities such as commercial ranching, and tourism increases the risk of pathogen transmission [<xref ref-type="bibr" rid="scirp.121768-ref8">8</xref>]. This has exposed the humans to the bite of the vectors [<xref ref-type="bibr" rid="scirp.121768-ref9">9</xref>]. Several tick-borne zoonotic pathogens have been detected in wildlife protected areas in Kenya [<xref ref-type="bibr" rid="scirp.121768-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.121768-ref11">11</xref>]. In order to curb the spread of these tick-borne pathogens the government must impose strict measure to prevent human encroachment into wildlife areas.</p><p>There is limited knowledge of circulating tick-borne pathogens of medical importance in their biological vectors at human-wildlife-livestock interface in Kenya due to limited resources. This study aimed at addressing the gap in knowledge on the zoonotic tick-borne pathogens circulating at human-wildlife-livestock interfaces in the Tsavo National Reserve (TNR) and the Shimba Hills National Reserve (SHNR), Kenya, by surveying the tick diversity and associated tick-borne pathogens.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Study Area</title><p>Sampling approval was obtained from the Kenya’s Directorate of Veterinary Services and Ministry of Health. Informed consent was obtained from the livestock’s owner before sampling of the ticks at near Tsavo and Shimba Hills National Reserves, Kenya. The two selected human-wildlife-livestock interfaces were selected based on encroachment human settlement by the pastoral community and reported cases of tick-borne pathogens of economic and public health burden. The Tsavo National Park is a protected area in Kenya, and borders the Chyulu Hills National Park in Kenya and Mkomazi game reserve of Tanzania. The park is divided by the highway road that runs from Nairobi to Mombasa into Tsavo East national park (13,747 Km<sup>2</sup>) and Tsavo West national park (9065 Km<sup>2</sup>). The SHNR is a wildlife protected area in Kwale County. It is the largest forest area in east African and home to a variety of wildlife species.</p><p>This map is republished with data under CC BY licenses from the following sources: https://www.wri.org/resources/data-sets/kenya-gis-data from the World Institute Resources, 2007 [<xref ref-type="bibr" rid="scirp.121768-ref12">12</xref>]; https://africaopendata.org/dataset/kenya-counties-shapefile from openAfrica, 2015 [<xref ref-type="bibr" rid="scirp.121768-ref13">13</xref>]; and https://gadm.org/data.html from GADM, 2018 [<xref ref-type="bibr" rid="scirp.121768-ref14">14</xref>] (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p></sec><sec id="s2_2"><title>2.2. Tick Collection and Identification</title><p>Sampling approval was obtained from the Kenya’s Directorate of Veterinary Services and Ministry of Health. Informed consent was obtained from the livestock’s owner before sampling of the ticks. Ticks were collected from restrained cattle hide using sterile forceps and placed into labeled falcon tubes. The tubes were then plugged with cotton swabs and transported in liquid nitrogen to the testing lab. They were stored at −80˚C until when analyzed [<xref ref-type="bibr" rid="scirp.121768-ref6">6</xref>]. The ticks were identified to genus and/or species level as per the morphological keys [<xref ref-type="bibr" rid="scirp.121768-ref15">15</xref>] using sterile forceps, petri-dishes and gloves. Ticks were pooled according to species, sex and sampling sites into groups of 1 - 11 for adults and 1 - 20 for nymphs as described by Oundo et al. [<xref ref-type="bibr" rid="scirp.121768-ref10">10</xref>]. Representative of these morphologically identified ticks were molecularly identified.</p></sec></sec><sec id="s3"><title>3. Laboratory Procedure</title><sec id="s3_1"><title>3.1. DNA Extraction</title><p>Ticks were homogenized in a 1.5-ml sterile microcentrifuge tubes containing 750 mg of 2-mm yttria-stabilized zirconium using a handheld battery-operated</p><p>homogenizer oxide bead (Glen Mills, Clifton, NJ). DNA was extracted from the homogenate using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) as per the manufacture’s protocol. The concentration and purity of the DNA were evaluated using a Nanodrop spectrophotometer (Thermo Fisher Scientific Wilmington, USA) and extracts stored at −20˚C.</p></sec><sec id="s3_2"><title>3.2. Molecular Detection and Identification of Tick-Borne Pathogens</title><p>Tick-borne pathogens were screened using HRM and characterized by sequencing of specific RT-PCR products of Anaplasma, Ehrlichia, and Rickettsia using genus-specific primers (<xref ref-type="table" rid="table1">Table 1</xref>). For HRM, a 10 &#181;l reaction volume was prepared containing a final concentration of 1&#215; HOT FIREPol Eva-Green HRM mix (Solis BioDyne, Tartu, Estonia), 500 nM of the respective forward and reverse primers (<xref ref-type="table" rid="table1">Table 1</xref>), 100 ng of template DNA and 5 μl nuclease free water. DNA extracts from Anaplasma phagocytophilum, Ehrlichia ruminantium, and Rickettsia africae were used as positive controls while nuclease-free water was used as a negative control. Minimum infection rate was calculated using the following formula: [number of pathogen positive tick pools/total number of ticks of that species tested] &#215; 1000. The MIR assumes that only one tick is positive in a pool.</p></sec><sec id="s3_3"><title>3.3. Data Analysis</title><p>Geneious software version 8.1.9 was used to edit and align all nucleotide sequences using the MAFFT plugin [<xref ref-type="bibr" rid="scirp.121768-ref16">16</xref>]. GenBank database using the Basic Local Alignment Search Tool (https://www.ncbi.nih.gov/BLAST/) was used in sequence identities. The map was prepared using QGIS software version 3.12.1 (QGIS) to show the sampling sites.</p></sec></sec><sec id="s4"><title>4. Results</title><sec id="s4_1"><title>4.1. Tick Diversity and Abundance</title><p>At near Tsavo National Reserve, a total of 317 (281 adult ticks and 36 nymphs) were collected, representing seven species (<xref ref-type="table" rid="table2">Table 2</xref>). Amblyomma ticks dominated the collections with Amblyomma gemma the most sampled species (n = 135, 42.6%). Other Amblyomma species sampled was Amblyomma variegatum (n = 40, 12.62%). Four species of Rhipicephalus ticks were collected including; R. appendiculatus (n = 44, 13.9%), R. evertsi (n = 1, 0.31%), R. decoloratus (n = 5, 1.6%), and Rhipicephalus pulchellus (n = 91, 28.7%). A single Hyalomma specimen was also collected (<xref ref-type="table" rid="table2">Table 2</xref>).</p><p>Near Shimba Hills game reserve 240 adult ticks were collected representing eight species (<xref ref-type="table" rid="table2">Table 2</xref>) and again Amblyomma gemma dominated the collection (n = 156, 65%). Other Amblyomma species sampled included; A. lepidum (n = 5, 2.1%), A. variegatum (n = 15, 6.3%). Rhipicephalus ticks included R. appendiculatus (n = 18, 7.5%), R. evertsi (n = 6, 2.5%), R. decoloratus (n = 4, 1.7%), R. pulchellus (n = 34, 14.2%). Two representatives of Hyalomma scupense were also collected (n = 2, 0.83%) (<xref ref-type="table" rid="table2">Table 2</xref>).</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> PCR primers pairs used in the study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >Target gene</th><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Primer sequence (5’-3’)</th><th align="center" valign="middle" >Amplicon Size (bp)</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >Rickettsia spp.</td><td align="center" valign="middle" >16S rRNA</td><td align="center" valign="middle" >Rick-F1 Rick-R2</td><td align="center" valign="middle" >GAACGCTATCGGTATGCTTAACACA CATCACTCACTCGGTATTGCTGGA</td><td align="center" valign="middle" >364</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.121768-ref15">15</xref>]</td></tr><tr><td align="center" valign="middle" >ompB</td><td align="center" valign="middle" >ompB 2788 ompB 3599</td><td align="center" valign="middle" >AAACAATAATCAAGGTACTGT TACTTCCGGTTACAGCAAAGT</td><td align="center" valign="middle" >856</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.121768-ref16">16</xref>]</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Ehrlichia spp.</td><td align="center" valign="middle"  rowspan="2"  >16S rRNA</td><td align="center" valign="middle" >Ehr 16S F Ehr 16S R</td><td align="center" valign="middle" >CGTAAAGGGCACGTAGGTGGACTA CACCTCAGTGTCAGTATCGAACCA</td><td align="center" valign="middle" >200</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.121768-ref17">17</xref>]</td></tr><tr><td align="center" valign="middle" >EhrJV F EhrJV R</td><td align="center" valign="middle" >GCAACCCTCATCCTTAGTTACCA TGTTACGACTTCACCCTAGTCAC</td><td align="center" valign="middle" >300</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.121768-ref18">18</xref>]</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Anaplasma spp.</td><td align="center" valign="middle"  rowspan="2"  >16S rRNA</td><td align="center" valign="middle" >Ana 16S F Ana 16S R</td><td align="center" valign="middle" >GGGCATGTAGGCGGTTCGGT TCAGCGTCAGTACCGGACCA</td><td align="center" valign="middle" >112 - 200</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.121768-ref17">17</xref>]</td></tr><tr><td align="center" valign="middle" >Ana JV F Ana JV R</td><td align="center" valign="middle" >CGGTGGAGCATGTGGTTTAATTC CGRCGTTGCAACCTATTGTAGTC</td><td align="center" valign="middle" >300</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.121768-ref18">18</xref>]</td></tr><tr><td align="center" valign="middle" >Theileria and Babesia spp.</td><td align="center" valign="middle" >18S rRNA</td><td align="center" valign="middle" >RLB-F RLB-R</td><td align="center" valign="middle" >GAGGTAGTGACAAGAAATAACAATA TCTTCGATCCCCTAACTTTC</td><td align="center" valign="middle" >450</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.121768-ref19">19</xref>]</td></tr></tbody></table></table-wrap><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Abundance and diversity of tick species collected in near Tsavo and Shimba Hills National Reserves, Kenya</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Species</th><th align="center" valign="middle"  colspan="4"  >Near Tsavo</th><th align="center" valign="middle"  colspan="4"  >Near Shimba Hills</th><th align="center" valign="middle"  rowspan="2"  >t-test</th><th align="center" valign="middle"  rowspan="2"  >P value</th></tr></thead><tr><td align="center" valign="middle" >Nymphs</td><td align="center" valign="middle" >Males</td><td align="center" valign="middle" >Females</td><td align="center" valign="middle" >Total %</td><td align="center" valign="middle" >Nymphs</td><td align="center" valign="middle" >Males</td><td align="center" valign="middle" >Females</td><td align="center" valign="middle" >Total %</td></tr><tr><td align="center" valign="middle" >A. gemma</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >39</td><td align="center" valign="middle" >96</td><td align="center" valign="middle" >135</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >59</td><td align="center" valign="middle" >97</td><td align="center" valign="middle" >156</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >A. lepidum</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >A. variegatum</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >40</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >H. scupense</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Hyalomma spp</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >R. appendiculatus</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >13</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >44</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >R. evertsi</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >6</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >R. decoloratus</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >R. pulchellus</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >69</td><td align="center" valign="middle" >91</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >34</td><td align="center" valign="middle" >1.096</td><td align="center" valign="middle" >0.305</td></tr></tbody></table></table-wrap></sec><sec id="s4_2"><title>4.2. Tick-Borne Pathogens Identified</title><p>At near Tsavo National Reserve (TNR) in Taita Taveta County, a total of three pools of Rhipicephaline appendiculatus were positive for Theileria parva (GenBank accession Number OL451869-OL451871), two pools of Rhipicephaline evertsi for Anaplasma platys (GenBank accession Number OL451873-OL451874) and one pool of Amblyomma variegatum nymphs for Rickettsia africae (GenBank accession Number OL466919) as shown in <xref ref-type="table" rid="table3">Table 3</xref>.</p><p>At Shimba Hills, Rickettsia africae was detected in two pools (GenBank accession Number OL466921-OL466922) of A. variegatum and one pool of A. gemma. Rickettsia sp. (GenBank accession Number OL466920) and Anaplasma sp. (GenBank accession Number OL451872) were detected in pools of A. gemma</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Tick-borne pathogens identified</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Site</th><th align="center" valign="middle" >Tick-borne pathogens</th><th align="center" valign="middle" >species</th><th align="center" valign="middle" >No. of infected pools/% of total tested</th><th align="center" valign="middle" >Minimum infection rate</th></tr></thead><tr><td align="center" valign="middle" >Near Tsavo</td><td align="center" valign="middle" >Theileria parva</td><td align="center" valign="middle" >R. appendiculatus</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >9.46</td></tr><tr><td align="center" valign="middle" >National Reserve</td><td align="center" valign="middle" >Anaplasma platys</td><td align="center" valign="middle" >R. evertsi</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >6.3</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Rickettsia africae</td><td align="center" valign="middle" >A. variegatum (nymphs)</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3.15</td></tr><tr><td align="center" valign="middle" >Near Shimba Hills</td><td align="center" valign="middle" >Rickettsia africae</td><td align="center" valign="middle" >A. variegatum</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >8.3</td></tr><tr><td align="center" valign="middle" >National Reserve</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >A. gemma</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >4.16</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Rickettsia sp.</td><td align="center" valign="middle" >A. gemma</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >4.16</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Anaplasma sp.</td><td align="center" valign="middle" >R. evertsi</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >4.16</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >R. aeschlimannii</td><td align="center" valign="middle" >A. gemma</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >4.16</td></tr></tbody></table></table-wrap><p>and R. evertsi respectively. Rickettsia aeschlimannii (GenBank accession Number OL466924) was detected in a pool of A. gemma.</p></sec></sec><sec id="s5"><title>5. Discussion</title><p>Detection of tick-borne zoonotic diseases at the human-wildlife-livestock interfaces of Shimba Hills National Reserve and the Tsavo National Reserve, gives an insight into the possibility of tick-borne zoonotic diseases spilling over from the wildlife to livestock and humans. Most of the tick species identified in this study have been incriminated as the vectors of tick-borne diseases of public health and veterinary concern [<xref ref-type="bibr" rid="scirp.121768-ref17">17</xref>].</p><p>Rickettsia africae is a zoonotic tick-borne pathogen which causes African tick bite fever in humans and manifests with headache, fever, rush, myalgia and skin lesion at the site of tick bite [<xref ref-type="bibr" rid="scirp.121768-ref11">11</xref>]. It is often misdiagnosed at the clinical setting because it shares symptoms with common febrile illnesses including malaria. This calls for robust surveillance and inclusions of R. africae in hospitals and other clinical settings. In this study, R. africae was detected in A. gemma and A. variegatum ticks. These findings are consistent with those that confirm the circulation of R. africae among the Amblyomma species [<xref ref-type="bibr" rid="scirp.121768-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.121768-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.121768-ref18">18</xref>]. Further, R. africae was detected in nymphs of A. variegatum ticks collected from cattle.</p><p>Rickettsia aeschlimannii is also considered to be a zoonotic tick-borne pathogen which has been reported in patients travelling from Africa [<xref ref-type="bibr" rid="scirp.121768-ref19">19</xref>] and it is understood that migratory birds play an important role in the epidemiology of R. aeschlimannii by passive transportation of R. aeschlimannii-infected ticks from one region to another [<xref ref-type="bibr" rid="scirp.121768-ref20">20</xref>]. This pathogen has been detected in detected in Hyalomma ticks in Kenya [<xref ref-type="bibr" rid="scirp.121768-ref6">6</xref>], which are thought to serves as reservoirs for R. aeschlimannii [<xref ref-type="bibr" rid="scirp.121768-ref21">21</xref>]. However, in the present study, R. aeschlimannii was detected in A. gemma. According to our knowledge this is the first time R. aeschlimannii has been detected in A. gemma.</p><p>Uncharacterized Rickettsia sp. was detected in Am. variegatum ticks. Although its pathogenicity was unknown, it can be a public health threat in future [<xref ref-type="bibr" rid="scirp.121768-ref19">19</xref>]. Many known Rickettsia species of public health concern today, were not initially considered to be harmful to humans. This species needs further characterization with additional markers such as ompA, sca4, 17kDa [<xref ref-type="bibr" rid="scirp.121768-ref10">10</xref>].</p><p>Anaplasma platys is a TBP infecting dogs which is transmitted by brown dog ticks (Rhipicephalus sanguineus s.l.) [<xref ref-type="bibr" rid="scirp.121768-ref22">22</xref>]. The pathogen has been reported also to infect humans causing mild headache, lethargy and myalgia [<xref ref-type="bibr" rid="scirp.121768-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.121768-ref24">24</xref>]. In the current study, Anaplasma platys was detected in R. evertsi.</p><p>Theileria parva is a TBP of veterinary importance which causes East Coast Fever in cattle [<xref ref-type="bibr" rid="scirp.121768-ref15">15</xref>]. In this current study, Theileria parva was detected in R. appendiculatus ticks. These findings were consistent with those of Oundo et al. [<xref ref-type="bibr" rid="scirp.121768-ref10">10</xref>]. The cattle get infected by coming into close proximity to buffaloes which are natural reservoir for T. parva [<xref ref-type="bibr" rid="scirp.121768-ref25">25</xref>].</p></sec><sec id="s6"><title>6. Conclusion</title><p>The detection of Rickettsia africae, Rickettsia aeschlimannii, and Anaplasma platys gives an insight into the possibility of transmission of zoonotic tick-borne pathogens from wildlife to humans at human-wildlife-livestock interfaces. Since persons infected with these pathogens present with fever, it is paramount to include tests that can diagnose these infections in clinical settings.</p></sec><sec id="s7"><title>Acknowledgements</title><p>We acknowledge the staff of the Msambweni Department of vector borne diseases for their technical assistance.</p></sec><sec id="s8"><title>Data Availability Statement</title><p>Sequences obtained in this study have been deposited in the GenBank database under the following accession numbers: OL466919-OL466924 (Rickettsia 16S rRNA), OL451872-OL451874 (Anaplasma 16S rRNA), and OL451869-OL451871 (Theileria 18S rRNA).</p></sec><sec id="s9"><title>Author’s Contributions</title><p>Conceptualization: MNC, MWM</p><p>Data curation: All authors.</p><p>Formal analysis: All authors.</p><p>Investigation: SKG</p><p>Methodology: All authors</p><p>Project administration: SKG</p><p>Resources: SKG</p><p>Supervision: MNC, MWM</p><p>Validation: MNC, MWM</p><p>Visualization: SKG, MNC, MWM</p><p>Writing-original draft: All authors.</p><p>Writing-review &amp; editing: All authors.</p></sec><sec id="s10"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s11"><title>Cite this paper</title><p>Godani, S.K., Chengo, M.N. and Muturi, M.W. (2023) Zoonotic Pathogens Detected in Ticks in Kenyan Game Reserves. Advances in Entomology, 11, 1-9. https://doi.org/10.4236/ae.2023.111001</p></sec></body><back><ref-list><title>References</title><ref id="scirp.121768-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Hotez, P.J. and Kamath, A. (2009) Neglected Tropical Diseases in Sub-Saharan Africa: Review of Their Prevalence, Distribution, and Disease Burden. PLOS Neglected Tropical Diseases, 3, e412. https://doi.org/10.1371/journal.pntd.0000412</mixed-citation></ref><ref id="scirp.121768-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Zaid, T., Ereqat, S., Nasereddin, A., Al-Jawabreh, A., Abdelkader, A. and Abdeen, Z. (2019) Molecular Characterization of Anaplasma and Ehrlichia in Ixodid Ticks and Reservoir Hosts from Palestine: A Pilot Survey. Veterinary Medicine and Science, 5, 230-242. https://doi.org/10.1002/vms3.150</mixed-citation></ref><ref id="scirp.121768-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Holbrook, M.R. (2012) Kyasanur Forest Disease. Antiviral Research, 96, 353-362. https://doi.org/10.1016/j.antiviral.2012.10.005</mixed-citation></ref><ref id="scirp.121768-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Zivcec, M., Scholte, F.E., Spiropoulou, C.F., Spengler, J.R. and Bergeron, é. (2016) Molecular Insights into Crimean-Congo Hemorrhagic Fever Virus. Viruses, 8, Article No. 106. https://doi.org/10.3390/v8040106</mixed-citation></ref><ref id="scirp.121768-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Wesonga, F.D., Kitala, P.M., Gathuma, J.M., Njenga, M.J. and Ngumi, P.N. (2010) An Assessment of Tick-Borne Diseases Constraints to Livestock Production in a Smallholder Livestock Production System in Machakos District, Kenya. Livestock Research for Rural Development, 22, 111. http://www.lrrd.org/lrrd22/6/weso22111.htm</mixed-citation></ref><ref id="scirp.121768-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Omondi, D., Masiga, D.K., Fielding, B.C., Kariuki, E., Ajamma, Y.U., Mwamuye, M.M., et al. (2017) Molecular Detection of Tick-Borne Pathogen Diversities in Ticks from Livestock and Reptiles along the Shores and Adjacent Islands of Lake Victoria and Lake Baringo, Kenya. Frontiers in Veterinary Science, 4, Article No. 73. https://doi.org/10.3389/fvets.2017.00073</mixed-citation></ref><ref id="scirp.121768-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Vanwambeke, S.O., Sumilo, D., Bormane, A., Lambin, E.F. and Randolph, S.E. (2010) Landscape Predictors of Tick-Borne Encephalitis in Latvia: Land Cover, Land Use, and Land Ownership. Vector Borne and Zoonotic Diseases (Larchmont, N.Y.), 10, 497-506. https://doi.org/10.1089/vbz.2009.0116</mixed-citation></ref><ref id="scirp.121768-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Mundia, C.N. and Murayama, Y. (2009) Analysis of Land Use/Cover Changes and Animal Population Dynamics in a Wildlife Sanctuary in East Africa. Remote Sensing, 1, 952-970. https://doi.org/10.3390/rs1040952</mixed-citation></ref><ref id="scirp.121768-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Lambin, E.F., Tran, A., Vanwambeke, S.O., Linard, C. and Soti, V. (2010) Pathogenic Landscapes: Interactions between Land, People, Disease Vectors, and Their Animal Hosts. International Journal of Health Geographics, 9, Article No. 54. https://doi.org/10.1186/1476-072X-9-54</mixed-citation></ref><ref id="scirp.121768-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Oundo, J.W., Villinger, J., Jeneby, M., Ong’amo, G., Otiende, M.Y., Makhulu, E.E., et al. (2020) Pathogens, Endosymbionts, and Blood-Meal Sources of Host-Seeking Ticks in the Fast-Changing Maasai Mara Wildlife Ecosystem. PLOS ONE, 15, e0228366. https://doi.org/10.1371/journal.pone.0228366</mixed-citation></ref><ref id="scirp.121768-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Mwamuye, M.M., Kariuki, E., Omondi, D., Kabii, J., Odongo, D., Masiga, D., et al. (2017) Novel Rickettsia and Emergent Tick-Borne Pathogens: A Molecular Survey of Ticks and Tick-Borne Pathogens in Shimba Hills National Reserve, Kenya. Ticks and Tick-Borne Diseases, 8, 208-218. https://doi.org/10.1016/j.ttbdis.2016.09.002</mixed-citation></ref><ref id="scirp.121768-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">World Resources Institute. Kenya GIS Data. https://www.wri.org/resources/data-sets/kenya-gis-data</mixed-citation></ref><ref id="scirp.121768-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Code for Kenya. Kenya Counties Shape File. openAfrica. https://africaopendata.org/dataset/kenya-counties-shapefile</mixed-citation></ref><ref id="scirp.121768-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">GADM. Kenya International Boundaries Shape File. GADM. https://gadm.org/download_country_v3.html</mixed-citation></ref><ref id="scirp.121768-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Walker, A.R., Bouattour, A., Camicas, J.-L. and Preston, P.M. (2014) Ticks of Domestic Animals in Africa: A Guide to Identification of Species. Bioscience Reports, Edinburgh.</mixed-citation></ref><ref id="scirp.121768-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., et al. (2012) Geneious Basic: An Integrated and Extendable Desktop Software Platform for the Organization and Analysis of Sequence Data. Bioinformatics, 28, 1647-1649. https://doi.org/10.1093/bioinformatics/bts199</mixed-citation></ref><ref id="scirp.121768-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Tokarz, R., Kapoor, V., Samuel, J.E., Bouyer, D.H., Briese, T. and Lipkin, W.I. (2009) Detection of Tick-Borne Pathogens by MassTag Polymerase Chain Reaction. Vector-Borne and Zoonotic Diseases, 9, 147-152. https://doi.org/10.1089/vbz.2008.0088</mixed-citation></ref><ref id="scirp.121768-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Oswe, M., Odhiambo, R., Mutai, B., Nyakoe, N., Awinda, G. and Waitumbi, J. (2018) Zoonotic Pathogens in Ticks Collected from Livestock in Kenya. Open Journal of Preventive Medicine, 8, 248-259. https://doi.org/10.4236/ojpm.2018.88021</mixed-citation></ref><ref id="scirp.121768-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Parola, P., Paddock, C.D., Socolovschi, C., Labruna, M.B., Mediannikov, O., Kernif, T., et al. (2013) Update on Tick-Borne Rickettsioses around the World: A Geographic Approach. Clinical Microbiology Reviews, 26, 657-702. https://doi.org/10.1128/CMR.00032-13</mixed-citation></ref><ref id="scirp.121768-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Rumer, L., Graser, E., Hillebrand, T., Talaska, T., Dautel, H., Mediannikov, O., et al. (2011) Rickettsia aeschlimannii in Hyalomma marginatum Ticks, Germany. Emerging Infectious Diseases, 17, 325-326. https://doi.org/10.3201/eid1702.100308</mixed-citation></ref><ref id="scirp.121768-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Matsumoto, K., Parola, P., Brouqui, P. and Raoult, D. (2004) Rickettsia Aeschlimannii in Hyalomma Ticks from Corsica. European Journal of Clinical Microbiology &amp; Infectious Diseases, 23, 732-734. https://doi.org/10.1007/s10096-004-1190-9</mixed-citation></ref><ref id="scirp.121768-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Abarca, K., López, J., Perret, C., Guerrero, J., Godoy, P., Veloz, A., et al. (2007) Anaplasma Platys in Dogs, Chile. Emerging Infectious Diseases, 13, 1392-1395. https://doi.org/10.3201/eid1309.070021</mixed-citation></ref><ref id="scirp.121768-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Arraga-Alvarado, C.M., Qurollo, B.A., Parra, O.C., Berrueta, M.A., Hegarty, B.C. and Breitschwerdt, E.B. (2014) Case Report: Molecular Evidence of Anaplasma platys Infection in Two Women from Venezuela. American Journal of Tropical Medicine and Hygiene, 91, 1161-1165. https://doi.org/10.4269/ajtmh.14-0372</mixed-citation></ref><ref id="scirp.121768-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Maggi, R.G., Mascarelli, P.E., Havenga, L.N., Naidoo, V. and Breitschwerdt, E.B. (2013) Co-Infection with Anaplasma platys, Bartonella henselae and Candidatus Mycoplasma haematoparvum in a Veterinarian. Parasites &amp; Vectors, 6, Article No. 103. https://doi.org/10.1186/1756-3305-6-103</mixed-citation></ref><ref id="scirp.121768-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Magulu, E., Kindoro, F., Mwega, E., Kimera, S., Shirima, G. and Gwakisa, P. (2019) Detection of Carrier State and Genetic Diversity of Theileria parva in ECF-Vaccinated and Naturally Exposed Cattle in Tanzania. Veterinary Parasitology: Regional Studies and Reports, 17, Article ID: 100312. https://doi.org/10.1016/j.vprsr.2019.100312</mixed-citation></ref></ref-list></back></article>