OJMSOpen Journal of Marine Science2161-7384Scientific Research Publishing10.4236/ojms.2023.131001OJMS-121675ArticlesEarth&Environmental Sciences Development and Characterization of 35 SNP Markers in the Fat Greenling <i>Hexagrammos otakii</i> XianggangGao1*WeidongLiu1XiangboBao1YingXia2Liaoning Key Laboratory of Marine Fishery Molecular Biology, Liaoning Ocean and Fisheries Science Institute, Dalian, ChinaDalian Eco-Environmental Monitoring Center of Liaoning Province, Dalian, China0512202213011625, October 20223, December 2022 6, December 2022© Copyright 2014 by authors and Scientific Research Publishing Inc. 2014This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/

Hexagrammos otakii is an important kind of economic fish species in East Asia. However, wild H. otakii resources have declined sharply in recent years as a result of human disturbance and habitat destruction. Thus, it is crucial to protect the current resources of H. otakii. In this study, 35 novel single nucleotide polymorphism (SNP) markers were developed based on restriction-site associated DNA sequencing. The results showed that the observed heterozygosity and expected heterozygosity ranged from 0.1875 to 0.6562 and 0.2679 to 0.5079, respectively. The minor allele frequency ranged from 0.1875 to 0.4375. Polymorphic information content ranged from 0.229 to 0.375. Six SNPs were found to be deviated significantly from the HWE (P < 0.05). These SNP markers will serve as a useful tool for genetic studies and population evaluation aimed at the conservation of H. otakii.

<i>Hexagrammos otakii</i> SNP RAD Genetic Diversity1. Introduction

Hexagrammos otakii (Fat greenling), belonging to the family Hexagrammidae and genus Hexagrammos, is mainly distributed in the North Korea, Japan and China offshore [1]. H. otakii is an important kind of economic fish species in East Asia. H. otakii has high protein content (18.50%) and essential amino acid (7.25%), especially since the protein content is higher than most other fish [2]. Featuring meat quality, good taste, and high nutritional value, H. otakii is challenged by continuously growing market requirements and reduction of fishery resources [3]. Thus, the demand for hypervariable molecular markers to provide a population-genetic perspective on conservation and management efforts of the spices becomes urgent [4] [5].

With the rapid development of next-generation sequencing technologies (NGS) [6], single nucleotide polymorphisms (SNPs) have been largely developed and widely used for genetic studies in aquaculture species such as Sebastes schlegelii, Megalobrama terminalis and Coilia ectenes [7] [8] [9]. For H. otakii resource conservation, we implemented restriction-site associated DNA (RAD) sequencing to facilitate the genetic evaluation which could provide a reference for the development of SNP markers.

2. Materials and Methods2.1. Materials

In this study, a total of 32 H. otakii wild individuals were collected from northern Yellow Sea in China. Muscle tissues were sampled and stored in 95% molecular grade ethanol. Total genomic DNA was extracted from tissue samples using the TIANamp Marine Animals DNA Kit (Tiangen, Beijing, China) following the manufacturer’s instructions.

2.2. Methods

All samples were used to construct the RAD libraries. Then, the libraries were sequenced on the Illumina HiSeq 4000 platform using 150 base pair (bp) paired-end reads. We trimmed the adapter sequences and low-quality reads (Phred score < 20) with Cutadapt [10]. Finally, 707,105 putative SNPs with the highest scores were generated, from which we randomly selected 100 candidate SNPs to test their applicability. The polymorphism of these candidate SNPs was further characterized in the samples mentioned above. Primer sequences for SNP loci were designed by Primer 5.0 software. The PCR reactions were conducted in 25 µL volume containing 50 ng of genomic DNA, 1 × PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 250 nM of each primer, and 1U of Taq polymerase (Takara, Dalian, China). The amplicons were checked by 1.0% agarose gel electrophoresis and sequenced on ABI 3730 DNA Analyzer (Applied Biosystems).

3. Results

The observed heterozygosity (Ho), expected heterozygosity (He), minor allele frequency (MAF), and P value representing the deviations from the Hardy-Weinberg equilibrium were estimated using POPGENE 32. The polymorphism information content (PIC) was calculated using Cervus 3.0 [11]. Among the test SNP markers in H. otakii, 35 polymorphic SNP markers were characterized in Table 1. The Ho and He were ranged from 0.1875 to 0.6562 and 0.2679 to 0.5079, respectively. The MAF ranged from 0.1875 to 0.4375. The PIC varied from 0.229 to 0.375, with an average of 0.3293. Six SNPs were found to be deviated significantly from the HWE (P < 0.05) (see Table 2 for details). These results will be useful for understanding the genetic diversity of H. otakii to assist in the management of this germplasm resource.

Summary information for the 35 SNP markers developed for the H. otakii
Primer IDPrimer sequencesSNP typeSNP PositionHoHeMAFPICPHWE
SNP1F: GTGCCGATGTTTATATCAGGCG R: cacatttctggttcgggctcAT970.37500.50600.31250.3740.1368
SNP2F: AATTCTGGTCCGGCAACAA R: agcccgagatgaacagagacAG1180.31250.30950.31250.2710.9550
SNP3F: TGCAGGTGAACATAGATTTCCAG R: tgctcctctgatgatggcaAG1040.21880.28920.21880.2440.1510
SNP4F: TCTTGTCCCTCCACTGTTGC R: tccggtcacaacttccaccAG950.25000.34720.25000.2830.1022
SNP5F: TCAAACAGGGAGAAACGGC R: TtaccacttgaagagactcccAG730.59380.50740.18750.3750.3283
SNP6F: GGAACGTAGGGGAGTTGAGC R: CACGCACATACGCACATACGTG860.25000.26790.25000.2290.6929
SNP7F: TTCCCAGGTAAAGCCAAGC R: aatacctcctcgctactcgAC1060.53120.44790.40630.3490.2828
SNP8F: AAGTGTTCATCCGCTGGCTTA R: tcattgtaggtagcccacacgAC900.65620.48360.28130.3630.0400*
SNP9F: GTTAAACTGAATATCAACAGGTG R: aactttgtaaagtgtcctggTG670.37500.38100.3750.3050.9277
SNP10F: TGTTTGTGTTGCCACTATCAG R: GCtcaatgtcttgaactgggAC640.46880.50350.31250.3730.6917
SNP11F: TGTTAACGTTTCGGCCTGCTAG R: agcaggaagtcaacccacgAC760.43750.34720.43750.2830.1291
SNP12F: TTCTCTGTTACAGCAGCGC R: caatgatagcacaggcagcAG950.46880.50740.25000.3740.6612
SNP13F: TCTGACTGACATCGTGGATCAC R: atgttctcaggttgcatcaggCT700.25000.43650.25000.3370.0136*
SNP14F: CGTAGGCTGTTGCGTCTC R: TgtgcacaagtataggctgcCT780.21880.42410.21880.3300.0051*
SNP15F: ATTCAGCAGTGGACTTGGGG R: TTCACTCTTTCCCGGGCTTCCT1180.18750.30950.18750.2580.0206*
SNP16F: TCTACTATGACGCTGTTACTCCAG R: atggtcaagtcatcagtggcAG830.28120.32890.28130.2710.3967
SNP17F: ACACGATACTGCTTTGTCAC R: GcttctagattagcttagcgcCT810.31250.38100.28130.3050.2964
SNP18F: ATGGATTTGCAGCACGGTTG R: AGCTAAAACTGGCACGCTCAAG1020.37500.50600.25000.3740.1368
SNP19F: CACTGGTGTGTTTGTGTCAAGG R: tccagcaccatcatcaggtcTG670.34380.50740.34380.3750.0637
SNP20F: AAGAGAGAAAATACCAACACTG R: aaatgatcctggtccttgcAG700.53120.50350.25000.3730.7511
SNP21F: CGTTGGTTGTTAAGTGGCAG R: caactaaggcagaagagatagaccAG640.50000.50790.25000.3750.9284
SNP22F: TTGGTTTTTGACGGTGTCGC R: GGTGGAGTGGCTGTGATTCTCT990.43750.50790.25000.3750.4255
SNP23F: AGAGTGCTGAAGCCTCAACTG R: acgtgatggaaagggacactgTG700.28120.32890.28130.2710.3967
SNP24F: TTCGGTTACGCGGGAGTTTGTC R: gtggaacccacagggtaacgtcCT1170.40620.48360.40630.3630.3570
SNP25F: AGAGTCAAGACTAAGCGCG R: ctgtgtgagtttttggtggcCT1020.34380.44790.34380.3440.1794
SNP26F: CTGCCGTGACGAGTTCAGAT R: TGTGCGATCGTGTGACAGAACT710.46880.46780.40630.3540.9902
SNP27F: CATAACGGACAAGAAAAATGCCTC R: ttaaccagtgactgtctggacCT740.56250.47620.34380.3590.2965
SNP28F: ACCGTGTGCTTTCAGTTCCTG R: GtaacactggagggtggagcCT1000.53120.46780.37500.3540.4340
SNP29F: GCCACATTCTACACACTGTCCC R: tcagcagacgacaatgcagcCT750.34380.44790.34380.3440.1794
SNP30F: TCCTTCTCTGGAGTCTTTGTGC R: TGTGTTTTGAGGTTTTTGCAAGCCT740.37500.41070.37500.3300.6145
SNP31F: CTCTCCAAGCCTCAGCGAG R: ACTTCCTCTCCTCCACTGCAAG1130.50000.49010.31250.3660.9073
SNP32F: CAGGTCTCAAGCTCACCCTGG R: actacttgcggatcacttgttgccTG940.31250.30950.31250.2580.9550
SNP33F: AGCATTGCTTGATAATGACTGCC R: agcgaatatctgcgaaacggAT980.50000.50790.21880.3750.9284
SNP34F: GCTGCCACAGTCACAGTTTCAC R: tcaggtcctcagcatcaacggAG720.25000.45830.25000.3490.0087*
SNP35F: AGATGCAAGAGGGCCACTTCC R: agggatagaggctgacgcctgCT1030.18750.30950.18750.2580.0206*
 The detailed information about the six SNPs found to be deviated significantly from the HWE (P < 0.05)
Primer IDGenotype/observed valueGenotype/expected valueχ2 (PHWE)
SNP8AA/9, ac/21, cc/2AA/11.88, ac/15.23, cc/4.884.58 (0.0400)
SNP13CC/18, ct/8, tt/6CC/15.13, ct/13.75, tt/3.135.60 (0.0136)
SNP14TT/19, c/t7, cc/6TT/15.82, ct/13.36, cc/2.827.26 (0.0051)
SNP15TT/23, ct/6, cc/3TT/21.13, ct/9.75, cc/1.134.72 (0.0206)
SNP34GG/17, ga/8, aa/7GG/13.78, ga/14.44, aa/3.786.39 (0.0087)
SNP35TT/23, ct/6, cc/3TT/21.13, ct/9.75, cc/1.134.72 (0.0206)
4. Conclusion

Wild H. otakii resources have declined sharply in recent years as a result of human disturbance and habitat destruction. In this study, 35 novel SNP markers were developed based on restriction-site associated DNA sequencing. The results showed that the Ho and He ranged from 0.1875 to 0.6562 and 0.2679 to 0.5079, respectively. The minor allele frequency ranged from 0.1875 to 0.4375. Polymorphic information content ranged from 0.229 to 0.375. Six SNPs were found to be deviated significantly from the HWE (P < 0.05). These SNP markers will serve as a useful tool for genetic studies and population evaluation aimed at the conservation of H. otakii.

Acknowledgements

This study was funded by the Agricultural Major Project of Liaoning Province (2020JH1/10200002) and China Agriculture Research System of MOF and MARA (CARS-47).

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

Cite this paper

Gao, X.G., Liu, W.D., Bao, X.B. and Xia, Y. (2023) Development and Characterization of 35 SNP Markers in the Fat Greenling Hexagrammos otakii. Open Journal of Marine Science, 13, 1-6. https://doi.org/10.4236/ojms.2023.131001

NOTESReferencesRen, G., Liu, Q., Gao, T. and Yanagimoto, T. (2013) Population Demography and Genetic Structure of the Fat Greenling (Hexagrammos otakii) Inferred from mtDNA Control Region Sequence Analyses. Biochemical Systematics and Ecology, 47, 156-163. https://doi.org/10.1016/j.bse.2012.09.026Kang, B. and Wu, Y.F. (1999) Nutritional Composition Analyses of Hexagrammos otakii. Marine Science, 6, 23-24.Shen, Z., Wang, B., Hu, F., Liu, H., Guan, H. and Zheng, F. (2019) Isolation and Characterization of Microsatellite Loci in Hexagrammos otakii based on 2b-RAD Method. Journal of Applied Ichthyology, 36, 55-61. https://doi.org/10.1111/jai.13988F.A.O. (1993) Report of the Expert Consultation on Utilization and Conservation of Aquatic Genetic Resources. FAO Fisheries Report, No. 491, 58 p.Khandaker, L., Akond, M., Liu, S., Kantartzi, S., Meksem, K., Bellaloui, N., Lightfoot, D. and Kassem, M. (2015) Mapping of QTL Associated with Seed Amino Acids Content in “MD96-5722” by “Spencer” RIL Population of Soybean Using SNP Markers. Food and Nutrition Sciences, 6, 974-984. https://doi:10.4236/fns.2015.611101Davey, J.W., Hohenlohe, P.A., Etter, P.D., Boone, J.Q., Catchen, J.M. and Blaxter, M.L. (2011) Genome-Wide Genetic Marker Discovery and Genotyping Using Next-Generation Sequencing. Nature Reviews Genetics, 12, 499-510. https://doi.org/10.1038/nrg3012Gao, X.G., Bao, X.B., Sun, W., Li, Y.F., Liu, Z.Y. and Liu, W.D. (2021) Isolation and Characterization of 38 SNP Markers for the Black Rockfish, Sebastes schlegelii by Next-Generation Sequencing. Conservation Genetics Resources, 13, 413-416. https://doi.org/10.1007/s12686-021-01226-3Yang, J.P., Li, X.H., Li, Y.F., Zhu, S.L., Chen, W.T. and Li, J. (2020) Isolation and Characterization of 30 SNP Markers in Guangdong Bream (Megalobrama terminalis) by Next-Generation Sequencing. Conservation Genetics Resources, 12, 399-402. https://doi.org/10.1007/s12686-020-01131-1Yu, A.Q., Shi, Y.H. and Yan, Y.L. (2019) Development and Characterization of 50 snp Markers in Coilia ectenes. Conservation Genetics Resources, 12, 177-181. https://doi.org/10.1007/s12686-019-01086-yMartin, M. (2011) Cutadapt Removes Adapter Sequences from High Throughput Sequencing Reads. EMBnet Journal, 17, 10-12. https://doi.org/10.14806/ej.17.1.200Kalinowski, S.T., Taper, M.L. and Marshall, T.C. (2007) Revising How the Computer Program CERVUS Accommodates Genotyping Error Increases Success in Paternity Assignment. Molecular Ecology, 16, 1099-1106. https://doi.org/10.1111/j.1365-294X.2007.03089.x