<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">JBNB</journal-id><journal-title-group><journal-title>Journal of Biomaterials and Nanobiotechnology</journal-title></journal-title-group><issn pub-type="epub">2158-7027</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/jbnb.2022.133004</article-id><article-id pub-id-type="publisher-id">JBNB-121566</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Chemistry&amp;Materials Science</subject></subj-group></article-categories><title-group><article-title>
 
 
  Matrix Stiffness-Induced Transcriptome Alterations and Regulatory Mechanisms Revealed by RNA-Seq in Endothelial Cells
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Chao</surname><given-names>Zhang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xiaomei</surname><given-names>Han</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jin</surname><given-names>Xu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yue</surname><given-names>Zhou</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>School of Biomedical Engineering, Shanghai Jiao Tong University, Shanghai, China</addr-line></aff><pub-date pub-type="epub"><day>29</day><month>07</month><year>2022</year></pub-date><volume>13</volume><issue>03</issue><fpage>61</fpage><lpage>79</lpage><history><date date-type="received"><day>1,</day>	<month>July</month>	<year>2022</year></date><date date-type="rev-recd"><day>26,</day>	<month>July</month>	<year>2022</year>	</date><date date-type="accepted"><day>29,</day>	<month>July</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Changes in vascular stiffness are associated with the development and progression of many diseases, especially in cardiovascular disease. However, the effect of vascular stiffness on the endothelial cells (ECs) is not fully understood. Therefore, this study aims to determine the gene expression changes of ECs cultured on the matrices with different stiffness (1 kPa and 40 kPa, respectively) by RNA-seq, thereby broadening the knowledge between mechanics and biology. We obtained 1775 differentially expressed genes (DEGs) by RNA-seq, with 450 up-regulated and 1325 down-regulated DEGs in ECs cultured on soft matrix (1 kPa) compared to those cultured on stiff matrix (40 kPa). After that, we performed a series of functional enrichment analyses based on DEGs and found that DEGs were enriched in many signaling pathways like adhesion junction. Furthermore, transcription factor (TF) target gene prediction analysis and protein-protein interaction (PPI) analysis were also conducted. We found that mechanotransduction signaling related TFs such as BRD4 are involved in. And in the PPI analysis, some genes encoding extracellular matrix proteins such as fibronectin 1 (FN1) were identified as the hub genes. In order to confirm the RNA-seq results, we performed real-time qPCR analysis on the genes of interest, including FN1, collagen α2 (IV) chain, matrix metalloproteinase-14 and integrin α5, and found that the expression levels of all these genes were down-regulated on soft matrix, suggesting that soft matrix caused by pathological conditions may directly attenuate vascular barrier function. This study offers the insights about the effects of physical stimulation on cells, paving a way for vascular tissue engineering, regenerative medicine, disease modeling and therapies.
 
</p></abstract><kwd-group><kwd>Endothelial Cells</kwd><kwd> Matrix Stiffness</kwd><kwd> RNA-Seq</kwd><kwd> Cell-Cell Junctions</kwd><kwd> Extracellular Matrix</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Over the past two decades, it is widely accepted that mechanical signals elicit specific responses in cells, as biological components do. Numerous studies have shown that ECM stiffness, or elasticity, affects fundamental cellular processes, including spreading, growth, proliferation, migration, stem cell differentiation, organoid formation [<xref ref-type="bibr" rid="scirp.121566-ref1">1</xref>] and regeneration [<xref ref-type="bibr" rid="scirp.121566-ref2">2</xref>]. Furthermore, ECM stiffness is emerging as a prominent mechanical cue that precedes disease and drives its progression and is becoming a new potential therapeutic target [<xref ref-type="bibr" rid="scirp.121566-ref3">3</xref>]. ECM stiffness changes in many pathological conditions, such as atherosclerosis. It has been shown that the stiffness of normal arterial blood vessels is about 40 kPa, but in the early stage of atherosclerosis, the stiffness of blood vessels will be greatly reduced due to the accumulation of lipids in the intima [<xref ref-type="bibr" rid="scirp.121566-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.121566-ref5">5</xref>], thus may lead to abnormal function of the epithelium and even other cells beneath it.</p><p>Under physiological conditions, endothelial cells (ECs) play an important role in maintaining the integrity of the vessel wall, and are involved in the modulations of metabolic homeostasis (trophic functions), vascular hemodynamics (tonic functions), vascular permeability, coagulation, and cell extravasation (trafficking) [<xref ref-type="bibr" rid="scirp.121566-ref6">6</xref>]. Endothelial cells can respond to both physical and chemical signals. When pathological signals are delivered to endothelial cells, arterial remodeling may occur, which contributes to common diseases, such as atherosclerosis [<xref ref-type="bibr" rid="scirp.121566-ref7">7</xref>]. ECs cultured on matrices with different stiffness showed significant differences in cell morphology and cell mechanics [<xref ref-type="bibr" rid="scirp.121566-ref8">8</xref>]. On the one hand, under the activation of endogenous molecules, ECs are capable of acting like immune cells, secreting cytokines, chemokines, growth factors, etc. [<xref ref-type="bibr" rid="scirp.121566-ref6">6</xref>]. In addition, ECs exposed in vitro to TGF-β (tumor growth factor-β), TNF-α (tumor necrosis factor-α), and IFN-γ (interferon-γ) undergo Endothelial-to-Mesenchymal Transition [<xref ref-type="bibr" rid="scirp.121566-ref9">9</xref>]. On the other hand, ECs can sense physical cues such as fluid mechanical forces [<xref ref-type="bibr" rid="scirp.121566-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.121566-ref11">11</xref>] and matrix stiffness [<xref ref-type="bibr" rid="scirp.121566-ref12">12</xref>]. Studies have shown that matrix stiffness affects not only endothelial cell morphology but also its biological processes. Furthermore, matrix stiffness has a significant impact on the interactions between endothelial cells and monocytes. When ECs were cultured on matrices with different stiffness (8 kPa, 20 kPa, 40 kPa), more monocytes adhered to ECs cultured on 8 kPa and 40 kPa compared to those cultured on 20 kPa, which was correlated with the expression levels of vascular cell adhesion molecule 1 (VCAM-1) and intercellular adhesion molecule 1 (ICAM-1) [<xref ref-type="bibr" rid="scirp.121566-ref13">13</xref>]. In addition, stiffness also regulates autophagy of ECs [<xref ref-type="bibr" rid="scirp.121566-ref14">14</xref>], neuroblastoma angiogenesis [<xref ref-type="bibr" rid="scirp.121566-ref15">15</xref>], and endothelial monolayer integrity [<xref ref-type="bibr" rid="scirp.121566-ref16">16</xref>]. However, the underlying mechanisms remain to be elucidated, and the effect of stiffness change on the gene expression of ECs is not well understood.</p><p>ECs are localized at the interface between blood and tissue, which plays a critical role in maintaining multi-organ health and homeostasis [<xref ref-type="bibr" rid="scirp.121566-ref17">17</xref>]. Endothelial dysfunction is regarded as a hallmark of many cardiovascular diseases such as atherosclerosis. And it manifests as impaired endothelium-dependent vasodilation, elevated oxidative stress, chronic inflammation, leukocyte adhesion and hyperpermeability, and endothelial cell senescence [<xref ref-type="bibr" rid="scirp.121566-ref18">18</xref>]. As discussed above, physical signals such as matrix stiffness play an integral role in disease initiation and progression. Therefore, it is particularly important to further study how matrix stiffness influences endothelial cells. In this study, in order to discover the potential link between stiffness and ECs, we examined the ECs transcriptome expression profiles, which cultured on matrices with different stiffness (1 kPa and 40 kPa, respectively), and performed a series of bioinformatics analyses based on differentially expressed genes. We also aimed to find the potential markers for assessing the occurrence of early disease.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Preparation of Matrices with Different Stiffness</title><p>Matrices with various stiffness were prepared as previously described [<xref ref-type="bibr" rid="scirp.121566-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.121566-ref13">13</xref>]. The following experimental procedures were performed in a sterile environment. Briefly, 40% (w/v) acrylamide (Sangon Biotech, China) and 2% (w/v) bis-acrylamide (Sangon Biotech, China) were mixed in different ratios, and crosslinked with tetramethylethylenediamine (TEMED, Klamar, China) and 10% ammonium persulfate solution (<xref ref-type="table" rid="table1">Table 1</xref>). Before polymerization, 100 μL mixture was added onto a glass plate pre-treated with gel slick (Lonza, Switzerland), and a circular silanizedcoverslip with a diameter of 20 mm was put onto the gel solution. After 20 min of polymerization, the coverslip with the polymerized matrix was pried up from the glass plate, and the matrix on the coverslip was rinsed with 2 mL 50 mM HEPES (Thermo Fisher, USA) for 3 times. Then the matrix was treated with Sulfo-SANPAH (Thermo Fisher, USA) and coated with 1 mg/mL Collagen I (Corning, USA). Finally, the matrix was sterilized with 70% (v/v) ethanol solution for 15 min, and washed with Dulbecco’s Phosphate-Buffered Saline (DPBS). The prepared matrices were stored in a 4˚C refrigerator for up to about 2 weeks and UV sterilized for 30 min before cell culture.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Composition of the PA gels with different stiffness</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Matrix stiffness</th><th align="center" valign="middle" >40% Acrylamide (μl)</th><th align="center" valign="middle" >2% Bis-acrylamide (μl)</th><th align="center" valign="middle" >1 M HEPES (μl)</th><th align="center" valign="middle" >ddH<sub>2</sub>O (μl)</th><th align="center" valign="middle" >Total (μl)</th></tr></thead><tr><td align="center" valign="middle" >1 kPa</td><td align="center" valign="middle" >30.00</td><td align="center" valign="middle" >5.00</td><td align="center" valign="middle" >2.00</td><td align="center" valign="middle" >163.00</td><td align="center" valign="middle" >200.00</td></tr><tr><td align="center" valign="middle" >40 kPa</td><td align="center" valign="middle" >73.60</td><td align="center" valign="middle" >30.20</td><td align="center" valign="middle" >2.00</td><td align="center" valign="middle" >94.20</td><td align="center" valign="middle" >200.00</td></tr></tbody></table></table-wrap></sec><sec id="s2_2"><title>2.2. Cell Culture</title><p>Human umbilical vein endothelial cells (HUVECs) were purchased from ScienCell Research Laboratories (ScienCell, USA) and cultured to passage 6 for experiments. HUVECs were cultured with EC medium supplemented with 5% fetal bovine serum, 1% EC growth factor and 1% penicillin/streptomycin (Sciencell, USA). In all experiments, HUVECs were cultured on matrices with different stiffness for more than 24 hours.</p></sec><sec id="s2_3"><title>2.3. Reverse-Transcription and Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)</title><p>Total RNA was extracted using the TRIzol plus RNA Purification kit (Thermo Fisher Scientific, USA), and reverse transcribed using the FastQuant RT kit (with gDNase) (TIANGEN, China). The cDNA samples were analyzed by RT-qPCR (Thermo Fisher Scientific, USA) using SuperRealPreMix Plus (SYBR Green) (TIANGEN, China) and the specific primer pairs (<xref ref-type="table" rid="table2">Table 2</xref>). GAPDH was used as a normalization control.</p></sec><sec id="s2_4"><title>2.4. RNA Isolation and Library Preparation</title><p>Total RNA for transcriptome sequencing was extracted using the TRIzol reagent according to the manufacturer’s protocol. RNA purity and quantification were</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Human mRNA primer sequences</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Target name</th><th align="center" valign="middle"  colspan="2"  >Nucleotide sequence (5' -&gt; 3')</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >Cadherin 5 (CDH5)</td><td align="center" valign="middle" >Forward Primer</td><td align="center" valign="middle" >GTTCACGCATCGGTTGTTCAA</td></tr><tr><td align="center" valign="middle" >Reverse Primer</td><td align="center" valign="middle" >CGCTTCCACCACGATCTCATA</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >F11 receptor (F11R)</td><td align="center" valign="middle" >Forward Primer</td><td align="center" valign="middle" >ATGGGGACAAAGGCGCAAG</td></tr><tr><td align="center" valign="middle" >Reverse Primer</td><td align="center" valign="middle" >CAATGCCAGGGAGCACAACA</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Fibronectin 1 (FN1)</td><td align="center" valign="middle" >Forward Primer</td><td align="center" valign="middle" >CGGTGGCTGTCAGTCAAAG</td></tr><tr><td align="center" valign="middle" >Reverse Primer</td><td align="center" valign="middle" >AAACCTCGGCTTCCTCCATAA</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Integrin, alpha 5 (ITGA5)</td><td align="center" valign="middle" >Forward Primer</td><td align="center" valign="middle" >GGCTTCAACTTAGACGCGGAG</td></tr><tr><td align="center" valign="middle" >Reverse Primer</td><td align="center" valign="middle" >TGGCTGGTATTAGCCTTGGGT</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >collagen α2(IV) chain (COL4A2)</td><td align="center" valign="middle" >Forward Primer</td><td align="center" valign="middle" >TTATGCACTGCCTAAAGAGGAGC</td></tr><tr><td align="center" valign="middle" >Reverse Primer</td><td align="center" valign="middle" >CCCTTAACTCCGTAGAAACCAAG</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Matrix metallopeptidase 14 (MMP14)</td><td align="center" valign="middle" >Forward Primer</td><td align="center" valign="middle" >CGAGGTGCCCTATGCCTAC</td></tr><tr><td align="center" valign="middle" >Reverse Primer</td><td align="center" valign="middle" >CTCGGCAGAGTCAAAGTGG</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)</td><td align="center" valign="middle" >Forward Primer</td><td align="center" valign="middle" >CTGGGCTACACTGAGCACC</td></tr><tr><td align="center" valign="middle" >Reverse Primer</td><td align="center" valign="middle" >AAGTGGTCGTTGAGGGCAATG</td></tr></tbody></table></table-wrap><p>evaluated using the NanoDrop 2000 spectrophotometer (Thermo Scientific, USA). RNA integrity was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Then the libraries were constructed using TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. The transcriptome sequencing and analysis were conducted by OE Biotech Co. Ltd. (Shanghai, China).</p></sec><sec id="s2_5"><title>2.5. RNA Sequencing, Identification of Differentially Expressed Genes and Gene Enrichment Analysis</title><p>The libraries were sequenced on an Illumina HiSeq X Ten platform and 150 bp paired-end reads were generated. Raw data (raw reads) were processed using Trimmomatic [<xref ref-type="bibr" rid="scirp.121566-ref19">19</xref>]. The reads containing ploy-N and the low-quality reads were removed. The clean reads were mapped to the human genome (GRCh38) using HISAT2 [<xref ref-type="bibr" rid="scirp.121566-ref20">20</xref>]. FPKM [<xref ref-type="bibr" rid="scirp.121566-ref21">21</xref>] of each gene was calculated using Cufflinks [<xref ref-type="bibr" rid="scirp.121566-ref22">22</xref>], and the read counts of each gene were obtained by HTSeq-count [<xref ref-type="bibr" rid="scirp.121566-ref23">23</xref>]. Differential expression analysis was performed using the DESeq (2012) R package [<xref ref-type="bibr" rid="scirp.121566-ref24">24</xref>]. P value &lt; 0.05 and fold change &gt; 2 or fold change &lt; 0.5 was set as the threshold for significantly differential expression. Hierarchical cluster analysis of differentially expressed genes (DEGs) was performed to demonstrate the expression pattern of genes in different groups and samples. The identified DEGs were used subsequently for Gene Ontology (GO, http://geneontology.org/) and Kyoto Encyclopedia for Genes and Genomes (KEGG, http://www.genome.jp/kegg/) pathway analysis, which performed respectively using R based on the hypergeometric distribution.</p></sec><sec id="s2_6"><title>2.6. Protein-Protein Interaction Network Analysis of DEGs</title><p>In order to explore the interactions between DEGs, a protein-protein interaction (PPI) network was built using the online analysis database STRING (http://string-db.org/). Cytoscape (http://www.cytoscape.org/) software was used to visualize the network.</p></sec><sec id="s2_7"><title>2.7. Analysis of Transcription Factors (TFs) and Their Target Genes</title><p>To explore the role of the TFs in mechanotransduction, we investigated the distribution of TF families. The relationship between TFs and their target genes was studied based on the hTFtarget database (http://bioinfo.life.hust.edu.cn/hTFtarget#!/tf).</p></sec><sec id="s2_8"><title>2.8. Statistical Analysis</title><p>Graph Pad Prism 6.0 software was used for statistical analyses and graphing. For all bar graphs, data were expressed as means &#177; SD. Differential analyses of mRNA expression between different matrix stiffness groups were carried out using Student’s t-test. Statistically significance was indicated by p &lt; 0.05.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Transcriptome Sequencing and Identification of DEGs</title><p>Samples were categorized by matrix stiffness into soft matrix group (1 kPa) and stiff matrix group (40 kPa), and were sequenced on an Illumina HiSeq X Ten platform. After removing the adapter sequences and discarding low-quality reads, the amount of data of each sample was distributed in the range of 6.22 - 7.09 G, the Q30 base was distributed in the range of 93.27% - 94.02%, and the average GC content was 50.57%. By aligning reads to the reference genome, the mapping rates of all samples were greater than 95%. In summary, the data acquired in this study were eligible to be used for later analysis (<xref ref-type="table" rid="table3">Table 3</xref>).</p><p>Principal component analysis (PCA) was performed to show the linear combination of the original high-dimensional data after dimensionality reduction [<xref ref-type="bibr" rid="scirp.121566-ref25">25</xref>]. In this study, PCA results showed that the principal component 1 (PC1) and principal component 2 (PC2) had 69.5% and 16.5% variations, respectively, which indicated that there were obvious differences between different matrix stiffnesses and that the same matrix stiffness had good repeatability. Based on this, the samples were distinguished into 2 groups of different dimensions (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). The RNA-seq results showed that gene expression was significantly different between the two groups. Therefore, the heatmap of the gene expression profile based on different gene expression values between the two groups was acquired (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). Totally, there were 1775 DEGs identified, among which 450 DEGs were up-regulated and 1325 DEGs were down-regulated in HUVECs cultured on soft matrix (1 kPa) compared to those cultured on stiff matrix (40 kPa) (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)).</p></sec><sec id="s3_2"><title>3.2. GO Enrichment Analysis of DEGs</title><p>Based on DEGs, GO analysis was conducted to evaluate the biological significance of matrix stiffness on ECs. In this study, we counted the number of differential genes in each GO term, and used the hypergeometric distribution algorithm to calculate their significance. We found that enriched GO terms were within three main categories: biological process, molecular function, and cellular component.</p><p>In the biological process category, most enriched genes were related to positive regulation of transcription by RNA polymerase, suggesting that changes in</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Clean data summary</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sample</th><th align="center" valign="middle" >RawReads (M)</th><th align="center" valign="middle" >RawBases (G)</th><th align="center" valign="middle" >CleanReads (M)</th><th align="center" valign="middle" >CleanBases (G)</th><th align="center" valign="middle" >ValidBases (%)</th><th align="center" valign="middle" >Q30 (%)</th><th align="center" valign="middle" >GC (%)</th></tr></thead><tr><td align="center" valign="middle" >1 kPa<sup>−1</sup></td><td align="center" valign="middle" >48.09</td><td align="center" valign="middle" >7.21</td><td align="center" valign="middle" >46.38</td><td align="center" valign="middle" >6.60</td><td align="center" valign="middle" >91.49</td><td align="center" valign="middle" >93.27</td><td align="center" valign="middle" >49.54</td></tr><tr><td align="center" valign="middle" >1 kPa<sup>−2</sup></td><td align="center" valign="middle" >44.91</td><td align="center" valign="middle" >6.74</td><td align="center" valign="middle" >43.67</td><td align="center" valign="middle" >6.22</td><td align="center" valign="middle" >92.37</td><td align="center" valign="middle" >93.49</td><td align="center" valign="middle" >49.33</td></tr><tr><td align="center" valign="middle" >40 kPa<sup>−1</sup></td><td align="center" valign="middle" >51.08</td><td align="center" valign="middle" >7.66</td><td align="center" valign="middle" >49.71</td><td align="center" valign="middle" >7.09</td><td align="center" valign="middle" >92.49</td><td align="center" valign="middle" >93.74</td><td align="center" valign="middle" >51.12</td></tr><tr><td align="center" valign="middle" >40 kPa<sup>−2</sup></td><td align="center" valign="middle" >49.59</td><td align="center" valign="middle" >7.44</td><td align="center" valign="middle" >48.52</td><td align="center" valign="middle" >6.96</td><td align="center" valign="middle" >93.55</td><td align="center" valign="middle" >94.02</td><td align="center" valign="middle" >51.86</td></tr></tbody></table></table-wrap><p>matrix stiffness would exert extensive impact on many aspects of the ECs. In the molecular function category, most DEGs enriched among protein binding, ATP binding and metal ion binding. In the cellular component category, most DEGs were associated with nucleoplasm, cytosol, nucleus, centriole and membrane (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)).</p><p>Moreover, we also compared the gene distribution of GO level 2 containing 64</p><p>terms (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)). In each of the above category, the enriched terms were associated with cell-cell interaction and cell-ECM interaction, including biological adhesion and cell junction. In the molecular function category, binding showed distinct expression differences. These results implied that changes in matrix stiffness can affect cell junction, which in turn may disrupt vessel integrity and endothelial barrier function.</p></sec><sec id="s3_3"><title>3.3. KEGG Pathway Enrichment Analysis of DEGs</title><p>KEGG pathway enrichment analysis was performed to further explore the signaling pathways involved in mediating the effects of matrix stiffness on cells. In this study, we show the top 20 signaling pathways with the highest enrichment scores after screening (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a)). And, the gene expression involved in each pathway is shown in <xref ref-type="fig" rid="fig3">Figure 3</xref>(b). Among these pathways, focal adhesion and regulation of actin cytoskeleton, which play an important role in cell-ECM interactions and cell-cell communications, may indicate the potential targets of mechanotransduction [<xref ref-type="bibr" rid="scirp.121566-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.121566-ref27">27</xref>]. In addition, DEGs were also enriched in intercellular junctions (including adherens junction, tight junction and gap junction) and endocytosis, which play an important role in endothelial cell barrier function [<xref ref-type="bibr" rid="scirp.121566-ref28">28</xref>].</p></sec><sec id="s3_4"><title>3.4. Expression Pattern of TFs and Its Target Genes</title><p>TFs play an indispensable role in regulating gene expression, are ubiquitous in all organisms and differences in their expression may provide important clues for understanding mechanotransduction. Therefore, the distribution of differential TF families was counted followed by their target genes (<xref ref-type="fig" rid="fig4">Figure 4</xref>). By comparing the distribution of TF families (up- and down-regulated), we found clear differences between the two groups (<xref ref-type="fig" rid="fig4">Figure 4</xref>(a)). Among these TF families,</p><p>zf-C2H2, chromosome remodeling factor, bHLH and ARID, are involved in mechanotransduction [<xref ref-type="bibr" rid="scirp.121566-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.121566-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.121566-ref31">31</xref>]. In order to further study the regulation of TFs on gene expression, we extracted the differential target genes corresponding to differential TFs according to the relationship list between TFs and target genes, and screened out the top 25 differential TFs (<xref ref-type="fig" rid="fig4">Figure 4</xref>(b)). In addition, we also found that some transcription factors like BRD4, BRD2, ARID1A and ARID2, which have been shown to be involved in mechanotransduction, were associated with a large number of DEGs [<xref ref-type="bibr" rid="scirp.121566-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.121566-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.121566-ref33">33</xref>].</p></sec><sec id="s3_5"><title>3.5. Protein-Protein Interaction (PPI) Analysis</title><p>PPI analysis was performed based on the top 35 DEGs. In order to explore the interactions between DEG, we established a PPI network using an online tool STRING database (https://stringdb.org/), and then used Cytoscape (http://www.cy-toscape.org/) software to visualize the network (<xref ref-type="fig" rid="fig5">Figure 5</xref>). We</p><p>used node size to represent the fold of differential expression, color to distinguish up- or down-regulated genes, and line width to indicate interaction score (&gt;0.7). In this network, some genes encoding ECM proteins, which play a considerable role in maintaining the integrity of ECM, such as fibronectin 1 (FN1), collagen α2(IV) chain (COL4A2), matrix metalloproteinase 2 (MMP2) and matrix metalloproteinase 14 (MMP14), have obvious expression differences and interactions. Moreover, cadherin 5 (CDH5), which plays a critical role in endothelial adherens junction assembly and maintenance, presents the same variation. In addition, ITGA5 and ITGB5, which encode integrin subunits that mediate cell-ECM interactions and function as mechanosensor, have the same results.</p></sec><sec id="s3_6"><title>3.6. Differential Gene Expression Validation by RT-qPCR</title><p>Based on the above bioinformatics analysis results, we found that the genes encoding some ECM proteins such as FN1 and COL4A, some genes encoding junction proteins such as CDH5 and F11R, the genes mediating cell-ECM communication such as ITGA5 had obvious differences in different matrix stiffness. ECM maintains the structural integrity of tissues and regulates cell and tissue functions. Dysregulation of the ECM composition and structure can lead to several human diseases [<xref ref-type="bibr" rid="scirp.121566-ref34">34</xref>]. The integrity of cell junctions is the basis for cells to function as a barrier. Therefore, six genes (including CDH5, F11R, FN1, COL4A2, MMP14 and ITGA5) were subject to PCR validation. As shown in <xref ref-type="fig" rid="fig6">Figure 6</xref>, the expression of these genes was reduced on soft matrix (1 kPa), which is consistent with the RNA-seq results. These results suggested that matrix stiffness may affect the endothelial cell barrier function as well as the structural integrity of ECM.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>The stiffness of the blood vessel is an important determinant of vascular homeostasis. The stiffness of the blood vessel is affected by aging and various pathological conditions, including hypertension, diabetes, hypercholesterolemia, chronic kidney disease, and unhealthy lifestyles [<xref ref-type="bibr" rid="scirp.121566-ref35">35</xref>]. For example, in the state of hypertension, a high shear stress environment can damage ECs, making them unable to regulate the entry and exit of substances such as lipids, which eventually leads to the changing of the stiffness of blood vessel and the formation of plaques [<xref ref-type="bibr" rid="scirp.121566-ref36">36</xref>]. A central function of vascular ECs, located at the interface between blood and tissue, is to serve as a barrier that regulates the entry and exit of solutes and cells, thereby maintaining homeostasis. ECs can directly sense the stimulation of mechanical signals and convert them into chemical signals [<xref ref-type="bibr" rid="scirp.121566-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.121566-ref37">37</xref>]. However, the understanding of how matrix stiffness affects EC function is still incomplete. So, in this study, we studied ECs cultured on matrices with different stiffness and compared their transcriptomes to determine any differences in DEGs using RNA-seq. A total of 1775 DEGs were identified, including 1325 up-regulated genes and 450 down-regulated genes on 1 kPa matrix compared</p><p>with 40 kPa matrix. PCA analysis and cluster analysis presented in <xref ref-type="fig" rid="fig1">Figure 1</xref> indicated two distinct groups, suggesting that soften matrix stiffness (1 kPa) have great impact on EC function.</p><p>GO enrichment analysis further demonstrated that most of the DEGs were enriched to cellular components. In the biological process category, most enriched genes were related to positive regulation of transcription by RNA polymerase, suggesting that changes in matrix stiffness would affect gene transcription, thus exert extensive impact on many aspects of the ECs. In addition, the enrichment of proteins in nucleoplasm and nucleus (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)) suggested that matrix stiffness change may largely result in transcription level changes due to epigenetic modification and regulation of gene expression by binding of the TFs. We further compared the changes of the DEGs of each term at GO level 2. Cell junctions and ECM and proteins are among those with significant differences. Matrix stiffness is one of the important features of the ECM. These results suggest that stiffness change could affect cell-cell interactions as well as cell-ECM interactions [<xref ref-type="bibr" rid="scirp.121566-ref38">38</xref>] [<xref ref-type="bibr" rid="scirp.121566-ref39">39</xref>], which in turn may disrupt vessel integrity and endothelial barrier function.</p><p>The regulatory role of the TFs is crucial in all aspects of cellular functions, including mechanotransduction. For example, YAP and TAZ, best-known as mechanosensitive transcriptional regulators, whose nuclear translocation is influenced by ECM stiffness, function as important effectors of mechanotransduction to regulate cell behaviors [<xref ref-type="bibr" rid="scirp.121566-ref40">40</xref>]. Among all the analyzed the distribution of TF families, zf-C2H2 transcription family had the most differential genes. Then we screened out KDM2B, which belongs to the ARID family by counting the DEG each TF targeted. A recent study showed that KDM2B directly recruits RNA polymerase II to further initiate and promote Il6 transcription, which in turn facilitates inflammatory responses [<xref ref-type="bibr" rid="scirp.121566-ref41">41</xref>]. In addition, BRD4, which is similar to YAP, can also respond to changes in matrix stiffness and regulate pro-fibrotic gene expression [<xref ref-type="bibr" rid="scirp.121566-ref30">30</xref>]. Furthermore, at low mechanical stress, ARID1A binds to YAP/TAZ, thereby preventing the formation of TEAD-YAP/TAZ complex [<xref ref-type="bibr" rid="scirp.121566-ref42">42</xref>].</p><p>In the KEGG pathway enrichment analysis, DEGs were concentrated in several important signaling pathways such as Notch signaling pathway, cell-cell junctions, and focal adhesion (<xref ref-type="fig" rid="fig2">Figure 2</xref>). Notch signaling, which is an evolutionarily highly conserved signaling pathway, plays an important role in maintaining tissue homeostasis, development and disease occurrence [<xref ref-type="bibr" rid="scirp.121566-ref43">43</xref>]. He et al. found that Piezo1, which is known as a mechanosensitive ion channel, requires the Notch signaling cascade to mechanistically regulate the development of inflammation and renal fibrosis [<xref ref-type="bibr" rid="scirp.121566-ref44">44</xref>]. In addition, there are also significant differences in the proteins involved in adherens junction, gap junction, and tight junction, which play an important role in maintaining vascular barrier function and mediating cell-cell interaction [<xref ref-type="bibr" rid="scirp.121566-ref45">45</xref>]. We observed the down-regulation of claudin, nectin, VE-cadherin, vinculin and catenin, on 1 kPa matrix compared to 40 kPa matrix. Furthermore, there are also distinct differences in focal adhesion and ECM-receptor interaction that serve an important role in cell-ECM interaction and mechanotransduction. All these results implied that soft matrix caused by pathological conditions may directly attenuate vascular barrier function and homeostasis.</p><p>To further understand the biological significance of the DEGs in regulating EC function, PPI network analysis of DEGs was performed using STRING database, followed by visualization using Cytoscape (<xref ref-type="fig" rid="fig5">Figure 5</xref>). As shown in the results, some ECM proteins such as FN1, COL4A2 and MMP14, were all down-regulated on 1 kPa matrix compared to 40 kPa matrix. More importantly, the expression of CHD5 involved in adherens junction and F11R involved in tight junction, respectively, was lower on 1 kPa matrix. These finding were confirmed by RT-qPCR results (<xref ref-type="fig" rid="fig6">Figure 6</xref>). Both of them play key roles in maintaining ECM integrity, cell-ECM interactions, and transmitting mechanical signals [<xref ref-type="bibr" rid="scirp.121566-ref46">46</xref>]. Besides, ITGA5, which encodes integrin α5, also showed significant differences. Given the critical role of integrins in translating mechanical signals into biochemical signals, a large number of therapeutic approaches based on targeting integrins have been developed [<xref ref-type="bibr" rid="scirp.121566-ref47">47</xref>]. These results suggest that matrix stiffness may affect the integrity of ECM and endothelial cell barrier function through ITGA5.</p></sec><sec id="s5"><title>5. Conclusion</title><p>In summary, we characterized the transcriptome profile of ECs cultured on matrices with different stiffness. The dynamic changes of DEGs of ECs contributed to understanding the molecular mechanisms of mechanotransduction. Our results suggested that matrix stiffness may affect ECM integrity, cell-ECM interactions, and cell-cell junctions, which in turn affect endothelial cell barrier function. The above findings provided unique insights for further studies on the mechanisms underlying how matrix stiffness affects cell behavior and could serve as the basis for the prevention and treatment of diseases.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s7"><title>Cite this paper</title><p>Zhang, C., Han, X.M., Xu, J. and Zhou, Y. (2022) Matrix Stiffness-Induced Transcriptome Alterations and Regulatory Mechanisms Revealed by RNA-Seq in Endothelial Cells. Journal of Biomaterials and Nanobiotechnology, 13, 61-79. https://doi.org/10.4236/jbnb.2022.133004</p></sec><sec id="s8"><title>Abbreviations</title><p>Endothelial cells (ECs);</p><p>Differentially expressed genes (DEGs);</p><p>Transcription factor (TF);</p><p>Protein-protein interaction (PPI);</p><p>Extracellular matrix (ECM);</p><p>Human umbilical vein endothelial cells (HUVECs);</p><p>Reverse-transcription and real-time quantitative polymerase chain reaction (RT-qPCR);</p><p>Fibronectin 1 (FN1);</p><p>Cadherin 5 (CDH5);</p><p>F11 receptor (F11R);</p><p>Integrin, alpha 5 (ITGA5);</p><p>Collagen α2(IV) chain (COL4A2);</p><p>Matrix metallopeptidase 14 (MMP14).</p></sec></body><back><ref-list><title>References</title><ref id="scirp.121566-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Chaudhuri, O., Cooper-White, J., Janmey, P.A., Mooney, D.J. and Shenoy, V.B. (2020) Effects of Extracellular Matrix Viscoelasticity on Cellular Behaviour. Nature, 584, 535-546. https://doi.org/10.1038/s41586-020-2612-2</mixed-citation></ref><ref id="scirp.121566-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Vining, K.H. and Mooney, D.J. (2017) Mechanical Forces Direct Stem Cell Behaviour in Development and Regeneration. Nature Reviews Molecular Cell Biology, 18, 728-742. https://doi.org/10.1038/nrm.2017.108</mixed-citation></ref><ref id="scirp.121566-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Lampi, M.C. and Reinhart-King, C.A. (2018) Targeting Extracellular Matrix Stiffness to Attenuate Disease: From Molecular Mechanisms to Clinical Trials. Science Translational Medicine, 10, eaao0475. https://doi.org/10.1126/scitranslmed.aao0475</mixed-citation></ref><ref id="scirp.121566-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Matsumoto, T., Abe, H., Ohashi, T., Kato, Y. and Sato, M. (2002) Local Elastic Modulus of Atherosclerotic Lesions of Rabbit Thoracic Aortas Measured by Pipette Aspiration Method. Physiological Measurement, 23, 635-648. https://doi.org/10.1088/0967-3334/23/4/304</mixed-citation></ref><ref id="scirp.121566-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Tian, B., Ding, X., Song, Y., Chen, W., Liang, J., Yang, L., Fan, Y., Li, S. and Zhou, Y. (2019) Matrix Stiffness Regulates SMC Functions via TGF-β Signaling Pathway. Biomaterials, 221, Article ID: 119407. https://doi.org/10.1016/j.biomaterials.2019.119407</mixed-citation></ref><ref id="scirp.121566-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Shao, Y., Saredy, J., Yang, W.Y., Sun, Y., Lu, Y., Saaoud, F., Drummer, C., Johnson, C., Xu, K., Jiang, X., Wang, H. and Yang, X. (2020) Vascular Endothelial Cells and Innate Immunity. Arteriosclerosis, Thrombosis, and Vascular Biology, 40, e138-e152. https://doi.org/10.1161/ATVBAHA.120.314330</mixed-citation></ref><ref id="scirp.121566-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Heusch, G., Libby, P., Gersh, B., Yellon, D., B&amp;#246;hm, M., Lopaschuk, G. and Opie, L. (2014) Cardiovascular Remodelling in Coronary Artery Disease and Heart Failure. The Lancet, 383, 1933-1943. https://doi.org/10.1016/S0140-6736(14)60107-0</mixed-citation></ref><ref id="scirp.121566-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Janmey, P.A., Fletcher, D.A. and Reinhart-King, C.A. (2020) Stiffness Sensing by Cells. Physiological Reviews, 100, 695-724. https://doi.org/10.1152/physrev.00013.2019</mixed-citation></ref><ref id="scirp.121566-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Haynes, B.A., Yang, L.F., Huyck, R.W., Lehrer, E.J., Turner, J.M., Barabutis, N., Correll, V.L., Mathiesen, A., McPheat, W., Semmes, O.J. and Dobrian, A.D. (2019) Endothelial-to-Mesenchymal Transition in Human Adipose Tissue Vasculature Alters the Particulate Secretome and Induces Endothelial Dysfunction. Arteriosclerosis, Thrombosis, and Vascular Biology, 39, 2168-2191. https://doi.org/10.1161/ATVBAHA.119.312826</mixed-citation></ref><ref id="scirp.121566-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Gimbrone, M.A. and García-Carde&amp;#241;a, G. (2013) Vascular Endothelium, Hemodynamics, and the Pathobiology of Atherosclerosis. Cardiovascular Pathology, 22, 9-15. https://doi.org/10.1016/j.carpath.2012.06.006</mixed-citation></ref><ref id="scirp.121566-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Souilhol, C., Serbanovic-Canic, J., Fragiadaki, M., Chico, T.J., Ridger, V., Roddie, H. and Evans, P.C. (2020) Endothelial Responses to Shear Stress in Atherosclerosis: A Novel Role for Developmental Genes. Nature Reviews Cardiology, 17, 52-63. https://doi.org/10.1038/s41569-019-0239-5</mixed-citation></ref><ref id="scirp.121566-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Bonnans, C., Chou, J. and Werb, Z. (2014) Remodelling the Extracellular Matrix in Development and Disease. Nature Reviews Molecular Cell Biology, 15, 786-801. https://doi.org/10.1038/nrm3904</mixed-citation></ref><ref id="scirp.121566-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Chen, W., Tian, B., Liang, J., Yu, S., Zhou, Y. and Li, S. (2019) Matrix Stiffness Regulates the Interactions between Endothelial Cells and Monocytes. Biomaterials, 221, Article ID: 119362. https://doi.org/10.1016/j.biomaterials.2019.119362</mixed-citation></ref><ref id="scirp.121566-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Hu, M., Jia, F., Huang, W.P., Li, X., Hu, D.F., Wang, J., Ren, K.F., Fu, G.S., Wang, Y.B. and Ji, J. (2021) Substrate Stiffness Differentially Impacts Autophagy of Endothelial Cells and Smooth Muscle Cells. Bioactive Materials, 6, 1413-1422. https://doi.org/10.1016/j.bioactmat.2020.10.013</mixed-citation></ref><ref id="scirp.121566-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Bao, M., Chen, Y., Liu, J.T., Bao, H., Wang, W.B., Qi, Y.X. and Lv, F. (2022) Extracellular Matrix Stiffness Controls VEGF(165) Secretion and Neuroblastoma Angiogenesis via the YAP/RUNX2/SRSF1 Axis. Angiogenesis, 25, 71-86. https://doi.org/10.1007/s10456-021-09804-7</mixed-citation></ref><ref id="scirp.121566-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Andresen Eguiluz, R.C., Kaylan, K.B., Underhill, G.H. and Leckband, D.E. (2017) Substrate Stiffness and VE-Cadherin Mechano-Transduction Coordinate to Regulate Endothelial Monolayer Integrity. Biomaterials, 140, 45-57. https://doi.org/10.1016/j.biomaterials.2017.06.010</mixed-citation></ref><ref id="scirp.121566-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Urbanczyk, M., Zbinden, A. and Schenke-Layland, K. (2022) Organ-Specific Endothelial Cell Heterogenicity and Its Impact on Regenerative Medicine and Biomedical Engineering Applications. Advanced Drug Delivery Reviews, 186, Article ID: 114323. https://doi.org/10.1016/j.addr.2022.114323</mixed-citation></ref><ref id="scirp.121566-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Xu, S., Ilyas, I., Little, P.J., Li, H., Kamato, D., Zheng, X., Luo, S., Li, Z., Liu, P., Han, J., Harding, I.C., Ebong, E.E., Cameron, S.J., Stewart, A.G. and Weng, J. (2021) Endothelial Dysfunction in Atherosclerotic Cardiovascular Diseases and Beyond: From Mechanism to Pharmacotherapies. Pharmacological Reviews, 73, 924-967. https://doi.org/10.1124/pharmrev.120.000096</mixed-citation></ref><ref id="scirp.121566-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Bolger, A.M., Lohse, M. and Usadel, B. (2014) Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics, 30, 2114-2120. https://doi.org/10.1093/bioinformatics/btu170</mixed-citation></ref><ref id="scirp.121566-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Kim, D., Langmead, B. and Salzberg, S.L. (2015) HISAT: A Fast Spliced Aligner with Low Memory Requirements. Nature Methods, 12, 357-360. https://doi.org/10.1038/nmeth.3317</mixed-citation></ref><ref id="scirp.121566-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Roberts, A., Trapnell, C., Donaghey, J., Rinn, J.L. and Pachter, L. (2011) Improving RNA-Seq Expression Estimates by Correcting for Fragment Bias. Genome Biology, 12, R22. https://doi.org/10.1186/gb-2011-12-3-r22</mixed-citation></ref><ref id="scirp.121566-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J. and Pachter, L. (2010) Transcript Assembly and Quantification by RNA-Seq Reveals Unannotated Transcripts and Isoform Switching during Cell Differentiation. Nature Biotechnology, 28, 511-515. https://doi.org/10.1038/nbt.1621</mixed-citation></ref><ref id="scirp.121566-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Anders, S., Pyl, P.T. and Huber, W. (2015) HTSeq—A Python Framework to Work with High-Throughput Sequencing Data. Bioinformatics, 31, 166-169. https://doi.org/10.1093/bioinformatics/btu638</mixed-citation></ref><ref id="scirp.121566-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Anders, S. and Huber, W. (2012) Differential Expression of RNA-Seq Data at the Gene Level—The DESeq Package.</mixed-citation></ref><ref id="scirp.121566-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Ringnér, M. (2008) What Is Principal Component Analysis? Nature Biotechnology, 26, 303-304. https://doi.org/10.1038/nbt0308-303</mixed-citation></ref><ref id="scirp.121566-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Abaricia, J.O., Shah, A.H. and Olivares-Navarrete, R. (2021) Substrate Stiffness Induces Neutrophil Extracellular Trap (NET) Formation through Focal Adhesion Kinase Activation. Biomaterials, 271, Article ID: 120715. https://doi.org/10.1016/j.biomaterials.2021.120715</mixed-citation></ref><ref id="scirp.121566-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Haas, A.J., Zihni, C., Ruppel, A., Hartmann, C., Ebnet, K., Tada, M., Balda, M.S. and Matter, K. (2020) Interplay between Extracellular Matrix Stiffness and JAM-A Regulates Mechanical Load on ZO-1 and Tight Junction Assembly. Cell Reports, 32, Article ID: 107924. https://doi.org/10.1016/j.celrep.2020.107924</mixed-citation></ref><ref id="scirp.121566-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Claesson-Welsh, L., Dejana, E. and McDonald, D.M. (2021) Permeability of the Endothelial Barrier: Identifying and Reconciling Controversies. Trends Molecular Medicine, 27, 314-331. https://doi.org/10.1016/j.molmed.2020.11.006</mixed-citation></ref><ref id="scirp.121566-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Niu, N., Xu, S., Xu, Y., Little, P.J. and Jin, Z.-G. (2019) Targeting Mechanosensitive Transcription Factors in Atherosclerosis. Trends in Pharmacological Sciences, 40, 253-266. https://doi.org/10.1016/j.tips.2019.02.004</mixed-citation></ref><ref id="scirp.121566-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Zhubanchaliyev, A., Temirbekuly, A., Kongrtay, K., Wanshura, L.C. and Kunz, J. (2016) Targeting Mechanotransduction at the Transcriptional Level: YAP and BRD4 Are Novel Therapeutic Targets for the Reversal of Liver Fibrosis. Frontiers in Pharmacology, 7, Article No. 462. https://doi.org/10.3389/fphar.2016.00462</mixed-citation></ref><ref id="scirp.121566-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Jarman, A.P. and Groves, A.K. (2013) The Role of Atonal Transcription Factors in the Development of Mechanosensitive Cells. Seminars in Cell &amp; Developmental Biology, 24, 438-447. https://doi.org/10.1016/j.semcdb.2013.03.010</mixed-citation></ref><ref id="scirp.121566-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Galea, G.L., Paradise, C.R., Meakin, L.B., Camilleri, E.T., Taipaleenmaki, H., Stein, G.S., Lanyon, L.E., Price, J.S., van Wijnen, A.J. and Dudakovic, A. (2020) Mechanical Strain-Mediated Reduction in RANKL Expression Is Associated with RUNX2 and BRD2. Gene, 763, Article ID: 100027. https://doi.org/10.1016/j.gene.2020.100027</mixed-citation></ref><ref id="scirp.121566-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Dupont, S. and Wickstr&amp;#246;m, S.A. (2022) Mechanical Regulation of Chromatin and Transcription. Nature Reviews Genetics, 23, 624-643. https://doi.org/10.1038/s41576-022-00493-6</mixed-citation></ref><ref id="scirp.121566-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Lacolley, P., Regnault, V., Segers, P. and Laurent, S. (2017) Vascular Smooth Muscle Cells and Arterial Stiffening: Relevance in Development, Aging, and Disease. Physiological Reviews, 97, 1555-1617. https://doi.org/10.1152/physrev.00003.2017</mixed-citation></ref><ref id="scirp.121566-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Chirinos, J.A., Segers, P., Hughes, T. and Townsend, R. (2019) Large-Artery Stiffness in Health and Disease: JACC State-of-the-Art Review. Journal of the American College of Cardiology, 74, 1237-1263. https://doi.org/10.1016/j.jacc.2019.07.012</mixed-citation></ref><ref id="scirp.121566-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Jia, G. and Sowers, J.R. (2021) Hypertension in Diabetes: An Update of Basic Mechanisms and Clinical Disease. Hypertension, 78, 1197-1205. https://doi.org/10.1161/HYPERTENSIONAHA.121.17981</mixed-citation></ref><ref id="scirp.121566-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Souilhol, C., Serbanovic-Canic, J., Fragiadaki, M., Chico, T.J., Ridger, V., Roddie, H. and Evans, P.C. (2020) Endothelial Responses to Shear Stress in Atherosclerosis: A Novel Role for Developmental Genes. Nature Reviews Cardiology, 17, 52-63. https://doi.org/10.1038/s41569-019-0239-5</mixed-citation></ref><ref id="scirp.121566-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Warkala, M., Chen, D., Ramirez, A., Jubran, A., Schonning, M., Wang, X., Zhao, H. and Astrof, S. (2021) Cell-Extracellular Matrix Interactions Play Multiple Essential Roles in Aortic Arch Development. Circulation Research, 128, e27-e44. https://doi.org/10.1161/CIRCRESAHA.120.318200</mixed-citation></ref><ref id="scirp.121566-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Kikuchi-Taura, A., Okinaka, Y., Saino, O., Takeuchi, Y., Ogawa, Y., Kimura, T., Gul, S., Claussen, C., Boltze, J. and Taguchi, A. (2021) Gap Junction-Mediated Cell-Cell Interaction between Transplanted Mesenchymal Stem Cells and Vascular Endothelium in Stroke. Stem Cells, 39, 904-912. https://doi.org/10.1002/stem.3360</mixed-citation></ref><ref id="scirp.121566-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Dupont, S., Morsut, L., Aragona, M., Enzo, E., Giulitti, S., Cordenonsi, M., Zanconato, F., Le Digabel, J., Forcato, M., Bicciato, S., Elvassore, N. and Piccolo, S. (2011) Role of YAP/TAZ in Mechanotransduction. Nature, 474, 179-183. https://doi.org/10.1038/nature10137</mixed-citation></ref><ref id="scirp.121566-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Zhou, Q., Zhang, Y., Wang, B., Zhou, W., Bi, Y., Huai, W., Chen, X., Chen, Y., Liu, Z., Liu, X. and Zhan, Z. (2020) KDM2B Promotes IL-6 Production and Inflammatory Responses through Brg1-Mediated Chromatin Remodeling. Cellular &amp; Molecular Immunology, 17, 834-842. https://doi.org/10.1038/s41423-019-0251-z</mixed-citation></ref><ref id="scirp.121566-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Chang, L., Azzolin, L., Di Biagio, D., Zanconato, F., Battilana, G., Lucon Xiccato, R., Aragona, M., Giulitti, S., Panciera, T., Gandin, A., Sigismondo, G., Krijgsveld, J., Fassan, M., Brusatin, G., Cordenonsi, M. and Piccolo, S. (2018) The SWI/SNF Complex Is a Mechanoregulated Inhibitor of YAP and TAZ. Nature, 563, 265-269. https://doi.org/10.1038/s41586-018-0658-1</mixed-citation></ref><ref id="scirp.121566-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Siebel, C. and Lendahl, U. (2017) Notch Signaling in Development, Tissue Homeostasis, and Disease. Physiological Reviews, 97, 1235-1294. https://doi.org/10.1152/physrev.00005.2017</mixed-citation></ref><ref id="scirp.121566-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">He, Y., Deng, B., Liu, S., Luo, S., Ning, Y., Pan, X., Wan, R., Chen, Y., Zhang, Z., Jiang, J., Xu, H., Xia, M. and Li, J. (2022) Myeloid Piezo1 Deletion Protects Renal Fibrosis by Restraining Macrophage Infiltration and Activation. Hypertension, 79, 918-931. https://doi.org/10.1161/HYPERTENSIONAHA.121.18750</mixed-citation></ref><ref id="scirp.121566-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Wettschureck, N., Strilic, B. and Offermanns, S. (2019) Passing the Vascular Barrier: Endothelial Signaling Processes Controlling Extravasation. Physiological Reviews, 99, 1467-1525. https://doi.org/10.1152/physrev.00037.2018</mixed-citation></ref><ref id="scirp.121566-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Castillo, E.A., Lane, K.V. and Pruitt, B.L. (2020) Micromechanobiology: Focusing on the Cardiac Cell-Substrate Interface. Annual Review of Biomedical Engineering, 22, 257-284. https://doi.org/10.1146/annurev-bioeng-092019-034950</mixed-citation></ref><ref id="scirp.121566-ref47"><label>47</label><mixed-citation publication-type="other" xlink:type="simple">Cooper, J. and Giancotti, F.G. (2019) Integrin Signaling in Cancer: Mechanotransduction, Stemness, Epithelial Plasticity, and Therapeutic Resistance. Cancer Cell, 35, 347-367. https://doi.org/10.1016/j.ccell.2019.01.007</mixed-citation></ref></ref-list></back></article>