<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2022.1311090</article-id><article-id pub-id-type="publisher-id">AJPS-121312</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  DNA Barcoding of Nigeria’s Forest Species Listed in CITES and Other Endangered Plant Species of National Interest
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Christie</surname><given-names>Oby Onyia</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Obianuju</surname><given-names>Patience Ilo</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Chosen</surname><given-names>Ekene Obih</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Omokafe</surname><given-names>Ugbogu</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Beatrice</surname><given-names>Onyinye Ojiego</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Sunkanmi</surname><given-names>Saheed Rufai</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Paschaleen</surname><given-names>Soromtochukwu Onyemaechi</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Emmanuel</surname><given-names>Chukwudi Chukwuma</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Department of Environmental Biotechnology and Bioconservation, National Biotechnology Development Agency, Abuja, Nigeria</addr-line></aff><aff id="aff1"><addr-line>Department of Biological Sciences/Directorate of Inter-Disciplinary Research, Godfrey Okoye University, Enugu, Nigeria</addr-line></aff><aff id="aff5"><addr-line>National Environmental Standards, Regulations and Enforcement Agency, Ibadan, Nigeria</addr-line></aff><aff id="aff3"><addr-line>Department of Biological Sciences, Godfrey Okoye University, Enugu, Nigeria</addr-line></aff><aff id="aff4"><addr-line>Forestry Research Institute of Nigeria, Ibadan, Nigeria</addr-line></aff><pub-date pub-type="epub"><day>18</day><month>11</month><year>2022</year></pub-date><volume>13</volume><issue>11</issue><fpage>1335</fpage><lpage>1346</lpage><history><date date-type="received"><day>17,</day>	<month>September</month>	<year>2022</year></date><date date-type="rev-recd"><day>18,</day>	<month>November</month>	<year>2022</year>	</date><date date-type="accepted"><day>21,</day>	<month>November</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Illegal trade is considered one of the greatest threats to the loss of biodiversity of endangered plants. Some of these plant species are often trafficked in processed forms, making it extremely difficult for taxonomic experts to identify them. In the past, illegal traders of endangered species have been arrested and prosecuted but eventually cleared due to a lack of conclusive evidence. DNA barcoding is a veritable tool to protect these endangered species from illegal trade. It identifies all stages of the species’ life forms including processed products (milled or powdered animal and plant parts). The study util
  ised the rbcL gene as a single barcode region in the identification/authentication of 19 Nigeria’s endangered forest species legislated under the CITES and other endangered species of national interest. The generated sequence barcodes were used to query NCBI-GenBank and BOLD databases. 57.89% of the samples were identified down to species level and 42.11% to genus level. Amongst the 19 samples, sample (S7) yielded a high-quality sequence for a single sequencing read (forward), sufficient to identify the sample with a 99.81% identity match on NCBI-GenBank and BOLD. The results reveal that the
   rbcL single barcode efficiently identified most of the sampled plants; this supports the potential utilisation of DNA barcoding in the accurate detection and conservation of CITES-listed plants in Nigeria. The study documented the CITES-listed plants and other essential plants endangered or threatened plants in Nigeria and provided the first chloroplast DNA reference dataset to support the utilisation of DNA barcoding to identify CITES-listed plant species in Nigeria, which is significant for future studies.
 
</p></abstract><kwd-group><kwd>Annonaceae</kwd><kwd> Apocynaceae</kwd><kwd> BOLD</kwd><kwd> CITES</kwd><kwd> DNA Barcoding</kwd><kwd> NCBI</kwd><kwd> &lt;i&gt;rbcL&lt;/i&gt;</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Land plants make up a large percentage of life diversity on earth, consisting of seed plants (angiosperms and gymnosperms), bryophytes, ferns and lilies, estimated at over 380,000 species [<xref ref-type="bibr" rid="scirp.121312-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.121312-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.121312-ref3">3</xref>]. It has been estimated that there are 352,000 species of angiosperms, 1300 species of gymnosperms and 13,000 species of bryophytes. During the last century, decreases in biodiversity have been increasingly observed. The Food and Agriculture Organization of the United Nations [<xref ref-type="bibr" rid="scirp.121312-ref4">4</xref>] reported the loss of 75% of the genetic diversity of crops, and according to Royal Botanic Gardens Kew [<xref ref-type="bibr" rid="scirp.121312-ref5">5</xref>], about one-fifth of known plant species are threatened with extinction. Nigeria is rich in bioresources and the distribution of biodiversity. This is shown by a broad range of habitats, starting from the Gulf of Guinea along the Atlantic coast, consisting of aquatic and non-aquatic organisms found in different ecological areas [<xref ref-type="bibr" rid="scirp.121312-ref6">6</xref>]. However, the country’s biodiversity are being threatened by various factors, which include but are not limited to anthropogenic activities and climate change effects.</p><p>As reported in the 2013 IUCN’s Red List, Nigeria’s threatened species are 309. The taxonomic categories include twenty-six mammals, nineteen birds, eight reptiles, thirteen amphibians, sixty fishes, a mollusc, fourteen other invertebrates and one hundred and sixty-eight plants [<xref ref-type="bibr" rid="scirp.121312-ref7">7</xref>]. Also, Nigeria Federal Environmental Protection Agency [<xref ref-type="bibr" rid="scirp.121312-ref8">8</xref>] reported that Nigeria has over 5000 recorded species of plants. It is estimated that 0.4% of the plant species are threatened, and 8.5% are endangered and close to becoming extinct due to poaching, climate change, urbanisation and industrialisation. According to Borokini [<xref ref-type="bibr" rid="scirp.121312-ref9">9</xref>], 91 species of Nigerian plants are endemic, and they belong to 44 families, with Rubiaceae attributing to the majority. Conservation scientists opine that serious consideration should be aimed at rescuing the remnants of the significant zones for biodiversity in the nation. Furthermore, there is a common agreement on where the outstanding node of biodiversity exists in Nigeria. The first level of feat is proper identification and documentation (Federal Ministry of Environment [<xref ref-type="bibr" rid="scirp.121312-ref10">10</xref>]). How fast this can be achieved will depend on the county’s capability, capacity and willpower to apply and deploy scientific advances such as DNA barcoding.</p><p>According to Convention on Biological Diversity [<xref ref-type="bibr" rid="scirp.121312-ref11">11</xref>], the global conservation strategy deems genes, species and ecosystem as prospective tools for sustaining biodiversity ecosystems conservation. Species identification is essential in assessing the level of biodiversity that appraises species diversity for conservation and management efforts [<xref ref-type="bibr" rid="scirp.121312-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.121312-ref13">13</xref>]. Fast and accurate plant species identification is vital in almost all plant-based research, including biodiversity studies. To protect global biodiversity from poaching and international trade abuse, countries of the world signed a treaty on March 3 1973, known as the Convention on International Trade on Endangered Species of Wild Fauna and Flora (CITES), for regulating trade in endangered species across the border. Protected species are classified in CITES Appendices I, II, and III, in accordance with how a particular populace is being threatened by extinction (Convention on the International Trade in Endangered Species of Wild Fauna and Flora [<xref ref-type="bibr" rid="scirp.121312-ref14">14</xref>]). Species listed in CITES Appendix I are illegal for international trade except for research. However, foreign trade could be approved by appropriate agencies of the nations affected by the import and export. Species listed in Appendix II of CITES are not yet threatened by extinction but may soon become unless their trade is checked [<xref ref-type="bibr" rid="scirp.121312-ref6">6</xref>].</p><p>Nigeria has over two hundred plants and animal species listed in the CITES, almost half of which are plants and most of which belong to Orchidaceae, Fabaceae, Euphorbiaceae families and Cycadaceae [<xref ref-type="bibr" rid="scirp.121312-ref15">15</xref>]. Most of the endangered land plants are located in the country’s various hard-to-reach protected forest reserves, from where some of the samples used in this study were collected. For adequate protection from illegal trade/over-exploitation for conservation purposes, there is a need for proper identification of the plants and authentication of same using DNA barcoding technique. The technique has been extensively utilised for several purposes and documented as a resurgence for taxonomy (Kress, 2017; Yu et al., 2021). DNA barcoding has also been applied in disease and pest control, market fraud detection and protection of endangered species from poachers and illegal international trade [<xref ref-type="bibr" rid="scirp.121312-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.121312-ref17">17</xref>]. Globally, there are ongoing initiatives to produce DNA barcodes for all assemblages of living organisms and the public availability of these information to comprehend, conserve, and use the world’s biodiversity [<xref ref-type="bibr" rid="scirp.121312-ref18">18</xref>]. For instance, Pathak et al. [<xref ref-type="bibr" rid="scirp.121312-ref19">19</xref>] reported using DNA barcoding in identifying 29 medicinal plants in the kingdom of Bahrain, while Lv et al. [<xref ref-type="bibr" rid="scirp.121312-ref20">20</xref>] identified herbal plants in the Apocynaceae family using DNA barcodes.</p><p>A DNA barcode is a genetic signature occurring naturally within every living species’ genome [<xref ref-type="bibr" rid="scirp.121312-ref21">21</xref>]. Mitochondrial cytochrome oxidase 1 gene (CO1) has been found effective in identifying animal groups, including birds, flies, butterflies and fish [<xref ref-type="bibr" rid="scirp.121312-ref22">22</xref>]; however, CO1 is ineffective for land plants. In the plastid region of land plants, the regions commonly used are two gene regions in the chloroplast, matK and Ribulose-1,5-bisphosphate carboxylase large subunit (rbcL), with two additional regions,trnH-psbA and internal transcribed spacer (ITS) or (ITS2) [<xref ref-type="bibr" rid="scirp.121312-ref23">23</xref>]. Jamdade et al. [<xref ref-type="bibr" rid="scirp.121312-ref24">24</xref>] assessed the ability of ITS2, rbcL and matK in classifying 20 key plant species of Caryophyllales and found that ITS2 was more effective in distinguishing between studied species. Lone et al. [<xref ref-type="bibr" rid="scirp.121312-ref25">25</xref>] investigated the use of ITS,rbcL, trnH-psbA and matK markers in identifying Epimedium elatum, a rare medicinal plant in the Himalayas, India and revealed highest polymorphic sites in ITS and matK. However, Negi et al. [<xref ref-type="bibr" rid="scirp.121312-ref26">26</xref>] identified rbcL as a potential marker to curb illicit trade of medicinal plants, Aconitum heterophyllum and Aconitum balfourii. Also, Ho et al. [<xref ref-type="bibr" rid="scirp.121312-ref27">27</xref>], in comparing the effectiveness of rbcL and matK DNA barcodes in the classification of Jewel orchid in Vietnam, disclosed rbcL gene has higher characteristic potential than matK.</p><p>This paper presents the first report of Nigeria’s Barcode of Wildlife—Plant Working Group (BWP-PWG) to protect the endangered flora species listed under CITES from poaching and illegal trading using DNA barcoding.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Sample Collection</title><p>Tools and materials used for the sample collection include Pair of secateurs, silica gel, machete and knife, polythene bag, hand lenses, a hardcover waterproof notebook, transparent rulers, plant presses, FluidX tubes, personal protective wear and a GPS device. Samples were collected as fresh as possible from the field and not touched with bare hands to avoid contamination. Young, fresh, flexible and non-waxy leaves, about 5 to 10 cm<sup>2</sup> in size, were chosen and stored in paper envelopes under relatively dry climatic conditions. The envelopes were assigned the same number as the plant specimen from which the leaves were collected, and the general rule is one plant per number. The number given to each plant is unique, written on a tag tied to the collected plant, and the replicates bear the same number. The samples were later transferred into FluidX tubes with unique barcodes containing silica gel. The ratio of the silica gel to leaf tissue was 5 - 10:1. Information, such as the GPS location, plant’s taxonomic name, tissue barcode number and habitat, was recorded and presented in <xref ref-type="table" rid="table1">Table 1</xref>.</p></sec><sec id="s2_2"><title>2.2. DNA Extraction</title><p>According to the manufacturer’s protocol, the extraction of genomic DNA from the samples was done using a modified DNA extraction kit (DNeasy plant mini kit, QIAGEN). Geno-grinder (2000, SPEX Inc.) was utilised to grind the lyophilised plant tissues, after which 20 mg of each plant tissue was put into distinctly labelled micro-centrifuge tubes. Approximately 400 &#181;l of Buffer AP1 and 4 &#181;l of RNase A stock solution (100 mg/ml) were added to each tube containing the powdered tissue. The mixtures were incubated in a water bath for 10 min at 65˚C. The tubes were homogenised 2 - 3 times by inverting tubes while incubating. Additionally, 130 &#181;l of Buffer AP2 was added to the lysates, stirred, and incubated on ice for 5 min. Centrifuging of the lysates for 5 min at 14,000 rpm was made, and the supernatants were transferred to QIAshredder spin columns sitting in 2 ml collection tubes and centrifuged for 2 min at 14,000 rpm. The flow-through was moved to well-labelled micro-centrifuge tubes. About 1.5 volume of Buffer AP3/E was put into the cleared lysates and homogenised by pipetting.</p><p>Consequently, pipetting of 650 &#181;l of the mixture into DNeasy mini spin columns sitting in 2 ml collection tubes was executed and centrifuged for 1 min at ≥6000 &#215; g. Then, the filtrate was removed, and the spin columns returned to the</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Samples field collection data</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sample ID</th><th align="center" valign="middle" >Taxonomic ID</th><th align="center" valign="middle" >Family</th><th align="center" valign="middle" >Tissue barcode</th><th align="center" valign="middle" >States collected</th><th align="center" valign="middle" >Locality</th><th align="center" valign="middle" >Decimal latitude</th><th align="center" valign="middle" >Decimal longitude</th></tr></thead><tr><td align="center" valign="middle" >S1</td><td align="center" valign="middle" >Funtumia elastica</td><td align="center" valign="middle" >Apocynaceae</td><td align="center" valign="middle" >FR04499552</td><td align="center" valign="middle" >Ogun</td><td align="center" valign="middle" >Omo Biosphere Reserve, Etemi</td><td align="center" valign="middle" >6.975361</td><td align="center" valign="middle" >4.366111</td></tr><tr><td align="center" valign="middle" >S2</td><td align="center" valign="middle" >Ficus exasperata</td><td align="center" valign="middle" >Moraceae</td><td align="center" valign="middle" >FR04499555</td><td align="center" valign="middle" >Ogun</td><td align="center" valign="middle" >Omo Biosphere Reserve, Etemi</td><td align="center" valign="middle" >6.979333</td><td align="center" valign="middle" >4.371944</td></tr><tr><td align="center" valign="middle" >S3</td><td align="center" valign="middle" >Kigelia Africana</td><td align="center" valign="middle" >Bignoniaceae</td><td align="center" valign="middle" >FR04499557</td><td align="center" valign="middle" >Osun</td><td align="center" valign="middle" >Sasa</td><td align="center" valign="middle" >7.089556</td><td align="center" valign="middle" >4.350306</td></tr><tr><td align="center" valign="middle" >S4</td><td align="center" valign="middle" >Diospyros mespiliformis</td><td align="center" valign="middle" >Ebenaceae</td><td align="center" valign="middle" >FR04499559</td><td align="center" valign="middle" >Oyo</td><td align="center" valign="middle" >Ebuya, Old Oyo National Park</td><td align="center" valign="middle" >8.485583</td><td align="center" valign="middle" >3.758833</td></tr><tr><td align="center" valign="middle" >S5</td><td align="center" valign="middle" >Lophira lanceolata</td><td align="center" valign="middle" >Ochnaceae</td><td align="center" valign="middle" >FR04499560</td><td align="center" valign="middle" >Oyo</td><td align="center" valign="middle" >Ebuya, Old Oyo National Park</td><td align="center" valign="middle" >8.486889</td><td align="center" valign="middle" >3.758</td></tr><tr><td align="center" valign="middle" >S6</td><td align="center" valign="middle" >Aframomum sceptrum</td><td align="center" valign="middle" >Zingiberaceae</td><td align="center" valign="middle" >FR04499565</td><td align="center" valign="middle" >Oyo</td><td align="center" valign="middle" >Ebuya, Old Oyo National Park</td><td align="center" valign="middle" >8.486167</td><td align="center" valign="middle" >3.7565</td></tr><tr><td align="center" valign="middle" >S7</td><td align="center" valign="middle" >Afzelia Africana</td><td align="center" valign="middle" >Fabaceae</td><td align="center" valign="middle" >FR04499569</td><td align="center" valign="middle" >Oyo</td><td align="center" valign="middle" >Ebuya, Old Oyo National Park</td><td align="center" valign="middle" >8.487222</td><td align="center" valign="middle" >3.757444</td></tr><tr><td align="center" valign="middle" >S8</td><td align="center" valign="middle" >Annona senegalensis</td><td align="center" valign="middle" >Annonaceae</td><td align="center" valign="middle" >FR04499570</td><td align="center" valign="middle" >Oyo</td><td align="center" valign="middle" >Ebuya, Old Oyo National Park</td><td align="center" valign="middle" >8.487113</td><td align="center" valign="middle" >3.757417</td></tr><tr><td align="center" valign="middle" >S9</td><td align="center" valign="middle" >Annona muricata</td><td align="center" valign="middle" >Annonaceae</td><td align="center" valign="middle" >FR04499573</td><td align="center" valign="middle" >Oyo</td><td align="center" valign="middle" >Sepeteri</td><td align="center" valign="middle" >8.623306</td><td align="center" valign="middle" >3.645861</td></tr><tr><td align="center" valign="middle" >S10</td><td align="center" valign="middle" >Albizia zygia</td><td align="center" valign="middle" >Fabaceae</td><td align="center" valign="middle" >FR04499578</td><td align="center" valign="middle" >Osun</td><td align="center" valign="middle" >Abataju village, Oke-Odo, Ikire</td><td align="center" valign="middle" >7.383444</td><td align="center" valign="middle" >4.230056</td></tr><tr><td align="center" valign="middle" >S11</td><td align="center" valign="middle" >Gongronema latifolium</td><td align="center" valign="middle" >Apocynaceae</td><td align="center" valign="middle" >FR04499581</td><td align="center" valign="middle" >Osun</td><td align="center" valign="middle" >Abataju village, Oke-Odo</td><td align="center" valign="middle" >7.384222</td><td align="center" valign="middle" >4.230389</td></tr><tr><td align="center" valign="middle" >S12</td><td align="center" valign="middle" >Funtumia africana</td><td align="center" valign="middle" >Apocynaceae</td><td align="center" valign="middle" >FR04499582</td><td align="center" valign="middle" >Osun</td><td align="center" valign="middle" >Abataju village, Oke-Odo</td><td align="center" valign="middle" >7.384417</td><td align="center" valign="middle" >4.230528</td></tr><tr><td align="center" valign="middle" >S13</td><td align="center" valign="middle" >Garcinia kola</td><td align="center" valign="middle" >Clusiaceae</td><td align="center" valign="middle" >FR04499583</td><td align="center" valign="middle" >Osun</td><td align="center" valign="middle" >Abataju village, Oke-Odo</td><td align="center" valign="middle" >7.387944</td><td align="center" valign="middle" >4.229056</td></tr><tr><td align="center" valign="middle" >S14</td><td align="center" valign="middle" >Lophira alata</td><td align="center" valign="middle" >Ochnaceae</td><td align="center" valign="middle" >FR04499588</td><td align="center" valign="middle" >Edo</td><td align="center" valign="middle" >Arakwan, Okomu National Park</td><td align="center" valign="middle" >6.34225</td><td align="center" valign="middle" >5.361028</td></tr><tr><td align="center" valign="middle" >S15</td><td align="center" valign="middle" >Khaya ivorensis</td><td align="center" valign="middle" >Meliaceae</td><td align="center" valign="middle" >FR04499589</td><td align="center" valign="middle" >Edo</td><td align="center" valign="middle" >Arakwan, Okomu National Park</td><td align="center" valign="middle" >6.343</td><td align="center" valign="middle" >5.360167</td></tr><tr><td align="center" valign="middle" >S16</td><td align="center" valign="middle" >Diospyros piscatoria</td><td align="center" valign="middle" >Ebenaceae</td><td align="center" valign="middle" >FR04499595</td><td align="center" valign="middle" >Edo</td><td align="center" valign="middle" >Arakwan, Okomu National Park</td><td align="center" valign="middle" >6.349417</td><td align="center" valign="middle" >5.343083</td></tr><tr><td align="center" valign="middle" >S17</td><td align="center" valign="middle" >Monodora tenuifolia</td><td align="center" valign="middle" >Annonaceae</td><td align="center" valign="middle" >FR04499597</td><td align="center" valign="middle" >Oyo</td><td align="center" valign="middle" >Microbiology dept, University of Ibadan</td><td align="center" valign="middle" >7.442778</td><td align="center" valign="middle" >3.897139</td></tr><tr><td align="center" valign="middle" >S18</td><td align="center" valign="middle" >Momordica charantia</td><td align="center" valign="middle" >Cucurbitaceae</td><td align="center" valign="middle" >FR04499542</td><td align="center" valign="middle" >Oyo</td><td align="center" valign="middle" >FRIN arboretum</td><td align="center" valign="middle" >7.391694</td><td align="center" valign="middle" >3.85775</td></tr><tr><td align="center" valign="middle" >S19</td><td align="center" valign="middle" >Entandrophragma angolense</td><td align="center" valign="middle" >Meliaceae</td><td align="center" valign="middle" >FR04499544</td><td align="center" valign="middle" >Oyo</td><td align="center" valign="middle" >FRIN premises, opposite FHI</td><td align="center" valign="middle" >7.39175</td><td align="center" valign="middle" >3.863028</td></tr></tbody></table></table-wrap><p>collection tubes. A repeat of this phase was made for the residual. About 500 &#181;l of Buffer AW was put into the DNeasy columns, inserted in new 2 ml collection tubes and centrifuged for 1 min at ≥6000 &#215; g (≥8000 rpm). Then, the filtrate was thrown away, and 500 &#181;l of Buffer AW was put into the DNeasy columns and centrifuged for 2 minutes at the highest rate for drying the membrane. Transfer of the DNeasy columns was made to 1.5 ml micro-centrifuge tubes, and 200 &#181;l of preheated (65˚C) Buffer AE was put into the DNeasy membrane directly. They were incubated for 5 minutes at room temperature, after which centrifugation was done at ≥6000 &#215; g (≥8000 rpm) for 1 minute for elution. The quality and concentration of DNA were determined using 2 &#181;l of the diluted DNA sample on 1% agarose gel. DNA’s quantity was measured with a Nanodrop spectrophotometer (2000/2000c, Thermo Scientific Inc.).</p></sec><sec id="s2_3"><title>2.3. Polymerase Chain Reaction (PCR) Amplification</title><p>PCR was evaluated using a 25 &#181;l cocktail made up of genomic DNA—100 ng, 10&#215; PCR buffer—2.5 &#181;l, 50 mM MgCl<sub>2</sub>—1 &#181;l, 2.5 mM dNTPs—2 &#181;l, Taq polymerase—0.1 &#181;l, DMSO—1 &#181;l, forward and reverse primer—1 &#181;l each and H<sub>2</sub>O—11.3 &#181;l. The gene region targeted and primer sequenced used are shown in <xref ref-type="table" rid="table2">Table 2</xref>. Amplification was performed using touch-down PCR as follows: an initial denaturation step of 5 mins at 94˚C, followed by nine cycles, each consisting of a denaturation step of 20 sec at 94˚C, an annealing step of 30 sec at 65˚C, and an extension step of 72˚C for 45 sec, this is followed by another 30 cycles each consisting of a denaturation step of 20 sec at 94˚C, annealing step of 30 sec at 55˚C, and an extension step of 72˚C for 45 sec. All amplification reactions were conducted in a GeneAmp PCR (Applied Biosystems). PCR amplicons were loaded on 1.5% agarose gel and ran at 100 volts for 2 hours.</p></sec><sec id="s2_4"><title>2.4. Sequencing</title><p>The amplified products were used to select the amplicons with a single band and were purified according to the company’s protocol (Cat. No.28106, QIAquick PCR Purification Kit). Afterwards, sequencing was executed using a sequencing kit (BigDye terminator cycle, Applied BioSystems). With ethanol EDTA solution,</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Gene region targeted and primer sequences used</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene and Region</th><th align="center" valign="middle" >Name of Primer</th><th align="center" valign="middle" >Primer Sequence 5' - 3'</th><th align="center" valign="middle" >Direction</th><th align="center" valign="middle" >Reference</th><th align="center" valign="middle" >Expected band size (bp)</th></tr></thead><tr><td align="center" valign="middle"  rowspan="4"  >rbcL</td><td align="center" valign="middle"  rowspan="2"  >rbcLaf</td><td align="center" valign="middle"  rowspan="2"  >ATGTCACCACAAACAGAGACTAAAGC</td><td align="center" valign="middle"  rowspan="2"  >F</td><td align="center" valign="middle" >Levin et al. [<xref ref-type="bibr" rid="scirp.121312-ref28">28</xref>] modified from</td><td align="center" valign="middle"  rowspan="4"  >750</td></tr><tr><td align="center" valign="middle" >Soltis et al. [<xref ref-type="bibr" rid="scirp.121312-ref29">29</xref>]</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >rbcLarev</td><td align="center" valign="middle"  rowspan="2"  >GTAAAATCAAGTCCACCRCG</td><td align="center" valign="middle"  rowspan="2"  >R</td><td align="center" valign="middle" >Kress and Erickson [<xref ref-type="bibr" rid="scirp.121312-ref30">30</xref>] modified from</td></tr><tr><td align="center" valign="middle" >Fofana et al. [<xref ref-type="bibr" rid="scirp.121312-ref31">31</xref>]</td></tr></tbody></table></table-wrap><p>unincorporated dye terminators were cleaned and precipitated. Furthermore, the pellets were dissolved in HiDi formaldehyde buffer (Cat No. 4311320, Applied Biosystems). Finally, a Genetic Analyser (3130xl, Applied Biosystems) was used to complete the sequencing, and the obtained sequence trace files were uploaded to the open-access DNA Subway software, following the guidelines reported by Goff et al. [<xref ref-type="bibr" rid="scirp.121312-ref32">32</xref>] and Merchant et al. [<xref ref-type="bibr" rid="scirp.121312-ref33">33</xref>]. The DNA sequences were analysed on the Blue Line of the DNA Subway.</p><p>The sequences were trimmed and viewed, and the forward and reverse sequences were manually edited and then paired to construct a consensus sequence. In case(s) where the forward and reverse sequence could not be merged to generate a consensus sequence, only the readable barcode sequence was utilised in the subsequent analysis due to the poor quality. The consensus sequences were exported for downstream analysis on NCBI-GenBank [<xref ref-type="bibr" rid="scirp.121312-ref34">34</xref>] and BOLD [<xref ref-type="bibr" rid="scirp.121312-ref35">35</xref>]. The samples were recognised based on the maximum percentage identity score. In cases where NCBI GenBank and BOLD searches returned identical identifications, the samples were considered at least to the genus level. The generated sequence barcodes were translated to amino acid sequences using the EMBOSS Transeq web tool of the European Molecular Biology Laboratory’s European Bioinformatics Institute (EMBL-EBI) to determine their suitable open reading frame. The sequences were later tendered to NCBI-GenBank, and their accession numbers were obtained, as shown in <xref ref-type="table" rid="table3">Table 3</xref>.</p></sec></sec><sec id="s3"><title>3. Results</title><p>This study tested the effectiveness of DNA barcoding to authenticate sampled CITES-listed land plants in Nigeria. Following the Nigerian plants CITES list created by the Barcode of Wildlife Nigeria-Plant Working Group in 2014, nineteen (19) plants in twelve (12) families belonging to Annonaceae and Apocynaceae families were sampled (<xref ref-type="table" rid="table1">Table 1</xref>). Extraction of DNA from all the samples was followed by PCR amplification of the rbcL barcode region. All the samples were successfully amplified. The PCR products, which were bidirectionally sequenced, produced a good sequence of at least 500 bp in length for both directions, with fewer nucleotide ambiguities. However, sample (S7) yielded a high-quality sequence for a single sequencing read (forward), sufficient to identify the sample with a 99.81% identity match on NCBI-GenBank and BOLD.</p><p>GenBank and BOLD comparison authenticated the identity of all the plant samples. Although DNA Subway’s local nucleotide database allows a rapid search, it has limitations [<xref ref-type="bibr" rid="scirp.121312-ref36">36</xref>]. Based on this fact, GenBank and BOLD were employed in identifying the samples, of which 57.89% were identified at the species level, and 42.11% were identified only at the genus level. The top BLAST result was evaluated with the highest percent identity score for all sequences. In the case of a tie between two identity scores, the lowest e-value was used as a deciding factor. If there were identical e-values and identity scores for multiple species, the individuals were only identified to the genus level to avoid taxonomic misidentification.</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Blast output of the generated rbcL sequences of the sampled species</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sample number</th><th align="center" valign="middle" >Taxonomic ID</th><th align="center" valign="middle" >GenBank ID</th><th align="center" valign="middle" >Percentage identity</th><th align="center" valign="middle" >BOLD ID</th><th align="center" valign="middle" >Percentage Identity</th><th align="center" valign="middle" >Accession number</th></tr></thead><tr><td align="center" valign="middle" >S1</td><td align="center" valign="middle" >Funtumia elastica</td><td align="center" valign="middle" >Funtumia elastic</td><td align="center" valign="middle" >99.82</td><td align="center" valign="middle" >Funtumia elastica</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >MT385762</td></tr><tr><td align="center" valign="middle" >S2</td><td align="center" valign="middle" >Ficus exasperate</td><td align="center" valign="middle" >Ficus hirta</td><td align="center" valign="middle" >99.83</td><td align="center" valign="middle" >Ficus carica</td><td align="center" valign="middle" >99.83</td><td align="center" valign="middle" >MT385771</td></tr><tr><td align="center" valign="middle" >S3</td><td align="center" valign="middle" >Kigelia Africana</td><td align="center" valign="middle" >Kigelia africana</td><td align="center" valign="middle" >99.46</td><td align="center" valign="middle" >Kigelia africana</td><td align="center" valign="middle" >99.47</td><td align="center" valign="middle" >MT385758</td></tr><tr><td align="center" valign="middle" >S4</td><td align="center" valign="middle" >Diospyros mespiliformis</td><td align="center" valign="middle" >Diospyros mespiliformis</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >Diospyros melanoxylon</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >MT385755</td></tr><tr><td align="center" valign="middle" >S5</td><td align="center" valign="middle" >Lophira lanceolata</td><td align="center" valign="middle" >Lophira lanceolata</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >Lophira lanceolata</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >MT385763</td></tr><tr><td align="center" valign="middle" >S6</td><td align="center" valign="middle" >Aframomum septrum</td><td align="center" valign="middle" >Aframomum angustifolium</td><td align="center" valign="middle" >99.09</td><td align="center" valign="middle" >Aframomum sp.</td><td align="center" valign="middle" >99.63</td><td align="center" valign="middle" >MT385764</td></tr><tr><td align="center" valign="middle" >S7</td><td align="center" valign="middle" >Afzelia Africana</td><td align="center" valign="middle" >Afzelia africana</td><td align="center" valign="middle" >99.81</td><td align="center" valign="middle" >Afzelia africana</td><td align="center" valign="middle" >99.81</td><td align="center" valign="middle" >MT385760</td></tr><tr><td align="center" valign="middle" >S8</td><td align="center" valign="middle" >Annona senegalensis</td><td align="center" valign="middle" >Annona senegalensis</td><td align="center" valign="middle" >99.47</td><td align="center" valign="middle" >Annona senegalensis</td><td align="center" valign="middle" >99.46</td><td align="center" valign="middle" >MT385759</td></tr><tr><td align="center" valign="middle" >S9</td><td align="center" valign="middle" >Annona muricate</td><td align="center" valign="middle" >Annona muricata</td><td align="center" valign="middle" >99.24</td><td align="center" valign="middle" >Annona muricata</td><td align="center" valign="middle" >99.81</td><td align="center" valign="middle" >MT385765</td></tr><tr><td align="center" valign="middle" >S10</td><td align="center" valign="middle" >Albizia zygia</td><td align="center" valign="middle" >Albizia chevalieri</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >Albizia lebbeck</td><td align="center" valign="middle" >98.67</td><td align="center" valign="middle" >MT385766</td></tr><tr><td align="center" valign="middle" >S11</td><td align="center" valign="middle" >Gongronema latifolium</td><td align="center" valign="middle" >Gongronema latifolium</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >Gongronema latifolium</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >MF162300</td></tr><tr><td align="center" valign="middle" >S12</td><td align="center" valign="middle" >Funtumia africana</td><td align="center" valign="middle" >Funtumia elastica</td><td align="center" valign="middle" >99.44</td><td align="center" valign="middle" >Funtumia elastica</td><td align="center" valign="middle" >99.63</td><td align="center" valign="middle" >MT385760</td></tr><tr><td align="center" valign="middle" >S13</td><td align="center" valign="middle" >Garcinia kola</td><td align="center" valign="middle" >Garcinia sp</td><td align="center" valign="middle" >99.5</td><td align="center" valign="middle" >Garcinia sp</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >MT385770</td></tr><tr><td align="center" valign="middle" >S14</td><td align="center" valign="middle" >Lophira alata</td><td align="center" valign="middle" >Lophira lanceolata</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >Lophira lanceolata</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >MT385756</td></tr><tr><td align="center" valign="middle" >S15</td><td align="center" valign="middle" >Khaya ivorensis</td><td align="center" valign="middle" >Khaya madagascariensis</td><td align="center" valign="middle" >99.53</td><td align="center" valign="middle" >Khaya nyasica</td><td align="center" valign="middle" >99.35</td><td align="center" valign="middle" >MT385766</td></tr><tr><td align="center" valign="middle" >S16</td><td align="center" valign="middle" >Diospyros piscatoria</td><td align="center" valign="middle" >Diospyros gabunensis</td><td align="center" valign="middle" >98.99</td><td align="center" valign="middle" >Diospyros gabunensis</td><td align="center" valign="middle" >98.99</td><td align="center" valign="middle" >MT385757</td></tr><tr><td align="center" valign="middle" >S17</td><td align="center" valign="middle" >Monodora tenuifolia</td><td align="center" valign="middle" >Monodora tenuifolia</td><td align="center" valign="middle" >99.82</td><td align="center" valign="middle" >Monodora tenuifolia</td><td align="center" valign="middle" >99.82</td><td align="center" valign="middle" >MT385768</td></tr><tr><td align="center" valign="middle" >S18</td><td align="center" valign="middle" >Momordica charantia</td><td align="center" valign="middle" >Momordica charantia</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >Momordica charantia</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >MT385772</td></tr><tr><td align="center" valign="middle" >S19</td><td align="center" valign="middle" >Entandrophragma angolense</td><td align="center" valign="middle" >Entandrophragma caudatum</td><td align="center" valign="middle" >99.83</td><td align="center" valign="middle" >Swietenia macrophylla</td><td align="center" valign="middle" >98.5</td><td align="center" valign="middle" >MT385769</td></tr></tbody></table></table-wrap></sec><sec id="s4"><title>4. Discussion</title><p>Although no single barcode region has been reported to be suitable for accurate discrimination of all plant taxa [<xref ref-type="bibr" rid="scirp.121312-ref37">37</xref>], the results of this study found the rbcL single barcode as an adequate estimation of species’ identification of most of the sampled tree plants. However, these findings would have to be tested with a much more extensive sample collection. According to Yu et al. [<xref ref-type="bibr" rid="scirp.121312-ref17">17</xref>], although there have been remarkable developments in standardized genetic markers, DNA barcode markers are merged with other biotechnologies, such as spectrum technologies, to achieve improved characterisation outcomes.</p><p>One of the complicating factors and limitations in applying DNA barcoding in the fight against the illegal trade of CITES-listed plants is that most of the products are trafficked in parts (like timber) or processed forms, such as traditional herbal medicines composed of more than one ingredient. Such products may contain multiple plant species that can only be analysed accurately if several DNA barcode templates can be sequenced concurrently. Concurrent sequencing is presently effectively achieved by next-generation sequencing (NGS) technology. Coghlan et al. [<xref ref-type="bibr" rid="scirp.121312-ref38">38</xref>] highlighted the effectiveness of metabarcoding in their study of the CITES-listed species contained in diverse traditional Chinese medicine (TCM) samples formulated in capsules, powders, herbal tea and tablets. Their study revealed that some of the TCM products contained CITES-listed species, including Saiga antelope (Saiga tatarica) and the Asian black bear (Ursus thibetanus), as well as some non-listed ingredients and potentially harmful and allergic plants [<xref ref-type="bibr" rid="scirp.121312-ref39">39</xref>].</p><p>In conclusion, this study documented the CITES-listed plants and other essential plants endangered or threatened plants in Nigeria. rbcL gene was employed as a single barcode region in the identification/authentication of some of Nigeria’s endangered forest species legislated under CITES. In addition, the study provided the first chloroplast DNA reference dataset to support the utilisation of DNA barcoding to identify CITES-listed plant species in Nigeria, which is significant for future studies.</p></sec><sec id="s5"><title>Acknowledgements</title><p>We thank the Consortium for Barcode of Life (CBOL) for supporting Nigeria’s Barcode of Wildlife Project; specifically, Dr David Schindel for effective coordination of the CITES project globally.</p></sec><sec id="s6"><title>Data Accessibility Statement</title><p>All data generated during this study are contained in this article. Raw sequence reads are deposited in NCBI GenBank with the following accession numbers; MT385762, MT385771, MT385758, MT385755, MT385763, MT385764, MT385760, MT385759, MT385765, MT385766, MF162300, MT385760, MT385770, MT385756, MT385766, MT385757, MT385768, MT385772, MT385769.</p></sec><sec id="s7"><title>Author Contributions</title><p>Christie Oby Onyia: Conceptualization and Principal investigator; Christie Oby Onyia and Obianuju Patience Ilo: Writing—original draft; Chosen Ekene Obih: Investigation and Data analysis; Omokafe Ugbogu and Emmanuel Chukwudi Chukwuma: Fieldwork and Curation; Beatrice Onyinye Ojiego and Paschaleen Soromtochukwu Onyemachi: Research design and methodology; Sunkanmi Saheed Rufai: Fieldwork. All authors read and approved the final manuscript.</p></sec><sec id="s8"><title>Conflicts of Interest</title><p>The authors declare no conflict of interest.</p></sec><sec id="s9"><title>Cite this paper</title><p>Onyia, C.O., Ilo, O.P., Obih, C.E., Ugbogu, O., Ojiego, B.O., Rufai, S.S., Onyemaechi, P.S. and Chukwuma, E.C. (2022) DNA Barcoding of Nigeria’s Forest Species Listed in CITES and Other Endangered Plant Species of National Interest. American Journal of Plant Sciences, 13, 1335-1346. https://doi.org/10.4236/ajps.2022.1311090</p></sec></body><back><ref-list><title>References</title><ref id="scirp.121312-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Govaerts, R. (2001) How Many Species of Seed Plants Are There? International Association for Plant Taxonomy (IAPT), 50, 1085-1090.  
https://doi.org/10.2307/1224723</mixed-citation></ref><ref id="scirp.121312-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Scotland, R.W. and Wortley, A.H. (2003) How Many Species of Seed Plants Are There? International Association for Plant Taxonomy (IAPT), 52, 101-104.  
https://doi.org/10.2307/3647306</mixed-citation></ref><ref id="scirp.121312-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Thorne, R.F. (2002) How Many Species of Seed Plants Are There. International Association for Plant Taxonomy (IAPT), 51, 511-512. https://doi.org/10.2307/1554864</mixed-citation></ref><ref id="scirp.121312-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Food and Agriculture Organization of the United Nations (2004) What Is Agrobiodiversity (Building on Gender, Agrobiodiversity and Local Knowledge, Issue).  
https://www.fao.org/3/y5609e/y5609e02.htm#TopOfPage</mixed-citation></ref><ref id="scirp.121312-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Royal Botanic Gardens Kew (2010) More than One-Fifth of World’s Plants Face Threat of Extinction, New Analysis Finds.  
https://www.sciencedaily.com/releases/2010/09/100928193452.htm</mixed-citation></ref><ref id="scirp.121312-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Onyia, C.O., Obih, C.E., Ilo, O.P., Ojiego, B.O., Iwu, V.C., Saidu, Y., Solomon, B.O., Amasiorah, V.I., Rowaiye, A.B. and Joshua, K.G. (2019) A New Approach to Protection and Conservation of Cites-Listed Species DNA Barcoding of Parrots in Nigeria. Journal of Biodiversity &amp; Endangered Species, 7, 1-4.</mixed-citation></ref><ref id="scirp.121312-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Sedghi, A. (2013) Red List 2013: Threatened Species across the Regions of the World. The Guardian.  
https://www.theguardian.com/news/datablog/2013/nov/26/iucn-red-list-threatened-species-by-country-statistics#data</mixed-citation></ref><ref id="scirp.121312-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Nigeria Federal Environmental Protection Agency (1991) Guidelines and Standards for Environmental Pollution Control in Nigeria. Federal Environmental Protection Agency (FEPA). https://books.google.co.za/books?id=fy8SAQAAIAAJ</mixed-citation></ref><ref id="scirp.121312-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Borokini, T.I. (2014) A Systematic Compilation of Endemic Flora in Nigeria for Conservation Management. Journal of Threatened Taxa, 6, 6406-6426.  
https://doi.org/10.11609/JoTT.o4010.6406-26</mixed-citation></ref><ref id="scirp.121312-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Federal Ministry of Environment (2015) National Biodiversity Strategy and Action Plan 2016-2020. https://www.cbd.int/doc/world/ng/ng-nbsap-v2-en.pdf</mixed-citation></ref><ref id="scirp.121312-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Convention on Biological Diversity (2007) Minutes of the Meeting of the Bureau of the Conference of the Parties to the Convention on Biological Diversity Held in Montreal on 14 October 2007.  
https://www.cbd.int/doc/meetings/cop-bureau/cop-bur-2007/cop-bur-2007-10-14-en.pdf</mixed-citation></ref><ref id="scirp.121312-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Mace, G.M. (2004) The Role of Taxonomy in Species Conservation. Philosophical Transactions of the Royal Society B: Biological Sciences, 359, 711-719.  
https://doi.org/10.1098/rstb.2003.1454</mixed-citation></ref><ref id="scirp.121312-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Wilson, E.O. (2017) Biodiversity Research Requires More Boots on the Ground. Nature Ecology &amp; Evolution, 1, 1590-1591.  
https://doi.org/10.1038/s41559-017-0360-y</mixed-citation></ref><ref id="scirp.121312-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Convention on the International Trade in Endangered Species of Wild Fauna and Flora (2015) The CITES Appendices. https://cites.org/eng/app/index.php</mixed-citation></ref><ref id="scirp.121312-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Barcode of Wildlife Project (2020) Enforcing Endangered Species Laws with DNA Barcodes. http://www.barcodeofwildlife.org</mixed-citation></ref><ref id="scirp.121312-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Kress, W.J. (2017) Plant DNA Barcodes: Applications Today and in the Future. Journal of Systematics and Evolution, 55, 291-307. https://doi.org/10.1111/jse.12254</mixed-citation></ref><ref id="scirp.121312-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Yu, J., Wu, X., Liu, C., Newmaster, S., Ragupathy, S. and Kress, W.J. (2021) Progress in the Use of DNA Barcodes in the Identification and Classification of Medicinal Plants. Ecotoxicology and Environmental Safety, 208, Article ID: 111691.  
https://doi.org/10.1016/j.ecoenv.2020.111691</mixed-citation></ref><ref id="scirp.121312-ref18"><label>18</label><mixed-citation publication-type="book" xlink:type="simple">de Vere, N., Rich, T.C.G., Trinder, S.A. and Long, C. (2015) DNA Barcoding for Plants. In: Batley, J., Ed., Plant Genotyping: Methods and Protocols, Springer, New York, 101-118. https://doi.org/10.1007/978-1-4939-1966-6_8</mixed-citation></ref><ref id="scirp.121312-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Pathak, M.R., Mohamed, A.A.M. and Farooq, M. (2018) DNA Barcoding and Identification of Medicinal Plants in the Kingdom of Bahrain. American Journal of Plant Sciences, 9, 2757-2774. https://doi.org/10.4236/ajps.2018.913200</mixed-citation></ref><ref id="scirp.121312-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Lv, Y.-N., Yang, C.-Y., Shi, L.-C., Zhang, Z.-L., Xu, A.-S., Zhang, L.-X., Li, X.-L. and Li, H.-T. (2020) Identification of Medicinal Plants within the Apocynaceae Family Using ITS2 and psbA-trnH Barcodes. Chinese Journal of Natural Medicines, 18, 594-605. https://doi.org/10.1016/S1875-5364(20)30071-6</mixed-citation></ref><ref id="scirp.121312-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Onyia, C.O., Jideofor, O.P., Ojiego, B.O., Solomon, B.O., Ogundipe, O.T. and Ogbadu, L.J. (2014) Current Developments in the Application of DNA Barcoding to Solving Biodiversity Conservation Problems in Developing Countries. Global Journal of Biology, Agriculture &amp; Health Sciences, 3, 285-288.</mixed-citation></ref><ref id="scirp.121312-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Habib, K.A., Neogi, A.K., Rahman, M., Oh, J., Lee, Y.H. and Kim, C.G. (2021) DNA Barcoding of Brackish and Marine Water Fishes and Shellfishes of Sundarbans, the World’s Largest Mangrove Ecosystem. PLOS ONE, 16, e0255110.  
https://doi.org/10.1371/journal.pone.0255110</mixed-citation></ref><ref id="scirp.121312-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Jones, L., Twyford, A.D., Ford, C.R., Rich, T.C.G., Davies, H., Forrest, L.L., Hart, M.L., McHaffie, H., Brown, M.R., Hollingsworth, P.M. and Vere, N. (2021) Barcode UK: A Complete DNA Barcoding Resource for the Flowering Plants and Conifers of the United Kingdom. Molecular Ecology Resources, 21, 2050-2062.  
https://doi.org/10.1111/1755-0998.13388</mixed-citation></ref><ref id="scirp.121312-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Jamdade, R., Mosa, K.A., El-Keblawy, A., Al Shaer, K., Al Harthi, E., Al Sallani, M., Al Jasmi, M., Gairola, S., Shabana, H. and Mahmoud, T. (2022) DNA Barcodes for Accurate Identification of Selected Medicinal Plants (Caryophyllales): Toward Barcoding Flowering Plants of the United Arab Emirates. Diversity, 14, 262.  
https://doi.org/10.3390/d14040262</mixed-citation></ref><ref id="scirp.121312-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Lone, S.A., Hassan, Q.P. and Gupta, S. (2019) Development of DNA Barcode for Rapid Identification of Epimedium elatum (Morren &amp; Decne) from Northwestern Himalayas in India. Journal of Applied Research on Medicinal and Aromatic Plants, 13, Article ID: 100205. https://doi.org/10.1016/j.jarmap.2019.100205</mixed-citation></ref><ref id="scirp.121312-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Negi, R.K., Nautiyal, P., Bhatia, R. and Verma, R. (2021) rbcL, a Potential Candidate DNA Barcode Loci for Aconites: Conservation of Himalayan Aconites. Molecular Biology Reports, 48, 6769-6777. https://doi.org/10.1007/s11033-021-06675-5</mixed-citation></ref><ref id="scirp.121312-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Ho, V.T., Tran, T.K.P., Vu, T.T.T. and Widiarsih, S. (2021) Comparison of matK and rbcL DNA Barcodes for Genetic Classification of Jewel Orchid Accessions in Vietnam. Journal of Genetic Engineering and Biotechnology, 19, Article No. 93.  
https://doi.org/10.1186/s43141-021-00188-1</mixed-citation></ref><ref id="scirp.121312-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Levin, R.A., Wagner, W.L., Hoch, P.C., Nepokroeff, M., Pires, J.C., Zimmer, E.A. and Sytsma, K.J. (2003) Family-Level Relationships of Onagraceae Based on Chloroplast rbcL and ndhF Data. American Journal of Botany, 90, 107-115.  
https://doi.org/10.3732/ajb.90.1.107</mixed-citation></ref><ref id="scirp.121312-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Soltis, P.S., Soltis, D.E. and Smiley, C.J. (1992) An rbcL Sequence from a Miocene Taxodium (Bald Cypress). Proceedings of the National Academy of Sciences of the United States of America, 89, 449-451. https://doi.org/10.1073/pnas.89.1.449</mixed-citation></ref><ref id="scirp.121312-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Kress, W.J. and Erickson, D.L. (2007) A Two-Locus Global DNA Barcode for Land Plants: The Coding rbcL Gene Complements the Non-Coding trnH-psbA Spacer Region. PLOS ONE, 2, e508. https://doi.org/10.1371/journal.pone.0000508</mixed-citation></ref><ref id="scirp.121312-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Fofana, B., Harvengt, L., Baudoin, J.P. and Du Jardin, P. (1997) New Primers for the Polymerase Chain Amplification of cpDNA Intergenic Spacers in Phaseolus Phylogeny. Belgian Journal of Botany, 129, 118-122. http://www.jstor.org/stable/20794388</mixed-citation></ref><ref id="scirp.121312-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Goff, S.A., Vaughn, M., McKay, S., Lyons, E., Stapleton, A.E., Gessler, D., Matasci, N., Wang, L., Hanlon, M., Lenards, A., Muir, A., Merchant, N., Lowry, S., Mock, S., Helmke, M., Kubach, A., Narro, M., Hopkins, N., Micklos, D., Stanzione, D., et al. (2011) The iPlant Collaborative: Cyberinfrastructure for Plant Biology. Frontiers in Plant Science, 2, Article No. 34. https://doi.org/10.3389/fpls.2011.00034</mixed-citation></ref><ref id="scirp.121312-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Merchant, N., Lyons, E., Goff, S., Vaughn, M., Ware, D., Micklos, D. and Antin, P. (2016) The iPlant Collaborative: Cyberinfrastructure for Enabling Data to Discovery for the Life Sciences. PLOS Biology, 14, e1002342.  
https://doi.org/10.1371/journal.pbio.1002342</mixed-citation></ref><ref id="scirp.121312-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) Basic Local Alignment Search Tool. Journal of Molecular Biology, 215, 403-410.  
https://doi.org/10.1016/S0022-2836(05)80360-2</mixed-citation></ref><ref id="scirp.121312-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Ratnasingham, S. and Hebert, P.D. (2007) Bold: The Barcode of Life Data System. Molecular Ecology Notes, 7, 355-364.  
https://doi.org/10.1111/j.1471-8286.2007.01678.x</mixed-citation></ref><ref id="scirp.121312-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Jensen-Vargas, E. and Marizzi, C. (2018) DNA Barcoding for Identification of Consumer-Relevant Fungi Sold in New York: A Powerful Tool for Citizen Scientists? Foods, 7, Article No. 87. https://doi.org/10.3390/foods7060087</mixed-citation></ref><ref id="scirp.121312-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Ballardini, M., Mercuri, A., Littardi, C., Abbas, S., Couderc, M., Ludena, B. and Pintaud, J.C. (2013) The Chloroplast DNA Locus psbZ-trnfM as a Potential Barcode Marker in Phoenix L. (Arecaceae). Zookeys, 365, 71-82.  
https://doi.org/10.3897/zookeys.365.5725</mixed-citation></ref><ref id="scirp.121312-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Coghlan, M.L., Haile, J., Houston, J., Murray, D.C., White, N.E., Moolhuijzen, P., Bellgard, M.I. and Bunce, M. (2012) Deep Sequencing of Plant and Animal DNA Contained within Traditional Chinese Medicines Reveals Legality Issues and Health Safety Concerns. PLOS Genetics, 8, e1002657.  
https://doi.org/10.1371/journal.pgen.1002657</mixed-citation></ref><ref id="scirp.121312-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Staats, M., Arulandhu, A.J., Gravendeel, B., Holst-Jensen, A., Scholtens, I., Peelen, T., Prins, T.W. and Kok, E. (2016) Advances in DNA Metabarcoding for Food and Wildlife Forensic Species Identification. Analytical and Bioanalytical Chemistry, 408, 4615-4630. https://doi.org/10.1007/s00216-016-9595-8</mixed-citation></ref></ref-list></back></article>