An experiment was conducted by Richard A.Hutchn to test if there is a deviation at Planck’s constant numbers. As a result of this experiment, it was revealed that Planck constant numbers can change depending on some variables [1].

Before this article; Kevser Köklü researched the relationship between the velocity of light numbers and genetic codes [2]. With respect to Quantum Perspective Model [2], besides this article, the relation with Pi numbers [3] and nucleotide bases were explained by Kevser Köklü and Tahir Ölmez [4]. At the same time; the link between the irrational numbers and genetic codes was researched by Tahir Ölmez. These irrational numbers are golden ratio numbers [5], Euler numbers [6], square root of 2 [7], square root of 3 [8], square root of 5 [9], square root of 7 [10] and square root of 10 [11]. In sum, according to Quantum Perspective Model, the expression of irrational numbers as genetic codes can be found in the summary table. Also, the velocity of light numbers was sequenced not only as ACU [ADENINE(A), CYTOSINE(C) and URACIL(U) ]in binary number base system, but also were sequenced as UUATACCTC/UUAUACCTC [Adenine (A), Thymine (T) Guanine (G), Cytosine (C) and Uracil] by Kevser Köklü [3]. Finally, Planck’s constant numbers after comma can be sequenced as both Adenine (A) and Thymine (T).

This article attempts to shed lights on the relationship between Planck’s constant numbers and chemical formulas and acid-base ratio and bony fishes.

In this research, this paper aims to search relations between Planck’s constant numbers and binary number base system and chemical formulas of nucleotide bases.

The chemical structures of nucleotide bases consist of Carbon(C), Nitrogen (N), Oxygen (O) and Hydrogen (H) (Wieser E M et al., 2013) [12]. For the representation of nucleotide bases (A, T, C, G and U) in chemical atoms; Please, see Table 1.

Planck’s constant numbers (h): 6.6260755 *10⁻³⁴ J.s. [13].

Planck’s constant numbers (h): 0.66260755 * 10⁻³⁵ J.s.

First of all, please take the Planck’s constant numbers after comma (0.66260755) as triplets, just like as triplet genetic codes (662-607-55). Secondly, convert these decimal numbers to binary number base. For example; 662: 1010011011, 607: 1001011111 and 55: 110111. Thirdly, after writing this binary

numbers one by one, convert this binary numbers to decimal numbers again partially. For example, 662: 1010011011, 607: 1001011111 and (55: 110 111 OR 55: 1 101 11). Fourthly, add the partial decimal numbers respectively just like this. Please, see Table 2.

“662”; 10 = 2 and 100 = 4 and 11011 = 27 Totally: 2 + 4 + 27 = 33.

“607”; 100 = 4 and 101 = 5 and 1111 = 15 Totally: 4 + 5 + 15 = 24.

“55”; 110 = 6 and 111 = 7 Totally: 6 + 7 = 13 OR “55”; 1 = 1 and 101 = 5 and 11 = 3 Totally: 1 + 5 + 3 = 9.

Fifthly, add the total results of this numbers respectively (33 + 24 + 13 = 70 OR 33 + 24 + 9 = 66). Finally, see Table 1 for the equivalents of these numbers. Namely, [Adenine (A): 70 and Thymine (T): 66].

In sum, after this research method with respect to Quantum Perspective Model, some remarkable consequences were reached by this article. This result will be put forth in next pages.

According to Quantum Perspective Model, before this article, the relationship between Fibonacci sequence and genetic codes were studied by T. Negadi [14]. Besides this article, also the relationship between Fibonacci sequence and Euler’s numbers were published by Tahir ÖLMEZ [15]. (Remember; Fibonacci sequence: 1, 1, 2, 3, 5, 8, 13, 21, 34 and 55…etc) [15]. If the number “55” is searched in the Fibonacci sequence, you can also see it in the fractions of Planck constants (6.6260755 × 10⁻³⁴). Let alone this previous similarity of the number “55”, the unchanged ratio of the golden mean numbers can be seen by dividing the numbers “55” and “34” (Remember; 55/34: 1,618) [5]. Interestingly, after looking for the number “55” at the Fibonacci sequence, the position of this number is also tenth just like as decimal (10) number base system.

A question might be asked, “Why are Planck Numbers taken as “triples”? As an answer to this question: The Universal Genetic Code Table consists of triple nucleotide bases [16] In addition, the common feature of “Adenine” and other nucleotide bases in general is that they have at least three atoms [Carbon(C), Nitrogen (N) and Hydrogen (H)] [12]. Not only the total atomic weights of these are fourteen, but also the maximum value number of acid base ratio equals fourteen, too (ph = 14) (Please, see Table 1). But the total atomic weight of “Thymine” base atoms is twenty-two. It is nearly about to ratio of Pi numbers (22/7).

According to Quantum Perspective Model, the Planck’s constant numbers after comma (0.66260755) can be converted from decimal number base system to binary number base system and vice versa. At first, the outcome of this numbers are “70” and “66”.One of the total number of “70” equals to “Adenine (A)” nucleotide base and also the other one equals to “Thymine (T)” nucleotide base (Please, See Table 1). Secondly, while calculating Planck’s constant numbers, in the transition from Decimal (10) to Binary (2) Number Based System, according to the Universal Genetic Code Table, codons were taken as triple nucleotide base codes and numbers were taken as triples. Fourthly, although “Adenine (A)” nucleotide base also consists of three atoms [Atomic weights (Carbon (C):6, Nitrogen (N):7 and Hydrogen (H):1] but “Thymine (T)” nucleotide base also consists of Oxygen (O) too. Lastly, the total basic atomic weights of “Adenine (A)” nucleotide base [(C):6+ (N):7 +(H)1:14] also equals “14” to the maximum value number of acid base ratio (ph = 14) (Please, see Table 1). Interestingly, the total basic atomic weights of “Thymine (T)” nucleotide base [(C):6+ (N):7 +(H)1+ (O)8:22] is also approximately similar to pi numbers ratio “22/7”! Besides, Let alone previous results, according to Quantum Perspective Model, also the expression of Pi numbers consists of both “Adenine (A)” and “Thymine (T)” nucleotide bases as well. [3] (Remember; Pi numbers (as a 22/7): UTA [Uracil (U), Thymine (T), Adenine (A)] [14], also (see, Table 3). [Remember; Pi numbers (as an extended form): TCGATTATACTGGTTGGTTGTTAACGGTAC] [4].

At first, this article attempts to shed lights on the relationships between some fundamental constants just like as Planck’s constant numbers and chemical atomic masses of genetic codes. Secondly, the representation of nucleotide bases (A, T, C, G and U) [18] in chemical atoms was calculated by Kevser Köklü and Tahir ÖLMEZ (See, Table 1). These calculations were attributed to Quantum Perspective Model by Kevser Köklü and Tahir ÖLMEZ. Thirdly, before this article, the relationships between velocity of light numbers and genetic codes were studied by Kevser Köklü [2]. Fourthly, the relationships between some irrational numbers and genetic codes were studied by Tahir ÖLMEZ (See, Table 3). Fifthly, after this previous research, the relation between Planck’s constant numbers and

nucleotide bases of genetic codes were defined apparently with these results. One of these result signs that Planck’s constant numbers can be expressed as Adenine (A) and Thymine (T) nucleotide bases. The other consequence of this result is the approximately average of five nucleotide bases (A, T, C, G and U) is “67.2” (See Table 1). The calculation of this average is here. (Totally A: 70+ T: 66+ C: 58+ G: 78+ U:64 = 336 and the average 336/5:67.2). Sixthly, a question can be asked just like as “Why the consequence of Planck’s Numbers are “twin”? As an answer to this question: The twin results of Planck Numbers at first can be interpreted as a meaning of “Quantum Superposition”. Because, superposition can be thought of as an equation with more than one solution. Based on this Quantum basis, an electron can be said to be in two places at once [19]. Namely, unlike a classical bit, a qubit can be in a superposition both in the “0” state and in the “1” state [20]. Another dazzling information is the function of transistors based on Silicon and Phosphorus atoms (Remember: Respectively, the atomic weight of Silicon is 14 and the atomic weight of Phosphorus is also 15 at the periodic table of elements) [12]. Another explanation of twin result can be “A-T” twin base “pairs”. Because of Adenine (A) and Thymine (T) base pair has two hydrogen bonds [21]. Seventhly, in respect of acid base ratio, the acid base ratio of blood and pure water is seven (ph = 7). The task of hemoglobin in the blood is to carry oxygen from the respiratory organs to the rest of the body [22]. The low pH, which is the unit of measure that reduces the affinity of hemoglobin and describes the degree of acidity or alkalinity of a solution, is called “ROOT EFFECT” and is seen only in the hemoglobin of fish [23]. Interestingly, the NCBI (The National Center for Biotechnology Information) results of irrational numbers and genetic codes are also “bony fish” (especially Danio Rerio) too [11].

Finally, it has been revealed that Planck’s constant numbers have a double striking result as [(Adenine (A) and Thymine (T)] in expressing genetic codes as chemical atomic masses. According to Quantum Perspective Model, data from this twin result can be meaning of Quantum superposition. In summary, can this article be a sign of a new discovery of the relations between sciences, especially in explaining the foundations of Quantum Physics?

The author declares no conflicts of interest.

Ölmez, T. (2022) Is There Any Meaning of Planck’s Constant Numbers as Regards to Quantum Superposition via the Chemical Atomic Masses of Nucleotide Bases? Open Access Library Journal, 9: e9482. https://doi.org/10.4236/oalib.1109482