<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2022.139084</article-id><article-id pub-id-type="publisher-id">AJPS-119928</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Identification of Large Deletion of &lt;i&gt;Ccs&lt;/i&gt; Responsible for Non-Red Fruit Color in Pepper (&lt;i&gt;Capsicum annuum&lt;/i&gt;) and Development of DNA Marker to Distinguish the Deletion
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shiho</surname><given-names>Omori</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tsuneo</surname><given-names>Sasanuma</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Laboratory of Plant Genetics and Breeding, Faculty of Agriculture, Yamagata University, Tsuruoka, Japan</addr-line></aff><pub-date pub-type="epub"><day>07</day><month>09</month><year>2022</year></pub-date><volume>13</volume><issue>09</issue><fpage>1233</fpage><lpage>1246</lpage><history><date date-type="received"><day>12,</day>	<month>August</month>	<year>2022</year></date><date date-type="rev-recd"><day>18,</day>	<month>September</month>	<year>2022</year>	</date><date date-type="accepted"><day>21,</day>	<month>September</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Chili pepper (
  Capsicum spp.) fruit color is an important agronomical trait. It has been known that a large deletion in the 5' upstream region of the 
  Ccs gene generates non-red fruit color in pepper, but the accurate size and position of the deletion and whether all the non-red cultivars had the same large deletion or not were unclarified. In this study, to identify the 
  Ccs upstream large deletion, we carried out diagnostic PCR using six forward primers at 300 - 900 bp intervals in the 5' untranslated region of 
  Ccs with a fixed reverse primer for a yellow fruit pepper “Sonia Gold”. Then it was revealed that 4430 bp from -3234 bp position in upstream region to 1196 bp position in exon was deleted in 
  Ccs of “Sonia Gold”. The allele having this dele
  tion was named ccs-del. Probably this allele is substantially the same a
  s ccs-p1 having 4879 bp deletion reported previously. Based on the sequence determined, we developed a PCR marker to distinguish ccs-del. Genotyping of 16 cultivars of C. annuum showed that 14 had ccs-del and the remaining two had another mutant allele ccs-3. This result indicates that ccs-del is the m
  ost common allele and widely shared in non-red fruit cultivars in C. annuum. Genotyping of 16 cultivars of C. chinense clarified that one cultivar each possessed ccs-del and ccs-3. These results indicate that major alleles responsible for non-red fruit color in C. annuum were shared across species throughout interspecific introgression.
 
</p></abstract><kwd-group><kwd>Non-Red Fruit Pepper</kwd><kwd> &lt;i&gt;Ccs&lt;/i&gt;</kwd><kwd> Identification of Large Deletion</kwd><kwd> &lt;i&gt;ccs-3&lt;/i&gt;</kwd><kwd> Development of DNA Marker</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Chili pepper (Capsicum spp.) is a major crop cultivated all over the world used as vegetable and spice. The various and vibrant fruit color of pepper such as red, orange and yellow is an important agronomical trait that arises consumer willingness to buy and makes our tables colorful. Furthermore, some pigments have positive effect to our health such as providing antioxidant activity and acting as dietary precursor of vitamin A [<xref ref-type="bibr" rid="scirp.119928-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref2">2</xref>].</p><p>The fruit color of pepper is determined by types and amounts of carotenoids. Carotenoids are natural pigment classified into tetraterpene, existing in almost all organisms living in an environment under sunlight and oxygen conditions. Carotenoids are synthesized in the biosynthesis pathway that starts from isopentenyl pyrophosphate (IPP) and undergoes via various enzymatic reactions [<xref ref-type="bibr" rid="scirp.119928-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref7">7</xref>]. The final products of the pathway are capsanthin and capsorubin that are red pigments making color of pepper mature fruit red [<xref ref-type="bibr" rid="scirp.119928-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref9">9</xref>]. Previous studies reported that non-red pepper fruit color such as orange and yellow are generated by mutations in Psy or Ccs genes involved in the carotenoid synthesis pathway. The Psy gene encodes phytoene synthase that catalyzes geranylgeranyl pyrophosphate into phytoene [<xref ref-type="bibr" rid="scirp.119928-ref7">7</xref>]. The Ccs gene encodes capsanthin- capsorubin synthase that acts in the final step of the pathway, catalyzing antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively [<xref ref-type="bibr" rid="scirp.119928-ref7">7</xref>]. As for the major cultivated pepper species C. annuum L., mutation in the Ccs gene mainly caused non-red fruit color. The Ccs gene is 1497 bp in length of coding region consisting of single exon [<xref ref-type="bibr" rid="scirp.119928-ref10">10</xref>]. Several studies reported that a large deletion located in the upstream region of the Ccs gene was responsible for the non- red fruit color [<xref ref-type="bibr" rid="scirp.119928-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref13">13</xref>]. Popovsky and Paran (2000) performed PCR to amplify entire region of the Ccs gene and reported that no amplification was detected in yellow fruit cultivar [<xref ref-type="bibr" rid="scirp.119928-ref12">12</xref>]. Lang et al. (2004) carried out Southern hybridization for the Ccs gene using red and orange fruit cultivars and indicated conservation of downstream of the coding region and lack of upstream of the coding and 5' flanking regions of the Ccs gene in orange fruit cultivar [<xref ref-type="bibr" rid="scirp.119928-ref13">13</xref>]. These results suggested that at least 1 kb large deletion involving both the promoter and upstream of coding region has occurred in the Ccs gene of non-red fruit color pepper. Although it was roughly understood that the deletion was more than 1 kb and located on the upstream region of the Ccs gene, the accurate length and position of the deletion, namely, how long and from where to where at single nucleotide level, have not been clarified because of its largeness. Furthermore, it has been unknown whether all non-red fruit color in the different cultivars is caused by the identical deletion. In fact, two Ccs alleles, ccs-p1 and ccs-p2, having different size large deletion in promoter region have been reported in Capsicum [<xref ref-type="bibr" rid="scirp.119928-ref14">14</xref>]. Regarding the Psy gene, several mutant alleles causing non-red fruit color have been found in the second major pepper species C. chinense Jacq [<xref ref-type="bibr" rid="scirp.119928-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref16">16</xref>].</p><p>Along with the progress of genomics, the entire genomic sequence of Capsicum annuum L. has been published [<xref ref-type="bibr" rid="scirp.119928-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref18">18</xref>]. Genomics has innovatively progressed investigation of crop important genes, therefore genes controlling useful biological characters have been identified in many crops, for example, major domestication gene tb1 in maize, semidwarf gene sd1 in rice and spike morphology determinative gene Q in wheat [<xref ref-type="bibr" rid="scirp.119928-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref21">21</xref>]. Also as for pepper, QTLs responsible for fruit size were identified using the entire genome sequence [<xref ref-type="bibr" rid="scirp.119928-ref22">22</xref>]. The information of entire genome sequence enables us to approach the detail of the large deletion. In this study, we tried to identify the accurate size and position of the large deletion of the Ccs gene in a non-red fruit pepper and develop a marker to distinguish the deletion. Then using the developed marker, the Ccs gene of non-red pepper genetic resources were genotyped and the identity of the cause of non-red fruit color in pepper was discussed.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Plant Materials</title><p>A commercial cultivar C. annuum cv. “Sonia Gold” was used as non-red fruit color pepper cultivar. “Sonia Gold” is a bell (blocky) type sweet pepper with yellow fruit color that is commonly cultivated as vegetable (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). As a comparison, a corn type red fruit hot pepper C. annuum cv. “Takanotsume” that is a traditional cultivar used as spice in Japan was used (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). As for genotyping, each of the 16 cultivars of C. annuum and C. chinense were used (<xref ref-type="table" rid="table1">Table 1</xref>). The total DNA was extracted from leaves of each of the accessions with CTAB method [<xref ref-type="bibr" rid="scirp.119928-ref23">23</xref>].</p></sec><sec id="s2_2"><title>2.2. Diagnostic PCR</title><p>Based on the genome sequence of C. annuum, six forward primers (Ccs5up_F-762, F-1671, F-2393, F-2745, F-3080, F-3784) were designed at 300 - 900 bp intervals in the 5' untranslated region of the Ccs gene. The numbers following F- in the primer names indicates the upstream position when the first nucleotide of the exon is defined as 1. Using the six forward primers with a fixed reverse primer Ccs_R+1494, diagnostic PCR was carried out using Tks Gflex DNA polymerase (Takara Bio) in 20 μL reaction volume with 40 ng genomic DNA as template. The condition of PCR amplification was 1 cycle at 94˚C for 1 min, 30 cycles at</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Non-red fruit color pepper used for genotyping</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >No.</th><th align="center" valign="middle" >Cultivar name</th><th align="center" valign="middle" >Source</th><th align="center" valign="middle" >Mature fruit color</th></tr></thead><tr><td align="center" valign="middle" >C. annuum</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Sweet Palermo Golden</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >Mild na Aji no Paprika Yellow</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >California Wonder Golden 2019</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >Sonia Gold</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >Cayenne Pepper Golden</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" >Se&#241;orita Golden</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" >Se&#241;orita Orange</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Orange</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" >14C23-1</td><td align="center" valign="middle" >Our laboratory<sup>a</sup></td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >9</td><td align="center" valign="middle" >14C23-2</td><td align="center" valign="middle" >Our laboratory</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" >msGTY-1</td><td align="center" valign="middle" >TOKITA Seed Co.</td><td align="center" valign="middle" >Orange</td></tr><tr><td align="center" valign="middle" >11</td><td align="center" valign="middle" >Wonder Bell (Yellow)</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >12</td><td align="center" valign="middle" >California Wonder Golden</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >13</td><td align="center" valign="middle" >California Wonder Orange</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Orange</td></tr><tr><td align="center" valign="middle" >14</td><td align="center" valign="middle" >Color Piment Yellow</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >15</td><td align="center" valign="middle" >Color Piment Orange</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Orange</td></tr><tr><td align="center" valign="middle" >16</td><td align="center" valign="middle" >Kiiro Togarashi</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >C. chinense</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Habanero Orange</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Orange</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >Habanero Swarp Orange</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Orange</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >Grif 9325</td><td align="center" valign="middle" >USDA</td><td align="center" valign="middle" >Orange</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >PI 281444</td><td align="center" valign="middle" >USDA</td><td align="center" valign="middle" >Orange</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >PI 438614</td><td align="center" valign="middle" >USDA</td><td align="center" valign="middle" >Orange</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" >PI 438645</td><td align="center" valign="middle" >USDA</td><td align="center" valign="middle" >Orange</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" >Habanero Lemon</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" >Yellow Buht Jolokia</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >9</td><td align="center" valign="middle" >Scotch Bonnet Yellow</td><td align="center" valign="middle" >Market</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" >PI 224448</td><td align="center" valign="middle" >USDA</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >11</td><td align="center" valign="middle" >PI 315019</td><td align="center" valign="middle" >USDA</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >12</td><td align="center" valign="middle" >PI 390611</td><td align="center" valign="middle" >USDA</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >13</td><td align="center" valign="middle" >PI 485593</td><td align="center" valign="middle" >USDA</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >14</td><td align="center" valign="middle" >PI 670898</td><td align="center" valign="middle" >USDA</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >15</td><td align="center" valign="middle" >CGN 17023</td><td align="center" valign="middle" >CGR the Netherland</td><td align="center" valign="middle" >Yellow</td></tr><tr><td align="center" valign="middle" >16</td><td align="center" valign="middle" >CGN 22854</td><td align="center" valign="middle" >CGR the Netherland</td><td align="center" valign="middle" >Yellow</td></tr></tbody></table></table-wrap><p><sup>a</sup>The materials segregated from commercial variety and maintained in our laboratory.</p><p>94˚C for 30 sec, 60˚C for 30 sec and 72˚C for 5 min, followed by a final extension at 72˚C for 3 min. Amplification was checked by electrophoresis in 1% agarose gel with 1 &#215; TAE buffer. The primers used were listed in <xref ref-type="table" rid="table2">Table 2</xref>.</p></sec><sec id="s2_3"><title>2.3. Genotyping of the Ccs Gene Using Developed PCR Marker</title><p>Using the normal allele specific and the large deletion specific forward primers (Ccs5del F1 and Ccs5del F2, respectively) with a fixed reverse primer (Ccs5del R) developed in this study, multiplex PCR was conducted for each of the 16 cultivars of C. annuum and C. chinense. PCR condition was the same as diagnostic PCR described above, except that the extension time was changed to 30 sec.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Primer list used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Name</th><th align="center" valign="middle" >Sequence (5' → 3' )</th><th align="center" valign="middle" >Purpose</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle" >Ccs5up_F-762</td><td align="center" valign="middle" >AGGAATACTACAAGGCCTCCA</td><td align="center" valign="middle" >diagnostic PCR</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ccs5up_F-1671</td><td align="center" valign="middle" >GATGAAAATTTGGGCTCCGC</td><td align="center" valign="middle" >diagnostic PCR</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ccs5up_F-2393</td><td align="center" valign="middle" >TGAAACTGAATAAGCTGCGACT</td><td align="center" valign="middle" >diagnostic PCR</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ccs5up_F-2745</td><td align="center" valign="middle" >ACTAATACAGCTGCCGTCCA</td><td align="center" valign="middle" >diagnostic PCR</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ccs5up_F-3080</td><td align="center" valign="middle" >GCCGCCCATTCTTTCTAGTC</td><td align="center" valign="middle" >diagnostic PCR</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ccs5up_F-3784</td><td align="center" valign="middle" >ACGGCAACTCAACACAAGTG</td><td align="center" valign="middle" >diagnostic PCR</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ccs R+1494 (CCS-d<sup>a</sup>)</td><td align="center" valign="middle" >AAGGCTCTCTATTGCTAGATTGCCCAG</td><td align="center" valign="middle" >diagnostic PCR and RT-PCR</td><td align="center" valign="middle" >Lang et al. (2004) [<xref ref-type="bibr" rid="scirp.119928-ref13">13</xref>]</td></tr><tr><td align="center" valign="middle" >Ccs5del F1</td><td align="center" valign="middle" >TGAGAAGTGTCCTTGAGGAAGA</td><td align="center" valign="middle" >multiplex PCR to distinguish the large deletion</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ccs5del F2</td><td align="center" valign="middle" >TCTGGTGCTTTTAGAGTTTGGA</td><td align="center" valign="middle" >multiplex PCR to distinguish the large deletion</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ccs5del R</td><td align="center" valign="middle" >TTTAACCAAGGGGACAGTGC</td><td align="center" valign="middle" >multiplex PCR to distinguish the large deletion</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ccs F+174</td><td align="center" valign="middle" >ACCCACATCAAAGCCAGAGT</td><td align="center" valign="middle" >RT-PCR</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ccs R+352 (CCS-534<sup>a</sup>)</td><td align="center" valign="middle" >ACATGGAAAGTAGTAAAGG</td><td align="center" valign="middle" >RT-PCR</td><td align="center" valign="middle" >Lang et al. (2004) [<xref ref-type="bibr" rid="scirp.119928-ref13">13</xref>]</td></tr><tr><td align="center" valign="middle" >Ccs F+1284 (CCS-1484<sup>a</sup>)</td><td align="center" valign="middle" >GGAAGGTACTAGGAGATTGTT</td><td align="center" valign="middle" >RT-PCR</td><td align="center" valign="middle" >Lang et al. (2004) [<xref ref-type="bibr" rid="scirp.119928-ref13">13</xref>]</td></tr><tr><td align="center" valign="middle" >ccs3dCAPS F</td><td align="center" valign="middle" >GTACTGGCTGAGGCCATCGT</td><td align="center" valign="middle" >dCAPS for ccs-3</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ccs3dCAPS R<sup>b</sup></td><td align="center" valign="middle" >AAACAATCTCCTAGTACCTTCCAAATCAAGCTTCAACAGA</td><td align="center" valign="middle" >dCAPS for ccs-3</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ubiqitin-F</td><td align="center" valign="middle" >TGTGTCTCAACATTCTTCGTGA</td><td align="center" valign="middle" >RT-PCR</td><td align="center" valign="middle" >Stellari et al. (2010) [<xref ref-type="bibr" rid="scirp.119928-ref27">27</xref>]</td></tr><tr><td align="center" valign="middle" >ubiqitin-R</td><td align="center" valign="middle" >ATACAGCAGCTGCGTCGT</td><td align="center" valign="middle" >RT-PCR</td><td align="center" valign="middle" >Stellari et al. (2010) [<xref ref-type="bibr" rid="scirp.119928-ref27">27</xref>]</td></tr></tbody></table></table-wrap><p><sup>a</sup>Names in the parenthesis are used in Lang et al. (2004) [<xref ref-type="bibr" rid="scirp.119928-ref13">13</xref>]. <sup>b</sup>The artificial mismatch site to create restriction site is shown in bold and underlined.</p><p>To distinguish ccs-3 that is another mutated allele of Ccs rediscovered in this study, a dCAPS marker was developed. At first the region including single base indel polymorphic site at the 3' end was amplified by PCR using primers ccs3dCAPS F and R developed in this study. Reverse primer contains an artificial SNP changing A to G at the second nucleotide position from 3' end to create a recognition site of restriction enzyme NdeII (GATC). PCR was conducted in 20 μL volume with 40 ng template DNA. The condition of PCR amplification was 1 cycle at 94˚C for 1 min, 30 cycles at 94˚C for 30 sec, 60˚C for 30 sec and 72˚C for 20 sec, followed by a final extension at 72˚C for 3 min. Takara Taq (Takara Bio) that does not possess 3' to 5' exonuclease activity was used as DNA polymerase. Restriction enzyme reaction was carried out using 3 μL PCR product and 30 units of NdeII in 20 μL volume. The mixture was incubated at 37 ˚C overnight. The expected band size of the PCR product is 180 bp for wild type and 179 bp for ccs-3. It is expected that wild type is not digested with NdeII but ccs-3 is digested to produce a 40 bp shorter band. Electrophoresis was performed using 3% agarose gel with 1 &#215; TBE buffer.</p></sec><sec id="s2_4"><title>2.4. RT-PCR</title><p>To investigate the expression of ccs-3, RT-PCR was performed for “Kiiro Togarashi”, a yellow fruit cultivar possessing ccs-3 (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)) and “Takanotsume”, a red fruit cultivar, as positive control. Total RNA was extracted from pericarp of fruits at color turning stage, using RNeasy Plant Mini Kit (QIAGEN). Reverse transcription reaction was carried out using PrimeScript II Reverse Transcriptase (Takara Bio). Two primer sets were applied, that is, Ccs F+174 and Ccs R+352 for upstream part of exon and Ccs F+1284 and Ccs R+1494 for downstream part of exon. Expression of ubiquitin was also examined as positive control. For all the primer sets, RT-PCR was carried out in 20 μL of reaction volume and the condition was 1 cycle at 94˚C for 1 min, 30 cycles at 94˚C for 30 sec, 60˚C for 30 sec and 72˚C for 30 sec, followed by a final extension at 72˚C for 30 sec.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Identification of the Large Deletion of the Ccs Gene in Non-Red Fruit Color Pepper</title><p>To identify the large deletion in upstream region of the Ccs gene, diagnostic PCR was carried out using six forward primers designed at 300 - 900 bp intervals with a fixed reverse primer (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)). At first, to verify the amplification accuracy, PCR was performed for the red pepper variety “Takanotsume” having the intact Ccs gene. As expected, a stepwise amplification of intensive bands with different sizes was observed for the six primers, although some minor non- specific bands were shown (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)). Then diagnostic PCR using these six primers was conducted for the yellow pepper cultivar “Sonia Gold” (<xref ref-type="fig" rid="fig2">Figure 2</xref>(c)). Five downstream primers did not show clear single band amplification</p><p>and only the most upstream primer Ccs5up_F-3784 amplified an intensive single band. Since the second upstream primer was located at −3080 bp position from the first nucleotide of exon, it was deduced that at least 3000 bp was lack in the Ccs gene of “Sonia Gold”.</p><p>The approximately 800 bp fragment obtained by using the most upstream primer Ccs5up_F-3784 was sequenced and aligned with the published genome sequence of red pepper. As a result, it was revealed that 4430 bp from −3234 bp position in upstream untranslated region to 1196 bp position in exon was deleted in the Ccs gene of “Sonia Gold” (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Since the accurate size and position of the large deletion could be successfully identified, hereafter we called this allele ccs-del. The size of the deletion of ccs-del was different from but near to ccs-p1 having 4879 bp deletion recently reported by Jeong et al. (2019) [<xref ref-type="bibr" rid="scirp.119928-ref14">14</xref>]. Especially the end of the deletion of ccs-del and ccs-p1 can be regarded to be identical depending on alignment.</p></sec><sec id="s3_2"><title>3.2. Development of the Large Deletion Distinguishable PCR Marker</title><p>Based on the results described above, we tried to develop PCR marker to distinguish ccs-del (<xref ref-type="fig" rid="fig4">Figure 4</xref>). Using the sequence information obtained, the 4430 bp large deletion specific primer Ccs5del F2 was designated astride the deletion</p><p>position (<xref ref-type="fig" rid="fig4">Figure 4</xref>(a)). In addition to this primer, normal allele specific primer Ccs5del F1 was designed inside the deleted region. Using these two primers at a time as forward with a single reverse primer Ccs5del R, multiplex PCR was carried out. According to the sequence information, it was expected that a 491 bp band was amplified for the normal allele and a 282 bp band was amplified for ccs-del. As shown in <xref ref-type="fig" rid="fig4">Figure 4</xref>(b), an approximately 500 bp single band was amplified for “Takanotsume” and an approximately 300 bp single band was amplified for “Sonia Gold” as expected. Thus, we successfully developed the PCR marker to distinguish the 4430 bp large deletion.</p></sec><sec id="s3_3"><title>3.3. Genotyping of the Ccs Gene for the Non-Red Fruit C. annuum Cultivars</title><p>Using the developed PCR marker for ccs-del, the Ccs genes in 16 non-red fruit color cultivars of C. annuum were genotyped (<xref ref-type="fig" rid="fig5">Figure 5</xref>). As a result, among 16 cultivars, 14 had ccs-del. Out of them, msGTY-1 (lane 10) is the orange fruit cultivar that has been used and revealed to have a large deletion in Lang et al. (2002) [<xref ref-type="bibr" rid="scirp.119928-ref13">13</xref>]. This result indicates that the 4430 bp deletion is a common cause of non-red fruit color in C. annuum.</p><p>Two cultivars “Cayenne Pepper Golden” (lane 5) and “Kiiro Togarashi” (lane 16) showed normal allele bands. “Cayenne Pepper Golden” and “Kiiro Togarashi” are European and Japanese traditional cultivars, respectively, and both are hot pepper having yellow and long type fruit. The sequences of the Ccs gene of the two cultivars were determined. Then, it was clarified that the sequences of both the cultivars were identical, having a single base deletion at 1265 bp position from the start codon that results in a frameshift and generates a stop codon (<xref ref-type="fig" rid="fig6">Figure 6</xref>). This was the allele ccs-3 that have been previously reported in other C. annuum cultivars [<xref ref-type="bibr" rid="scirp.119928-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref24">24</xref>]. Expression of ccs-3 in “Kiiro Togarashi” was investigated by RT-PCR with two primer sets, that is, upstream and downstream parts of exon (<xref ref-type="fig" rid="fig7">Figure 7</xref>(a). Both the upstream and downstream primer sets showed positive amplification in RT-PCR (<xref ref-type="fig" rid="fig7">Figure 7</xref>(b)). This result suggested that almost entire region of ccs-3, including even the region downstream of stop codon generated by frameshift due to the 1 bp deletion, was transcribed in the yellow cultivars. Therefore, the fruit color change might have been caused not by expressional change but by loss or weakening of function of ccs-3 due to the frameshift. A dCAPS marker was developed to distinguish ccs-3 (<xref ref-type="fig" rid="fig7">Figure 7</xref>(a) and <xref ref-type="fig" rid="fig7">Figure 7</xref>(c)). This is a codominant marker that can recognize heterozygous samples.</p></sec><sec id="s3_4"><title>3.4. Genotyping of the Ccs Gene for the Non-Red Fruit C. chinense Cultivars</title><p>Sixteen non-red fruit cultivars of C. chinense, the second major pepper species, were genotyped by the PCR marker for ccs-del (<xref ref-type="fig" rid="fig8">Figure 8</xref>(a)). Among 16 cultivars, 13 showed normal allele bands and a cultivar PI 485593 (lane 13) exhibited the 4430 bp large deletion specific band. No amplification was observed in two cultivars PI 224448 and CGN 22854 (lanes 10 and 16), suggesting that these cultivars had unknown mutation in the Ccs gene. When using the dCAPS marker for ccs-3, it was found that a cultivar PI 670898 (lane 14) had ccs-3 (<xref ref-type="fig" rid="fig8">Figure 8</xref>(b)). In <xref ref-type="fig" rid="fig8">Figure 8</xref>(b), PI 485593 (lane 13) that was revealed to have the 4430 bp deletion did not show band, which is as expected since the forward primer used</p><p>for dCAPS was included in the deleted region. These results indicated that the mutated alleles of the Ccs genes generating non-red fruit color, ccs-del and ccs-3, were shared in two major Capsicum species, C. annuum and C. chinense.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>In this study, we could successfully identify the large deletion causing non-red fruit color of pepper that has been known for more than 20 years but whose substance has not been identified [<xref ref-type="bibr" rid="scirp.119928-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref13">13</xref>]. It was revealed to be a 4430 bp deletion from −3234 bp position in 5' upstream untranslated region to 1196 bp position in exon. We named the allele having this deletion ccs-del. The size of the deletion of ccs-del was different from but near to that of ccs-p1 recently reported by Jeong et al. (2019) [<xref ref-type="bibr" rid="scirp.119928-ref14">14</xref>]. The size of the deletion of ccs-p1 was 4879 bp. Since the sequence of ccs-p1 could not be obtained, the identity of ccs-del determined in this study and ccs-p1 is obscure, but it is possible that these two alleles are the same because the length of the deletion region is depending on the reference sequence compared. The most part of the deleted region was promoter region of the Ccs gene. Since the length in promoter region is not so conservative, it is considerably possible that the two alleles are substantially the same.</p><p>We also succeeded to develop the PCR marker for ccs-del. Using this PCR marker, we clarified that most of the non-red fruit C. annuum cultivars investigated (14 of 16) possess ccs-del. Jeong et al. (2019) reported that 23 C. annuum accessions had ccs-p1. Although the identity of the ccs-del and ccs-p1 is ambiguous, these results indicate that more than 4 kb large deletion of Ccs is the most common cause to non-red fruit color in C. annuum and is shared by various sweet bell pepper. This is probably resulted from modern pepper breeding aiming colorful fruit color in which genetically limited preferable alleles were introduced intensively. The yellow or orange sweet bell pepper possessing ccs-del have nearly identical genetic traits such as flavor and productivity to the red sweet bell pepper that does not have ccs-del, indicating that ccs-del does not affect traits other than fruit color. Jeong et al. (2019) have reported another allele ccs-p2 that had 2968 bp deletion in the promoter region [<xref ref-type="bibr" rid="scirp.119928-ref14">14</xref>]. This allele, however, was found only in C. baccatum. Considering this fact and our result that all the cultivars having large deletion possess ccs-del, it is considered that ccs-p2 is not a source of non-red fruit color of C. annuum. In our present study, in addition to ccs-del, another allele ccs-3 was found in two traditional hot pepper cultivars. This allele is the most common among the alleles with frameshift of the Ccs gene and reported in other hot pepper cultivars. [<xref ref-type="bibr" rid="scirp.119928-ref14">14</xref>]. These results suggest that traditional non-bell type peppers possibly have alleles of Ccs other than ccs-del.</p><p>The genotyping of C. annuum and C. chinense revealed that ccs-del and ccs-3 were also present in C. chinense although they were minor in the species. As far as we know, this is the first report that the large deletion of Ccs that is the major cause for non-red fruit color in C. annuum is present in other Capsicum species. Also with respect to ccs-3, although it has been found in C. baccatum [<xref ref-type="bibr" rid="scirp.119928-ref14">14</xref>], presence in C. chinense has not been reported to date. These results evidently indicate that major alleles responsible for non-red fruit color in C. annuum were shared across species throughout interspecific introgression. Such introgression may contribute to expansion of pepper fruit color variation.</p><p>In this study, regardless the fruit color is orange or yellow, non-red fruit color cultivars had ccs-del. Several studies indicated that carotenoid amount was not necessarily determined by Ccs alleles [<xref ref-type="bibr" rid="scirp.119928-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref25">25</xref>]. Furthermore, recent study clarified that besides Ccs and Psy, the major genes responsible for pepper fruit color, other genes included in the carotenoid synthesis pathway or regulatory genes are involved in pepper fruit color determination [<xref ref-type="bibr" rid="scirp.119928-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.119928-ref26">26</xref>]. Thus, further analysis is necessary for understanding genetic mechanism of pepper fruit color. In this study, we developed two DNA markers to distinguish Ccs mutant alleles, ccs-del and ccs-3. DNA markers are powerful tool for breeding, especially, for selection of the traits that can be discerned only at the later growth stage such as fruit color. Even now it can be considered that demands to the vibrant color of pepper fruit are potentially high. The DNA markers developed in this study will be helpful for acceleration of pepper breeding targeting fruit color.</p></sec><sec id="s5"><title>Fund</title><p>This study was financially supported by the research grant from Urakami Foundation for Food and Food Culture Promotion.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s7"><title>Cite this paper</title><p>Omori, S. and Sasanuma, T. (2022) Identification of Large Deletion of Ccs Responsible for Non-Red Fruit Color in Pepper (Capsicum annuum) and Development of DNA Marker to Distinguish the Deletion. American Journal of Plant Sciences, 13, 1233-1246. https://doi.org/10.4236/ajps.2022.139084</p></sec></body><back><ref-list><title>References</title><ref id="scirp.119928-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Bucchaman, B.B., Gruissem, W. and Jones, R.L. (2000) Biochemistry &amp; Molecular Biology of Pants. American Society of Plant Physiologists, Maryland, 40.</mixed-citation></ref><ref id="scirp.119928-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">von Lintig, J. (2010) Colours with Functions: Elucidating the Biochemical and Molecular Basis of Carotenoid Metabolism. Annual Review of Nutrition, 30, 35-56.  
https://doi.org/10.1146/annurev-nutr-080508-141027</mixed-citation></ref><ref id="scirp.119928-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Romer, S., Hugueney, P., Bouvier, F., Camara, B. and Kuntz, M. (1993) Expression of the Genes Encoding the Early Carotenoid Biosynthetic Enzymes in Capsicum annuum. Biochemical and Biophysical Research Communications, 196, 1414-1421.  
https://doi.org/10.1006/bbrc.1993.2410</mixed-citation></ref><ref id="scirp.119928-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Hugueney, P., Badillo, A., Chen, H.C., Klein, A., Hirschberg, J., Camara, B. and Kuntz, M. (1995) Metabolism of Cyclic Carotenoids: A Model for the Alteration of This Biosynthetic Pathway in Capsicum annuum Chromoplasts. The Plant Journal, 8, 417-424. https://doi.org/10.1046/j.1365-313X.1995.08030417.x</mixed-citation></ref><ref id="scirp.119928-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Hirschberg, J., Cohen, M., Harker, M., Lota, T., Mann, V. and Pecker, I. (1997) Molecular Genetics of the Carotenoid Biosynthesis Pathway in Plants and Algae. Pure and Applied Chemistry, 69, 2151-2158. https://doi.org/10.1351/pac199769102151</mixed-citation></ref><ref id="scirp.119928-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Bouvier, F., Keller, Y., d’Harlingue, A. and Camara, B. (1998) Xanthophyll Biosynthesis; Molecular and Functional Characterization of Carotenoid Hydroxylases from Pepper Fruits (Capsicum annuum L.). Biochemica et Biophysica Acta—Lipids and Lipid Metabolism, 1391, 320-328. https://doi.org/10.1016/S0005-2760(98)00029-0</mixed-citation></ref><ref id="scirp.119928-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Thorup, T., Tanyolac, B., Livingstone, K., Popovsky, S., Paran, I. and Jahn, M. (2000) Candidate Gene Analysis of Organ Pigmentation Loci in the Solanaceae. Proceedings of the National Academy of Sciences of the United States of America, 97, 11192-11197. https://doi.org/10.1073/pnas.97.21.11192</mixed-citation></ref><ref id="scirp.119928-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Bouvier, F., Hugueney, P., d’Harlingue, A., Kuntz, M. and Camara, B. (1994) Xanthophyll Biosynthesis in Chromoplasts: Isolation and Molecular Cloning of an Enzyme Catalyzing the Conversion of 5,6-Epoxycarotenoid into Ketocarotenoid. The Plant Journal, 6, 45-54. https://doi.org/10.1046/j.1365-313X.1994.6010045.x</mixed-citation></ref><ref id="scirp.119928-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Hugueney, P., Bouvier, F., Badillo, A., Quennemet, J., d’Harlingue, A. and Camara, B. (1996) Developmental and Stress Regulation of Gene Expression for Plastid and Cytosolic Isoprenoid Pathways in Pepper Fruits. Plant Physiology, 111, 619-626.  
https://doi.org/10.1104/pp.111.2.619</mixed-citation></ref><ref id="scirp.119928-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Deruere, J., Bouvier, F., Steppuhn, J., Klein, A., Camara, B. and Kuntz, M. (1994) Structure and Expression of Two Plant Genes Encoding Chromoplast-Specific Proteins: Occurrence of Partially Spliced Transcripts. Biochemical and Biophysical Research Communications, 199, 1144-1150. https://doi.org/10.1006/bbrc.1994.1350</mixed-citation></ref><ref id="scirp.119928-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Lefebvre, V., Kuntz, M., Camara, B. and Palloix, A. (1998) The Capsanthin-Capsorubin Synthase Gene: A Candidate Gene for the y Locus Controlling the Red Fruit Colour in Pepper. Plant Molecular Biology, 36, 785-789.  
https://doi.org/10.1023/A:1005966313415</mixed-citation></ref><ref id="scirp.119928-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Stellari, G.M., Mazourek, M. and Jahn, M.M. (2010) Contrasting Modes for Loss of Pungency between Cultivated and Wild Species of Capsicum. Heredity, 104, 460-471.  
https://doi.org/10.1038/hdy.2009.131</mixed-citation></ref><ref id="scirp.119928-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Jeong, H.B., Jang, S.J., Kang, M.Y., Kim, S., Kwon, J.K. and Kang, B.C. (2020) Candidate Gene Analysis Reveals that the Fruit Color Locus C1 Corresponds to PRR2 in Pepper (Capsicum frutescens). Frontiers in Plant Science, 11, Article No. 399.  
https://doi.org/10.3389/fpls.2020.00399</mixed-citation></ref><ref id="scirp.119928-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Rodriguez-Uribe, L., Guzman, I., Rajapakse, W., Richins, R.D. and O’Connell, M.A. (2012) Carotenoid Accumulation in Orange-Pigmented Capsicum annuum Fruit, Regulated at Multiple Levels. Journal of Experimental Botany, 63, 517-526.  
https://doi.org/10.1093/jxb/err302</mixed-citation></ref><ref id="scirp.119928-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Guzman, I., Hambly, S., Romero, J., Bosland, P. and O’Connell, M. (2010) Variability of Carotenoid Biosynthesis in Orange Coloured Capsicum spp. Plant Science, 179, 49-59. https://doi.org/10.1016/j.plantsci.2010.04.014</mixed-citation></ref><ref id="scirp.119928-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Murray, M.G. and Thompson, W.F. (1980) Rapid Isolation of High Molecular Weight Plant DNA. Nucleic Acids Research, 8, 4321-4326.  
https://doi.org/10.1093/nar/8.19.4321</mixed-citation></ref><ref id="scirp.119928-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Hill, T.A., Chunthawodtiporn, J., Ashrafi, H., Stoffel, K., Weir, A. and Deynze, A.V. (2017) Regions Underlying Population Structure and the Genomics of Organ Size Determination in Capsicum annuum. The Plant Genome, 10, plantgenome2017.03.0026. https://doi.org/10.3835/plantgenome2017.03.0026</mixed-citation></ref><ref id="scirp.119928-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Faris, J.D., Fellers, J.P., Brooks, S.A. and Gill, B.S. (2003) A Bacterial Artificial Chromosome Contig Spanning the Major Domestication Locus Q in Wheat and Identification of a Candidate Gene. Genetics, 164, 311-321.  
https://doi.org/10.1093/genetics/164.1.311</mixed-citation></ref><ref id="scirp.119928-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Spielmeyer, W., Ellis, M.H. and Chandler, P.M. (2002) Semidwarf (sd-1), “Green Revolution” Rice, Contains a Defective Gibberellin 20-Oxidase Gene. Proceedings of the National Academy of Sciences of the United States of America, 99, 9043-9048. https://doi.org/10.1073/pnas.132266399</mixed-citation></ref><ref id="scirp.119928-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Doebley, J.F., Stec, A. and Gustus, C. (1995) Teosinte branched1 and the Origin of Maize: Evidence for Epistasis and the Evolution of Dominance. Genetics, 141, 333-346.  
https://doi.org/10.1093/genetics/141.1.333</mixed-citation></ref><ref id="scirp.119928-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Qin, C., Yu, C., Shen, Y, Fang, X., Chen, L., Min, J., Cheng, J., Zhao, S., Xu, M., Luo, Y., et al. (2014) Whole-genome sequencing of cultivated and wild peppers provides Insights into Capsicum Domestication and Specialization. Proceedings of the National Academy of Sciences of the United States of America, 111, 5135-5140.  
https://doi.org/10.1073/pnas.1400975111</mixed-citation></ref><ref id="scirp.119928-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Kim, S., Park, M., Yeom, S.I., Kim, Y.M., Lee, J.M., Lee, H.A., Seo, E., Choi, J., Cheong, K., Kim, K.T., et al. (2014) Genome Sequence of the Hot Pepper Provides Insights into the Evolution of Pungency in Capsicum species. Nature Genetics, 46, 270-278. https://doi.org/10.1038/ng.2877</mixed-citation></ref><ref id="scirp.119928-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Kim, O.R., Cho, M.C., Kim, B.D. and Huh, J.H. (2010) A Splicing Mutation in the Gene Encoding Phytoene Synthase Causes Orange Coloration in Habanero Pepper Fruits. Molecules and Cells, 30, 569-574. https://doi.org/10.1007/s10059-010-0154-4</mixed-citation></ref><ref id="scirp.119928-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Huh, J., Kang, B., Nahm, S., Kim, S., Ha, K., Lee, M. and Kim, B. (2001) A candidate Gene Approach Identified Phytoene Synthase as the Locus for Mature Fruit Colour in Red Pepper (Capsicum spp.). Theoretical and Applied Genetics, 102, 524-530.  
https://doi.org/10.1007/s001220051677</mixed-citation></ref><ref id="scirp.119928-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Jeong, H.B., Kang, M.Y., Jung, A., Han, K., Lee J.H., Jo, J., Lee, H.Y., An, J.W., Kim, S. and Kang, B.C. (2019) Single-Molecule Real-Time Sequencing Reveals Diverse Allelic Variations in Carotenoid Biosynthetic Genes in Pepper (Capsicum spp.). Plant Biotechnology Journal, 17, 1081-1093. https://doi.org/10.1111/pbi.13039</mixed-citation></ref><ref id="scirp.119928-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Lang, Y., Yanagawa, S., Sasanuma, T. and Sasakuma, T. (2004) Orange Fruit Colour in Capsicum Due to Deletion of Capsanthin-Capsorubin Synthesis Gene. Breeding Science, 54, 33-39. https://doi.org/10.1270/jsbbs.54.33</mixed-citation></ref><ref id="scirp.119928-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Popovsky, S. and Paran, I. (2000) Molecular Genetics of the y Locus in Pepper: Its Relation to Capsanthin-Capsorubin Synthase and to Fruit Colour. Theoretical and Applied Genetics, 101, 86-89. https://doi.org/10.1007/s001220051453</mixed-citation></ref></ref-list></back></article>