AiMAdvances in Microbiology2165-3402Scientific Research Publishing10.4236/aim.2022.128034AiM-119447ArticlesBiomedical&Life Sciences Molecular Identification of <i>Streptococcus pyogenes</i> in Isolates from Children with Pharyngitis, Gezira State, Sudan 2022 MinasMohamed Balla1*AdilMergani2MohamedElamin A. M. E. Medani3AdamDawoud Abakar4Department of Molecular and Immunogenetics, NCI, University of Gezira, Wad Medani, SudanDepartment of Microbiology, Faculty of Science, University of Gezira, Wad Medani, SudanDepartment of Medical Parasitology, Faculty of Medical Laboratory Science, University of Gezira, Wad Medani, SudanPediatric Cardiologist Faculty of Medicine, University of Gezira, Wad Medani, Sudan15082022120850051012, July 202223, August 2022 26, August 2022© Copyright 2014 by authors and Scientific Research Publishing Inc. 2014This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/

Background: Streptococcus pyogenes (Group A streptococcus) is an important Gram-positive human pathogen affected the upper respiratory tract, such as the tonsils and pharynx, and is also induces post-infection diseases such as rheumatic fever and glomerulonephritis. This study aim to isolate Streptococcus pyogenes from children with pharyngitis and to evaluate the molecular identification of S. pyogenes compared with conventional methods. Methods: A cross sectional study was conducted on total of 200 throat swab samples which were collected from children with pharyngitis referred to Wad medani Pediatric Teaching Hospital and Wad medani ENT hospital from January to November 2021. Demographic and clinical data were collected by questionnaire. Throat swabs were tested with the standard microbiological techniques to isolated Group A streptococcus (GAS). Antimicrobial susceptibility testing was performed to all GAS isolates using the Kirby Bauer disk diffusion method according to clinical laboratory standard institute (CLSI) guidelines. Additionally, PCR was used to identify Spy 1258 gene of isolated bacteria. Results: From all throat swab samples screened, 51 isolates (25.5%) were identified as GAS. Antibiotic susceptibility testing revealed that all the GAS isolates were sensitive to Penicillin and Azithromycin. Sensitivity to Erythromycin, Gentamicin, Clarithromycin, Amoxicillin and Cephalexin were 88.2%, 86.3%, 45.1%, 41.2%, 13.7%, respectively. Based on PCR identification of Spy 1258 gene the percentage of isolated bacteria was 21%. Conclusion: The rate of isolated Streptococcus pyogenes was 25.5% by conventional methods and 21% by PCR. The bacteria were sensitive to Penicillin and Azithromycin. The Spy 1258 gene was specific for detection of Streptococcus pyogenes.

Antimicrobial Sensitivity Test Pharyngitis Spy 1258 <i>Streptococcus pyogenes</i> Sudan1. Introduction

Streptococcus species are associated with many human diseases. Neonatal sepsis, meningitis, arthritis, and pneumonia are some examples of these diseases. Group A Streptococcus (GAS) is a gram-positive cocci bacteria that appear in chains and produces small white to grey colonies with a clear zone of β-hemolysis on blood agar, rare strains are not hemolytic. GAS can be subdivided into more than 100 serotypes by the M-protein antigen that is found on the cell surface and by fimbriae. The GAS cell is a complicated structure, the cell is covered with a hyaluronic acid capsule that makes the colonies mucoid or water drop appearance in rapidly dividing strains. The cell surface and the hyaluronic capsular layer are microscopic hair-like fimbriae which enable adherence of GAS to epithelial cells and extracellular matrix proteins [1]. GAS causes mild infectious diseases such as skin infections and pharyngitis but is also able to cause severe, life-threatening invasive diseases such as streptococcal toxic shock syndrome or necrotizing fasciitis. Recurrent GAS infections may induce autoimmune diseases including rheumatic fever, rheumatic heart disease and acute post-streptococcal glomerulonephritis [2]. Streptococcus pyogenes contain N-acetyl glucosamine linked to rhamnose polymer that is characterized as group A streptococcus. Streptococcus pyogenes is able of infecting humans through adhesion and colonization of the host mucosal surface epithelial cells of the upper respiratory tract. The infection rate is more than 600 million infections annually resulting in more than 500,000 deaths a year [3].

Acute pharyngitis/tonsillitis is defined as inflammation of posterior pharynx and tonsils. Most cases of acute pharyngitis resolve without antibiotic treatment. Many viruses and bacteria can cause acute pharyngitis; however, Streptococcus pyogenes (also known as Lancefield group A, β-hemolytic streptococci) is the most common bacterial cause of pharyngitis and only causative agent that requires an etiologic diagnosis and specific treatment. S. pyogenes is of major clinical importance because it can cause post-infection systemic complications which occur after 1 - 3 weeks of the pharynx infection. S. pyogenes is responsible for 5% to 30% of cases of acute pharyngitis, and it is more common in children between 5 years and 15 years than in adults. In addition to group A streptococci several strains of bacteria can cause acute pharyngitis such as group C streptococci and group G streptococci. Common symptoms of acute pharyngitis are sore throat and fever with or without tonsillar erythema, swelling, exudate, or ulcerations. In streptococcal infections, symptom onset is usually sudden and includes sore throat, chills, malaise, fever, headache, tender and enlarged anterior cervical lymph nodes, and pharyngeal or tonsillar exudate. Scarlatina form rash and Palatal petechiae are highly specific, but rarely found. Cough, conjunctivitis, coryza and diarrhea are uncommon in streptococcal infection, and their presence suggests a viral etiology. Viruses cause approximately 75% of pharyngitis [4].

Treatment of GAS infections naturally depends on the use of convenient antibiotics. GAS remains globally sensitive to penicillin, while antibiotics such as cephalosporins, macrolides, and clindamycin are also used clinically. In some regions of the world, GAS resistance to antibiotics such as clindamycin and macrolides has become an increasing worry and epidemiological wakefulness is required to ensure that treatment matches the antibiotic sensitivity of GAS strains [5]. This study aims to isolate Streptococcus pyogenes from children with pharyngitis and to evaluate the molecular identification of S. pyogenes compared with conventional methods.

2. Methods

This study was cross sectional Laboratory based. Samples were collected from children attending Wad Madani Pediatric Teaching Hospital and Wad Madani Ear, Nose and Throat (ENT) hospital with symptoms of Pharyngitis, ages from 5 to 17 years from January to November 2021. Culture, identification and sensitivity test were done in Medical Laboratory of University of Gezira and molecular detection of Streptococcus pyogenes using PCR and Genetics study were done in Molecular Biology Department-National Institute of Cancer, Wad Madani, Sudan. Exclusion criteria included Children with prior antibiotic therapy in less than 7 days and respiratory tract symptoms such as rhinorrhea or nasal congestion.

2.1. Ethical Approval

The study was approved by the Ministry of Health Gezira state Ethics Committee.

2.2. Sample Size

N = Z 2 ⋅ p q d 2 (1)

N = Sample size.

Z = the standard normal deviation at 95% confidences level (set at 1.96).

p = is 1 − q.

q = the proportion in the target population estimated to have a particular characteristic or disease.

d = the degree of accuracy/accepted margin.

According to the mentioned statistical calculation, this study included 200 samples.

2.3. Sample Collection

Throat swabs were collected by sterile swab and care was taken not to swab the Cheeks, tongues, lips or other areas of the mouth of children at the age from 5 - 17 years suffering from pharyngitis. Informed consent was taken from parents. Each selected child was subjected to a brief focused medical history and physical examination. And questionnaire was filled.

2.4. Throat Swabs Culture and Identification of Bacteria

The throat swabs were inoculated on 5% sheep blood agar plates and incubated at 37˚C for 24 h in a candle jar, which can provide an atmosphere of 5% - 10% CO2. Culture plates negative for beta-haemolytic colonies were incubated for additional 24 hours. Identification of GAS isolates was made based on the standard microbiological techniques which include beta-hemolytic activity on sheep blood agar, small colony characteristics, Gram positive cocci (Streptococci), catalase production negative, 0.04-U bacitracin disc susceptible and PYR test positive. For other bacteria Different identification methods were followed including cultural, morphological, microscopic, and biochemical tests.

2.5. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility testing was done using the standard disk diffusion method on Mueller Hinton agar with 5% sheep blood, incubated overnight at 37˚C in 5% - 10% CO2 according to the Clinical and Laboratory Standard Institute (CLSI) guidelines. The commercial antibiotic discs were used to determine the susceptibility of isolates to penicillin (10 U), Erythromycin (15 μg), Amoxicillin (10 mcg), Azithromycin (15 μg), Clarithromycin (15 μg), Gentamicin (10 mcg), and Cephalexin (30 mcg). The strains were designated sensitive, intermediately sensitive or resistant, according to CLSI guidelines.

2.6. PCR Detection of Streptococcus pyogenes2.6.1. Primer Design of Spy 1258 Gene

Molecular detection of Streptococcus pyogenes by Polymerase Chain Reaction (PCR) amplification of Spy 1258 gene, primers were designed according to (Table 1).

Sequence of primer sets used for PCR amplification of spy 1258 gene
GenePrimer namePrimer SequenceProduct length
Spy 1258Spy 1258 (F)5' AAAGACCGCCTTAACCACCT 3'407 bp
Spy 1258 (R)5' TGCCAAGGTAAACTTCTAAAGCA 3'
2.6.2. DNA Extraction

Deoxyribonucleic acid (DNA) was extracted from strains of Streptococcus pyogenes by Boiling method, after thawing of S. pyogenes isolates which placed in 500 μL of Trise EDTA (TE) buffer and frozen at −70˚C, 150 μL of this suspension was taken and heated at 95˚C for 30 minutes, centrifuge was used and spin at 14,000 rpm for 5 minutes and the supernatant was taken into new sterilized tube.

2.6.3. PCR Amplification of Spy 1258 Gene

Amplification reactions were performed for 40 cycles using PCR program shown in (Table 2).

PCR program of amplification of spy 1258 gene
TemperatureTime
Initial Denaturation94˚C3 min.
Denaturation94˚C1 min.
Annealing58˚C45 sec.
Elongation72˚C45 sec.
Final Elongation72˚C3 min.
2.6.4. Gel Electrophoresis

Amplicons were visualized on 1.5% Agarose gel by Electrophoresis. The PCR products were electrophoresed through agarose gel with current 120 V for about 30 min. Gels are photographed under UV light.

2.7. Statistical Analysis

Statistical analysis was done by SPSS statistical software. Participants’ demographic and clinical characteristic were described by using descriptive statistics. p-value less than 0.05 taken as statistically significant at 95% confidence level.

3. Results3.1. Social Demographic Data

In this study a total of 200 throat swabs were collected from Pharyngitis from January to November 2021. Females accounted 126 (63%) and males were 74 (37%). The most common infected age group was 5 - 7 years representing 68 (34%) followed by age group from 11 - 13 and the age group 14 - 17 is less infected by pharyngitis 36 (18%) (Figure 1).

And urban residents were 62% when the rural was 38%. Pharyngitis decrease during the age, the age from 14 to 17 is the less infection and especially in male more than female.

3.2. Symptoms and Clinical Presentation

Enlarged and Red Tonsils and fever were the most dominant symptoms which represent 100% and 81% respectively and the less dominant symptoms are vomiting and abdominal pain which are 6.5% (Figure 2).

3.3. Isolation of Streptococcus pyogenes

In this study, the rate of Streptococcus pyogenes was 25.5% (51/200) which has been identified by Conventional methods using culture and biochemical tests. Total number of males infected by S. pyogenes was 13 (25.5%) and females were 38 (74.5%). The age group from 5 - 7 years were the most infected group with S. pyogenes 17 (33.4%) and infection decreased throw the age in male and increased again in female from in age groups 13 - 15 years and 15 - 17 years (Figure 3).

3.4. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility testing for all S. pyogenes isolates was performed using Clinical and Laboratory Standard Institute guidelines CLSI by Kirby–Bauer disk diffusion method, the bacteria were sensitive to Penicillin and Azithromycin. Sensitivity to Erythromycin, Gentamicin, Clarithromycin, Amoxicillin, Cephalexin were 88.2%, 86.3%, 45.1%, 41.2%, 13.7%, respectively.

3.5. Bacterial Isolates

The bacterial isolates include Streptococcus pyogenes (25.5%), Staphylococcus aureus (31.5%), other streptococci (11%) and coagulase negative staphylococci (5%) and no growth was detected in (27%) of total 200 samples.

3.6. Detection of S. pyogenes Using Spy 1258 Gene

PCR detection of Spy 1258 gene which has 407 bp Product length (Figure 4) showed 42 samples positive (82.4%) of 51 S. pyogenes samples were detected by culture and biochemical test and 9 samples were negative (17.6%). The results showed the percentage of S. pyogenes was 21% by using PCR detection of Spy 1258 gene and 25.5% by using conventional methods (Table 3).

Detection of S. pyogenes by culture method and spy 1258 gene
Detection MethodFrequencyPercentage
Culture method5125.5%
Spy 12584221%
Total200100%
3.7. Specificity of Spy 1258 Gene

The study showed the Spy 1258 gene specific for S. pyogenes only when tested for other species included Staphylococcus aureus, Coagulase negative staphylococci, other streptococci, E. coli and human DNA (Figure 5).

4. Discussion

Group A Streptococcus (GAS) is the most important bacterial cause of pharyngitis, children from 5 - 15 years are most infected, Streptococcus pyogenes is responsible for 20% - 30% of sore throat in children [6]. In this study the females were more commonly infected with pharyngitis than males (63%) which agree with [7] study showing the female infection more than males (57%). Isolation of Streptococcus pyogenes was 25.5% this is high result compared with 11.3% reported in Ethiopia [7], 12% in Turkey [8]. The study of [9] shows 24.1% isolation percentage near to this study and agrees with 26% isolate of [10] study. Our result has a lower rate than [11] and [12] studies which show 30% and 46% isolates of Streptococcus pyogenes.

Streptococcus pyogenes is sensitive to penicillin; different studies worldwide showed that like [11] study from Iran, [13] study from Senegal, [14] study from Ethiopia, [15] study from China and our study also showed that which confirm the penicillin is still the drug of choice for the treatment of GAS pharyngitis.

Antibiotics such as cephalosporins, macrolides, and clindamycin are also used clinically. In some regions of the world, GAS resistance to antibiotics such as clindamycin and macrolides has become an increasing worry and epidemiological wakefulness is required to ensure that treatment matches the antibiotic sensitivity of GAS strains [5]. Resistance among streptococci to macrolides (erythromycin and clarithromycin) are widely reported [16]. Our study showed the resistance of Clarithromycin was 33.3% similar to [11] showing resistance 33.9% and the resistance to Erythromycin was 7.8% agree with 9.7% of [17] study and 6.9% of [18] study. And also show 52.9% resistance to amoxicillin where study of [19] from Egypt showed 81% sensitive to amoxicillin.

The Spy 1258 is the most widely common primer used for molecular detection of S. pyogenes [20], this study detects 82.4% of bacterial isolates, in [12] study from Iraq the percentage of detection by Spy 1258 was 61%. [21] In a comparative study (Identification of Streptococcus pyogenes—Phenotypic Tests vs Molecular Assay (Spy 1258 PCR)) showed the percentage Streptococcus pyogenes contain Spy 1258 gene was 85.9%. This study showed 100% Specifity of Spy 1258 agree with [10] study which also showed 100% Specifity and 87% sensitivity and [22] showed that Spy 1258 gene was specific for S. pyogenes only, but not from other species of the genus Streptococcus and common bacteria. And this result disagrees with [5] study showed all S. pyogenes isolates contain Spy 1258 genes and [21] study’s conclusion to use Spy 1258 for the best results of identification. [20] study from Sudan showed that the low sensitivity of Spy 1258 primer and the variability in S. pyogenes genome sequence necessitate developing new primers according to the environmental and geographical distribution of S. pyogenes isolates.

Limitation of the study includes the Corona pandemic and its impact on various aspects, such as the difficulty of providing research materials.

5. Conclusion

The rate of Streptococcus pyogenes was 25.5% by conventional methods and 21% by using Spy 1258 gene. The bacteria were sensitive to Penicillin and Azithromycin. And the Spy 1258 gene is specific for detection of Streptococcus pyogenes.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

Cite this paper

Balla, M.M., Mergani, A., Medani, M.E.A.M.E. and Abakar, A.D. (2022) Molecular Identification of Streptococcus pyogenes in Isolates from Children with Pharyngitis, Gezira State, Sudan 2022. Advances in Microbiology, 12, 500-510. https://doi.org/10.4236/aim.2022.128034

ReferencesHelal, Z.M., Rizk, D.E., Adel El-Sokkary, M.M. and Hassan, R. (2020) Prevalence and Characterization of Streptococcus pyogenes Clinical Isolates from Different Hospitals and Clinics in Mansoura. International Journal of Microbiology, 2020, Article ID: 5814945. https://doi.org/10.1155/2020/5814945Orsud, H., Mergani, A., Elsanousi, S. and Elazhari, G. (2020) Isolation, Identification and Biochemical Profile of Pathogenic and Opportunistic Bacteria from Sore throat. The Gazette of Medical Science, 1, 4-12. https://doi.org/10.46766/thegms.microb.20090201https://www.doi.org/10.46766/thegms.microb.20090201Abraham, T. and Sistla, S. (2016) Identification of Streptococcus pyogenes—Phenotypic Tests vs Molecular Assay (spy1258pcr): A Comparative Study. Journal of Clinical and Diagnostic Research, 10, DC01-DC03. https://doi.org/10.7860/JCDR/2016/20053.8093Ahmed, S., Al-Jebori, I., Saeed, H. and Al-Shwany, Z. (2015) Molecular Study of Sortase Enzyme in Streptococcus pyogenes Isolated from Patients with Tonsillitis in Kirkuk City. Kirkuk University Journal-Scientific Studies, 10, 227-241. https://doi.org/10.32894/kujss.2015.103487Wu, P.-C., Lo, W.-T., Chen, S.-J. and Wang, C.-C. (2014) Molecular Characterization of Group A Streptococcal Isolates Causing Scarlet Fever and Pharyngitis among Young children: A Retrospective Study from a Northern Taiwan Medical Center. Journal of Microbiology, Immunology and Infection, 47, 304-310. https://doi.org/10.1016/j.jmii.2013.02.007Ali, H.N., Dhahi, M.A. and Abd, A.K.H. (2015) Molecular Screening for Erythromycin Resistance Genes in Streptococcus pyogenes Isolated from Iraqi Patients with Tonsilo-pharyngites. African Journal of Biotechnology, 14, 2244-2250.Sunaoshi, K., Murayama, S.Y., Adachi, K., Yagoshi, M., Okuzumi, K., Chiba, N., Morozumi, M. and Ubukata, K. (2010) Molecular emm Genotyping and Antibiotic Susceptibility of Streptococcus dysgalactiae subsp. Equisimilis Isolated from Invasive and Non-Invasive Infections. Journal of Medical Microbiology, 59, 82-88. https://doi.org/10.1099/jmm.0.013201-0Li, H., Zhou, L., Zhao, Y., Ma, L., Liu, X. and Hu, J. (2020) Molecular Epidemiology and Antimicrobial Resistance of Group a Streptococcus Recovered from Patients in Beijing, China. BMC Infectious Diseases, 20, Article No. 507. https://doi.org/10.1186/s12879-020-05241-xKebede, D., Admas, A. and Mekonnen, D. (2021) Prevalence and Antibiotics Susceptibility Profiles of Streptococcus pyogenes among Pediatric Patients with Acute Pharyngitis at Felege Hiwot Comprehensive Specialized Hospital, Northwest Ethiopia. BMC Microbiology, 21, Article No. 135. https://doi.org/10.1186/s12866-021-02196-0Camara, M., Dieng, A. and Boye, C.S.B. (2013) Antibiotic Susceptibility of Streptococcus pyogenes Isolated from Respiratory Tract Infections in Dakar, Senegal. Microbiology Insights, 6, Mbi. S12996. https://doi.org/10.4137/MBI.S12996Degaim, Z.D., Taher, E.D. and Shallal, M. (2019) Molecular Study of spy1258 and Smez Genes in Group A Streptococcal Tonsillitis. Journal of Pure and Applied Microbiology, 13, 433-439. https://doi.org/10.22207/JPAM.13.1.47Sayyahfar, S., Fahimzad, A., Naddaf, A. and Tavassoli, S. (2015) Anti Biotic Susceptibility Evaluation of Group A Streptococcus Isolated from Children with Pharyngitis: A Study from Iran. Infection & chemotherapy, 47, 225-230.Dunne, E.M., Marshall, J.L., Baker, C.A., Manning, J., Gonis, G., Danchin, M.H., Smeesters, P.R., Satzke, C. and Steer, A.C. (2013) Detection of Group a Streptococcal Pharyngitis by Quantitative PCR. BMC Infectious Diseases, 13, Article No. 312. https://doi.org/10.1186/1471-2334-13-312https://link.springer.com/article/10.1186/1471-2334-13-312Oliver, J., Malliya Wadu, E., Pierse, N., Moreland, N.J., Williamson, D.A. and Baker, M.G. (2018) Group A Streptococcus Pharyngitis and Pharyngeal Carriage: A Meta-Analysis. PLOS Neglected Tropical Diseases, 12, Article ID: e0006335. https://doi.org/10.1371/journal.pntd.0006335Tartof, S.Y., Reis, J.N., Andrade, A.N., Ramos, R.T., Reis, M.G. and Riley, L.W. (2010) Factors Associated with Group A Streptococcus emm Type Diversification in a Large Urban Setting in Brazil: A Cross-Sectional Study. BMC Infectious Diseases, 10, Article No. 327. https://doi.org/10.1186/1471-2334-10-327https://bmcinfectdis.biomedcentral.com/articles/10.1186/1471-2334-10-327Tesfaw, G., Kibru, G., Mekonnen, D. and Abdissa, A. (2015) Prevalence of Group A β-Haemolytic Streptococcus among Children with Pharyngitis in Jimma Town, Southwest Ethiopia. Egyptian Journal of Ear, Nose, Throat and Allied Sciences, 16, 35-40. https://doi.org/10.1016/j.ejenta.2015.02.001Shulman, S.T., Bisno, A.L., Clegg, H.W., Gerber, M.A., Kaplan, E.L., Lee, G., Martin, J.M. and Van Beneden, C. (2012) Clinical Practice Guideline for the Diagnosis and Management of Group A Streptococcal Pharyngitis: 2012 Update by the Infectious Diseases Society of America. Clinical Infectious Diseases, 55, e86-e102. https://doi.org/10.1093/cid/cis629Chen, M., Yao, W., Wang, X., Li, Y., Chen, M., Wang, G., Zhang, X., Pan, H., Hu, J. and Zeng, M. (2012) Outbreak of Scarlet Fever Associated with emm12 Type Group A Streptococcus in 2011 in Shanghai, China. The Pediatric Infectious Disease Journal, 31, e158-e162. https://doi.org/10.1097/INF.0b013e31825874f3Anjos, L.M.M., Marcondes, M.B., Lima, M.F., Mondelli, A.L. and Okoshi, M.P. (2014) Streptococcal Acute Pharyngitis. Revista da Sociedade Brasileira de Medicina Tropical, 47, 409-413. https://doi.org/10.1590/0037-8682-0265-2013Borek, A.L., Obszańska, K., Hryniewicz, W. and Sitkiewicz, I. (2012) Detection of Streptococcus pyogenes Virulence Factors by Multiplex PCR. Virulence, 3, 529-533. https://doi.org/10.4161/viru.21540Walker, M.J., Barnett, T.C., Mcarthur, J.D., Cole, J.N., Gillen, C.M., Henningham, A., Sriprakash, K., Sanderson-Smith, M.L. and Nizet, V. (2014) Disease Manifestations and Pathogenic Mechanisms of Group A Streptococcus. Clinical Microbiology Reviews, 27, 264-301. https://doi.org/10.1128/CMR.00101-13Nizet, V. and Arnold, J.C. (2016) 118 Streptococcus pyogenes (Group A Strepto coccus). Acessado dezembro, 15, 696-707.