The coagulase-negative staphylococci (CoNS) have long been considered to be low pathogenicity. The possibility of a horizontal transfer of resistance and virulence genes from
S. aureus to CoNS could increase the pathogenicity of these bacteria. The objective of this work is to contribute to a better knowledge of the pathogenicity of (CoNS) strains isolated from surfaces and medico-technical materials of the University Hospital of Abomey-Calavi/S
ô-Ava. Seventy strains of CoNS isolated from surfaces and medico-technical materials of the University Hospital of Abomey-Calavi were tested for methicillin resistance. The resistance to methicillin was evaluated phenotypically by the resistance of the strains to cefoxitin and then confirmed by the search for the
mecA gene using PCR. The genes encoding staphylococcal chromosomal cassette (SCCmec) types I, II and III originally found in
S. aureus were tested in CoNS by multiplex PCR using specific primers. All the strains studied showed resistance to methicillin. However, only 28.5% (20/70) carried the mecA gene. SCCmec was identified in only 17.14% (12/70) of these strains. Four strains carried
mecA gene as well as one of the three types of SCCmec searched. SCCmec types I, II and III were identified in CoNS strains studied. SCCmec type I was the most frequent chromosomal cassette in mecA
+ strains, only or in association with another SCCmec. The study also revealed methicillin-resistant strains carrying SCCmec lacking the mecA gene. Finally, 60% (12/20) of the strains were found to be non-typeable. Our results show that CoNS strains present a high resistance to methicillin and the source of this resistance in the CoNS of our study is not only the mecA gene. There is also a high diversity of SCCmec, justified by a large number of non-typeable CoNS strains. The
mecA−SCCmec+ methicillin-resistant strains deserve to be sequenced for further studies.
The main mechanism of the resistance to methicillin is related to beta-lactam target modification [6] [7]. Resistance to this semi-synthetic antibiotic is under the control of the mecA gene located in a mobile genetic element called the staphylococcal chromosome cassette mec (SCCmec) [8]. SCCmec harbors the mec genes, which confer resistance not only to methicillin but also to almost all other beta-lactams [9]. SCCmec has two components, it is about: the mec gene complex and the cassette chromosome recombinase (ccr) gene complex. The mec gene complex which consists of mecA, the regulatory genes, and the associated insertion sequences; has been classified into six different classes (A, B, C1, C2, D, and E) together with cassette chromosome recombinase (ccr) genes (ccrC or the pair of ccrA and ccrB) encoding recombinases that mediate the integration and excision of SCCmec into and from the chromosome.
Different types of SCCmec have been identified in staphylococci. Among them, SCCmec I, II and III are more particularly present in Hospital associated MRSA strains (HA-MRSA), while new SCCmec allelic variants, types IV to VIII, have been identified in Community associated MRSA strains (CA-MRSA) [10]. This implies that coagulase-positive and coagulase-negative strains of staphylococci exchange staphylococcal chromosomal cassettesmec (SCCmec) by horizontal transfer, thus promoting the acquisition of antibiotic resistance genes by the latter [11].
The aim of this study is therefore to investigate the diversity and distribution of staphylococcal chromosome cassettes mec (CCSmec) types I, II and III in coagulase-negative staphylococcal strains isolated from surfaces and medico-technical materials from the University Hospital of Abomey-Calavi/Sô-Ava (South Benin) from January to June 2019 in the Departments of Neonatology, Pediatrics, Maternity Ward, Operating Room and Central Sterilization.
2. Materials and Methods2.1. Collection of Bacterial Isolates
Seventy strains of coagulase-negative staphylococci were previously collected from surfaces and medico-technical materials at the Abomey-Calavi/Sô-Ava University Hospital and identified phenotypically by the API STAPH galleries [12]. These 70 strains represent 10 species, namely S. xylosus (n = 12), S. capitis (n = 10), S. sciuri (n = 10), S. hominis (n = 10), S. cohnii (n = 8), S. epidermidis (n = 6), S. lugdunensis (n = 6), S. haemolyticus (n = 4), S. lentus (n = 2), and S. schleifeiri (n = 2).
2.2. Susceptibility of CoNS Strains to Methicillin
The susceptibility of the CoNS isolate was investigated by cefoxitin disk diffusion method on the Muller Hinton agar medium according to the EUCAST [13]. The bacterial suspension was standardized using the 0.5 McFarland control.
2.3. DNA Extraction
DNA extraction of the different SCN strains was done according to the method adapted from Rasmussen and Morrissey [14] [15]: after inoculating a colony of the strain to be tested on MH agar medium poured into petri dishes, the dishes were incubated at 37˚C for 18 h. Then, the preculture of the different colonies obtained on the petri dishes was done in 1 mL of liquid MH in an eppendorf tube. The tubes were incubated at 37˚C for 18 h. The obtained bacterial cultures were centrifuged at 12,000 rpm for 5 minutes. The supernatant was poured off and 500 µL of sterile distilled water was added to the bacterial pellet and heated in a dry bath at 95˚C for 15 minutes. Then, the heated pellet was centrifuged at 12,000 rpm for 5 minutes. The resulting supernatant was emptied into another eppendorf tube and 500 µL of 70% (v/v) alcohol was added. Centrifugation was performed again at 12000 rpm for 5 minutes. The resulting supernatant was again emptied and the eppendorf tubes were left for 24 hours in a laminar flow hood for drying. The DNA pellets were suspended in 50 µL of EDS and stored at 4˚C for immediate use or at −20˚C for long-term storage.
2.4. mecA Gene Detection
The detection of the mecA gene in methicillin-resistant CoNS (MR-CoNS) strains was performed by monoplex PCR using specific primers (Table 1). The reaction mixture used for the amplification of this gene was composed of 2 µL of buffer, 0.1 µL of Taq polymerase at a final concentration of 0.025 units/µL, 0.2 µL of MgCl2, 0.4 µL of dNTP, 1 µL of reverse and forward primer of the mecA gene at a final concentration of 10 µM, 5 µL of DNA and 8.3 µL of sterile distilled water for a final volume of 20 µL. The amplification program used consisted of an initial denaturation at 94˚C for 3 min followed by 36 cycles of denaturation at 94˚C for 1 min and 30 s, hybridization at 55˚C for 1 min, elongation at 72˚C for 1 min, final elongation at 72˚C for 10 min and refrigeration of the amplified product to 10˚C.
2.5. SCCmec Typing
The typing of CCSmec present in CoNSRM was done via multiplex PCR using specific primer pairs (Table 1) capable of detecting CCSmec type I, II and III. The sequences of the different primers used are shown in Table 1. The reaction mixture consisted of 2 µL of buffer, 0.1 µL of Taq polymerase at a final concentration of 0.025 units/µL, 0.4 µL of dNTP, 1 µL at a final concentration of 10 µM of the sense and antisense primers of each of the three primer pairs, 5 µL of DNA and 6.5 µL of sterile distilled water for a final volume of 20 µL. The amplification program used was as follows: initial denaturation at 94˚C for 3 min followed
List of primers for mecA gene detection and SCCmec typing
Target
Name/ Primers
Sequences (5' → 3')
Amplified fragment Size (bp)
SCCmec Type
SCCmec
CIF2 F CIF2 R
TTCGAGTTGCTGATGAAGAAGG
494
I
ATTTACCACAAGGACTACCAGC
KDP F1 KDP R1
AATCATCTGCCATTGGTGATGC
284
II
CGAATGAAGTGAAAGAAAGTGG
RIF5 F10 RIF5 R13
TTCTTAAGTACACGCTGAATCG
414
III
GTCACAGTAATTCCATCAATGC
mecA
mecA F mecA R
CCAGGAATGCAGAAAGACC
675
TCACCTGTTTGAGGGTGGAT
by 36 cycles of denaturation at 94˚C for 1 min and 30 s, hybridization at 57˚C for 1 min, elongation at 72˚C for 1 min, final elongation at 72˚C for 10 min and cooling of the amplified product to 10˚C.
2.6. Data Analysis
The Excel 2019 workbook was used to make graphs to better analyze data. The ± signs were used to reflect the presence or absence of the desired gene and staphylococcal chromosomal cassettes.
3. Results3.1. Susceptibility of CoNS Strains to Methicillin
A total of 70 CoNS strains isolated from surfaces and medical equipment at the Abomey-Calavi/Sô-Ava University Hospital were enrolled in this study. The susceptibility to methicillin of CoNS strains revealed that all (100%) strains studied were resistant to the used antibiotic (Figure 1). Thus, among the strains resistant to methicillin, S. xylosus is the most represented species, representing 17.14% of all MR-CoNS strains. S. lentus and S. schleifeiri strains were weakly represented in methicillin-resistant species (2.85% each). S. capitis, S. sciuri, S. hominis, S. epidermidis, S. lugdunensis and S. haemolyticus are resistant in varying proportions.
3.2. mecA Gene Detection
The detection of the mecA gene in all seventy methicillin-resistant CoNS strains was performed by monoplex PCR. Our results show that 28.5% (20/70) of the CoNS strains possess the searched gene (Figure 2). Thus, S. xylosus (8/12), S.
lugdunensis (2/6), S. capitis (2/10), S. sciuri (2/10), S. lentus (2/2), S. haemolyticus (2/4) and S. epidermidis (2/6) possess the mecA gene. Inside the MR-CoNS species studied, the mecA gene is most present in S. xylosus strains (40%).
3.3. SCCmec Typing
To assess the distribution of SCCmec in CoNS, Multiplex PCR was done. Analysis revealed the presence of one of the three SCCmec in twelve (17.14%) of the seventy CoNS strains studied (Figure 3, Table 2). Among the mecA+ strains, four (40%) were found to carry one of the three SCCmec. Thus, SCCmec types I, II and III alone or in combination with another SCCmec were distributed among twelve CoNS strains. However, it was observed that among the strains carrying at least one of the three SCCmec type, two CoNS strains (S. cohnii and S. sciuri) carry SCCmec lacking the mecA gene. Our results also show that SCCmec type I, either alone or in combination, is the most frequent SCCmec in the CoNS strains studied. Indeed, it was identified alone and in combination with SCCmec type III (n = 4). The other type of SCCmec identified was SCCmec type II and it was identified as many times as SCCmec type III. This study also shows a high genetic diversity of SCCmec within the MR-CoNS since 60% of
mecA gene and SCCmec repartition in CoNS species
Genes
S. xylosus
S. lentus
S. cohnii
S. hominis
S. schleifeiri
S. lugdunensis
S. capitis
S. sciuri
S. haemolyticus
S. epidermidis
mecA
8
2
-
-
-
2
2
2
2
2
SCCmec I
1
-
-
-
-
-
-
1
-
-
SCCmec II
1
-
1
-
-
-
-
-
-
-
SCCmec III
-
-
-
-
-
-
-
-
-
-
SCCmec I + III
-
-
-
-
-
-
1
-
-
1
Non-typeables
10
2
7
10
2
2
9
9
4
5
Total
12
2
8
10
2
6
10
10
4
6
mecA+ strains could not be typed (Figure 3, Table 2).
4. Discussion
CoNS are ubiquitous bacteria with a strong adaptive capacity and are among the most common germs isolated in hospitals. For a long time considered not very pathogenic, they are, as shown by recent studies, more and more incriminated in health care associated infections [14]. The increase in antibiotic-resistant strains of CoNS increases the pathogenicity of these strains and complicates the treatment of patients with infections caused by these bacteria [15]. This study therefore focused on the determinism of CoNS strains carrying the mecA gene and its genetic carrier SCCmec. It was found that all CoNS strains in this study were resistant to methicillin when tested on MH agar medium. Results from many other studies have shown that the antibiotic resistance rate of CoNS to methicillin is greater than 50% [16] [17]. However, other studies have shown that the resistance rate is much lower, below 50% [15] [18]. Also, the MRCoNS strains that are resistant to the beta-lactam class antibiotics are also susceptible to showing resistance to another class of antibiotics. Indeed, the gene coding for methicillin resistance is carried by the SCCmec, a mobile genetic element that can carry resistance genes to other antibiotics [19]. In the study made by Socohou and al., CoNS strains with methicillin resistance showed resistance to other antibiotics such as fosfomycin, erythromycin and vancomycin [13]. Bhowmik and al. showed in their study that methicillin-resistant S. aureus strains also show resistance to other antibiotics such as clindamycin, linezolid or erythromycin and that this antibiotic resistance is a function of the SCCmec carried by S. aureus strains [20]. In our study, S. xylosus is the species most represented among the methicillin-resistant CoNS strains. It constitutes 17.14% of the MRCoNS species studied at the expense of S. epidermidis, S. capitis, S. hominis, S. lugdunensis. This unusual rather finding may be a function of the origin and location of sampling as well as the size of the samples [15] [20] [21].
It is also noted that not all CoNS strains with methicillin resistance have the mecA gene. Indeed, only 20 (28.5%) of 70 methicillin-resistant strains carried the researched gene, a percentage that is much higher than that recorded by Xu et al. [20]. This result could be explained by the heterogeneity of the expression of methicillin resistance in CoNS strains. In addition, several factors are susceptible to influence the expression of this resistance in these strains [22] [23]. In fact, Ph, temperature and salt concentration can affect the expression of methicillin resistance in CoNS strains. In addition, there are other mechanisms of methicillin resistance in coagulase-negative staphylococci [24]. Also, according to the CNRS CoNS strains with true methicillin resistance and with the mecA gene in their genome are quite rare [25]. Although having high scores, methods for phenotypic detection of methicillin resistance would not be as reliable as genotypic methods for detecting resistance to this class of antibiotics. In this regard, the work of Asante et al. shows that 05 strains of CoNS with the mecA gene were not detected as mecA+ after their resistance to methicillin was assessed phenotypically [16].
SCCmec are mobile genetic elements and also genetic carriers the mecA gene, the gene governing methicillin resistance. Several types of SCCmec have been identified among the staphylococcal strains responsible for healthcare-associated infections. Thus, in this study, type I, II and III SCCmec were detected in only 12 CoNS strains (17.14%) with cefoxitin resistance and in 8 CoNS strains (40%) with the mecA gene in their genome. The three types of SCCmec investigated in this study are the types of staphylococcal chromosomal cassette most often identified in staphylococcal strains responsible of healthcare associated infections and therefore logically predominate over other SCCmec such as SCCmec types IV, V, VI, VII and VIII often found in cases responsible for the community associated infections [25] [26]. Our results show that in this study there are fewer CoNS strains carrying the mecA gene as well as one of the SCCmec types I, II and III than CoNS strains carrying the mecA gene and not typable for one of the three SCCmec types searched (60%). This shows that the SCCmec types I, II and III previously frequently identified in MRCoNS strains are being replaced by the smaller SCCmec types IV and V. Other studies have found similar results to ours in that the most frequent SCCmec identified in MRCoNS strains were not type I, II or III [18] [20] [27] [28]. The current preponderance of type IV, V, VI, VII and VIII SCCmec in hospital associated MRCoNS strains can be explained by the small size of these chromosomal cassettes. Indeed, their small size favors their displacement and transmission from one strain of CoNS to another. Furthermore, the great diversity of SCCmec within CoNS strains would also explain the fact that not all the strains studied could be typed. Then, they could carry one of the other SCCmec identified to date [29].
The identification of CoNS strains possessing SCCmec and lacking the mecA gene in their genome would mean that these strains may have lost the researched gene. Indeed, although SCCmec are generally stable once within a staphylococcal strain, they can be damaged if certain conditions are met. For example, there have been cases where SCCmec lack the mecA gene. This may be caused by long storage of CoNS strains at low temperature (−80˚C). Similar results were obtained in other studies where S. aureus strains lost the mecA gene complex after long storage of these strains at low temperature [30] [31]. In such cases, the SCCmec although retained within the CoNS strain would lack the mecA gene and this strain would be mecA− after PCR although carrying a SCCmec. This may be the case in this study as the strains studied were stored at low temperature for a significant period of time.
In view of the significant number of CoNS with the methicillin resistance gene and staphylococcal chromosomal cassette in this study, it’s clear that this group of bacteria shouldn’t be neglected in daily practice as multidrug resistance is a major constraint in the treatment of infections caused by these bacteria. It’s therefore necessary not only to carry out more in-depth studies on this bacterial group but also to adopt measures to improve hygiene in hospitals in order to limit possible contamination that could lead to infections.
5. Conclusion
Often neglected because their pathogenicity is much weaker than that of S. aureus strains, CoNS are nowadays incriminated in many cases of nosocomial infections. Our results show that CoNS strains present a high resistance to methicillin and the source of this resistance in the CoNS of our study is not only the mecA gene. It’s therefore essential to evaluate their antibiotic susceptibility profiles and to determine the source of their resistance to these antibiotics in order to prescribe appropriate antibiotic therapy. This study also shows a high diversity of SCCmec in CoNS strains isolated from surfaces and medico-technical materials of the University Hospital of Abomey-Calavi/Sô-Ava (South Benin), as shown by the large number of non-typeable CoNS strains. The mecA− SCCmec+ meticillin resistant strains deserve to be sequenced for further studies. All three types of SCCmec sought were identified in this study but a large number of mecA+ CoNS strains could not be typed for the I, II and III SCCmec. Then, these strains should be typed for one of the thirteen other SCCmec identified to date. These staphylococcal chromosomal cassettes, which carry the mecA gene, may also be the genetic carriers of many other antibiotic resistance genes. The mobility of these genetic elements could then favor their movement between the different CoNS strains by horizontal transfer, a hypothesis that was verified since one of the SCCmec studied was detected in the CoNS strains. More attention should also be paid to CoNS, their antibiotic resistance profile, the genes that mediate antibiotic resistance and their genetic backbone. Meticillin-resistant strains with mecA− SCCmec+ genotype deserve to be sequenced for further study. We also plan to search for other types of staphylococcal chromosome cassette in non-typeable CoNS. On the other hand, whole genome sequencing will help to understand the mechanism of acquisition of the mecA gene in strains that do not carry the staphylococcal chromosome cassette mec.
Acknowledgements
We thank all the staff of the Laboratory of Biology and Molecular Typing in Microbiology of University of Abomey-Calavi, Benin and the laboratory of Molecular Biology and Bioinformatics Applied to Genomics of National University of Sciences, technologies, engineering and mathematics of Abomey, Benin for their help and collaboration in the development of this study.
Conflicts of Interest
The authors declare no conflicts of interest regarding the publication of this paper.
Cite this paper
Chimene, N., Fresnel, C., Gustave, D., Haziz, S., Akim, S., Aurel, D., Enorck, K., Farid, B., Clémént, A. and Saïd, B.-M.L. (2022) Diversity and Distribution of Staphylococcal Chromosomal Cassettes Mec (SCCmec) Types I, II and III in Coagulase-Negative Staphylococcal Strains Isolated from Surfaces and Medico-Technical Materials of the University Hospital of Abomey-Calavi/Sô-Ava. American Journal of Molecular Biology, 12, 122-133. https://doi.org/10.4236/ajmb.2022.123011
ReferencesValencia-Rey, P., Weinberg, J., Miller, N.S. and Barlam, T.F. (2015) Coagulase-Negative Staphylococcal Bloods Tream Infections: Does Vancomycin Remain Appropriate Empirictherapy? Journal of Infection, 71, 53-60.
https://doi.org/10.1016/j.jinf.2015.02.007Lowy, F.D. (1998) Staphylococcus aureus Infections. New England Journal of Medicine, 339, 520-532. https://doi.org/10.1056/NEJM199808203390806Bush, L.M. (2019) Le Manuel MSD Version pour le grand public.
https://www.msdmanuals.comMalachowa, N. and Deleo, F.R. (2010) Mobile Genetic Elements of Staphylococcus aureus. Cellular and Molecular Life Sciences, 67, 3057-3071.
https://doi.org/10.1007/s00018-010-0389-4Besnier, J.M., Bastides, F. and Choutet, P. (1997) Thérapeutique des infections à Staphylococcus aureus sensible à la méticilline (SAMS). Médecine et Maladies Infectieuses, 27, 225-240. https://doi.org/10.1016/S0399-077X(97)80024-8Drawz, S.M. and Bonomo, R.A. (2010) Three Decades of bêta-lactamase Inhibitors. Clinical Microbiology Reviews, 23, 160-201. https://doi.org/10.1128/CMR.00037-09Wolff, K.A., Sherman, M. and Nguyen, L. (2011) Chapter 8. Potentiation of Available Antibiotics by Targeting Resistance—An Emerging Trend in Tuberculosis Drug Development. In: Rundfeldt, C., Ed., Drug Development—A Case Study-Based Insight into Modern Strategies, Intech Publisher Inc., London, 183-208.Chambers, H.F. and Deleo, F.R. (2009) Waves of Resistance: Staphylococcus aureus in the Antibiotic Era. Nature Reviews. Microbiology, 7, 629.
https://doi.org/10.1038/nrmicro2200García-álvarez, L., Holden, M.T., Lindsay, H., Webb, C.R., Brown, D.F. and Curran, M.D. (2011) Meticillin-Resistant Staphylococcus aureus with a Novel mecA Homologue in Human and Bovine Populations in the UK and Denmark: A Descriptive Study. The Lancet Infectious Diseases, 8, 595-603.
https://doi.org/10.1016/S1473-3099(11)70126-8Katayama, Y., Takeuchi, F., Ito, T., Ma, X.X., Ui-Mizutani, Y., Kobayashi, I. and Hiramastu, K. (2003) Identification in Methicillin-Susceptible Staphylococcus hominis of an Active Primordial Mobile Genetic Element for the Staphylococcal Cassette Chromosome mec of Methicillin-Resistant Staphylococcus aureus. Journal Bacteriology, 185, 2711-2722. https://doi.org/10.1128/JB.185.9.2711-2722.2003Ganga, R., Riederer, K., Sharma, M., Fakih, M.G., Johnson, L.B., Shemes, S. and Khatib, R. (2009) Role of SCCmec Typein Outcome of Staphylococcus aureus Bacteremia in a Single Medical Center. Journal of Clinical Microbiology, 47, 590-595.
https://doi.org/10.1128/JCM.00397-08Socohou, A., Sina, H., Degbey, C., Nanoukon, C., Chabi Sika, K., Ahouandjinou, H., Lehmane, H., Baba-Moussa, F. and Baba-Moussa, L. (2020) Antibiotics Resistance and Biofilm Formation Capacity of Staphylococcus spp. Strains from Isolated Surfaces and Medicotechnical Materials. International Journal of Microbiology, 2020, Article ID: 6512106. https://doi.org/10.1155/2020/6512106European Committee on Antimicrobial Susceptibility Testing (EUCAST) (2019) Recommendations, European Committee on Antimicrobial Susceptibility Testing, Varjo, Sweden.Becker, K., Heilmann, C. and Peters, G. (2014) Coagulase-Negative Staphylococci. Clinical Microbiology Reviews, 27, 870-926. https://doi.org/10.1128/CMR.00109-13Rakotozandrindrainy, N. (2018) Identification et caractérisation des Staphylocoques à Coagulase Négative résistants à la méthicilline isolés d’échantillons sanguins de patients fébriles dans les centres de santé de la région Analamanga-Antananarivo. Mémoire, Université D’Antananarivo, Madagascar.Oliveira, A.D.D., d’Azevedo, P.A., De Sousa, L.B., Viana-Niero, C., Francisco, W., Lottenberg, C., Dalla, M., Martino, V. and Hofling-Lima, A.L. (2007) Laboratory Detection Methods for Methicillin Resistance in Coagulase Negative Staphylococcus Isolated from Ophthalmic Infections. The Arquivos Brasileiros Oftalmologia, 70, 667-675. https://doi.org/10.1590/S0004-27492007000400018Asante, J., Hetsa, B.A., Amoako, D.G., Abia, A.L.K., Bester, L.A. and Essack, S.Y. (2021) Multidrug Resistant Coagulase-Negative Staphylococci Isolated from Bloodstream in the Umgungundlovu District of KwaZulu-Natal Province in South Africa: Emerging Pathogens. Antibiotics, 10, 198.
https://doi.org/10.3390/antibiotics10020198Seng, R., Leungtongkam, U., Thummeepak, R., Chatdumrong, W. and Sitthisak, S. (2017) High Prevalence of Methicillin-Resistant Coagulase-Negative Staphylococci Isolated from a University Environment in Thailand. International Microbiology, 20, 65-73.Bhowmik, D., Dasa, B.J., Pandeya, P., Chetria, S., Chanda, D.D. and Bhattacharjeea, A. (2019) Anarray of Multiplex PCR Assays for Detection of Staphylococcal Chromosomal Cassette mec (SCCmec) Types among Staphylococcal Isolates. Journal of Microbiological Methods, 166, Article ID: 105733.
https://doi.org/10.1016/j.mimet.2019.105733Xu, Z., Shah, H.N., Misra, R., Chen, J., Zhang, W., Liu, Y., Cutler, R.R., Mkrtchyan, V.H., et al. (2018) The Prevalence, Antibiotic Resistance and mecA Characterization of Coagulase Negative Staphylococci Recovered from Non-Healthcare Settings in London, UK. Antimicrobial Resistance and Infection Control, 7, 73.
https://doi.org/10.1186/s13756-018-0367-4Chen, X., Li, W., Zheng, H., Du, H., Zhang, L., Zhang, L., Che, J., Wu, Y., Liu, S. and Lu, J. (2017) Extrême Diversity and Multiple SCCmec Elements in Coagulase-Negative Staphylococcus Found in the Clinic and Community in Beijing, China. Annals Clinical Microbiology Antimicrobials, 16, 57.
https://doi.org/10.1186/s12941-017-0231-zHussain, Z., Stoakes, L., Lannigan, R., Longo, S. and Nancekivell, B. (1998) Evaluation of Screening and Commercial Methods for Detection of Methicillin Resistance in Coagulase-Negative Staphylococci. Journal of Clincali Microbiology, 36, 273-274.
https://doi.org/10.1128/JCM.36.1.273-274.1998Garza-Gonzalez, E., Morfin-Otero, R., Llaca-Diaz, J.M. and Rodriguez-Noriega, E. (2010) Staphylococcal Cassette Chromosome mec (SCCmec) in Methicillin-Resistant Coagulase-Negative Staphylococci. A Review and the Experience in a Tertiary-Care Setting. Epidemiology and Infection, 138, 644-654.
https://doi.org/10.1017/S0950268809991361Boisset, S. (2020) Résistances Aux Antibiotiques Chez Les Bactéries à Gram Positif. UFR Médecine-Université Grenoble Alpes, Grenoble.Centre national de référence des Staphylocoques (2020) Rapport annuel d’activité CNR des Staphylocoques. Centre National de Référence, 28-30.Ito, T., Katayama, Y., Asada, K., Mori, N., Tsutsumimoto, K., Tiensasitorn, C. and Hiramatsu, K. (2001) Structural Comparison of Three Types of Staphylococcal Cassette Chromosome mec Integrated in the Chromosome in Methicillin-Resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy, 45, 1323-1336.
https://doi.org/10.1128/AAC.45.5.1323-1336.2001Hiramatsu, K., Katayama, Y., Yuzawa, H. and Ito, T. (2002) Molecular Genetics of Methicillin-Resistant Staphylococcus aureus. International Journal of Medical Microbiology, 292, 67-74. https://doi.org/10.1078/1438-4221-00192Oliveira, D.C. and Tomasz, A.L.H. (2002) Secrets of Success of a Human Pathogen: Molecular Evolution of Pandemic Clones of Methicillin-Resistant Staphylococcus aureus. The Lancet Infectious Diseases, 2, 180-189.
https://doi.org/10.1016/S1473-3099(02)00227-XXu, Z., Shi, L., Alam, M.J., Li, L. and Yamasaki, S. (2008) Integron-Bearing Methicillin-Resistant Coagulase-Negative Staphylococci in South China 2001-2004. FEMS Microbiology Letters, 278, 223-230.
https://academic.oup.com/femsle/article/278/2/223/513107
https://doi.org/10.1111/j.1574-6968.2007.00994.xVan Griethuysen, A., van Loo, I., Van Belkum, A., Vandenbroucke-Grauls, C., Wannet, W., van Keulen, P. and Kluytmans, J. (2005) Loss of the mecA Gene during Storage of Methicillin-Resistant Staphylococcus aureus (MRSA) Strains. Journal of Clinical Microbiology, 43, 1361-1365.
https://doi.org/10.1128/JCM.43.3.1361-1365.2005Olayinka, B.O., Olayinka, A.T., Obajuluwa, A.F., Onaolapo, J.A. and Olurinola, P.F. (2009) Absence of meca Gene in Methicillin-Resistant Staphylococcus aureus Isolates. African Journal of Infectious Diseases, 3, 49-56.
https://doi.org/10.4314/ajid.v3i2.55081