Samples of secondary (activated sludge) and tertiary (filtration and disinfection) treated wastewater samples were collected from two wastewater treatment plants in the central part of Israel. Plant A serves 240,000 inhabitants and Plant B serves 44,000 inhabitants. In both plants, the treatment process consists of primary settling, activated sludge, secondary settling, sand filtration and disinfection by either chlorine (Plant A) or UV irradiation (Plant B). In plant A, total suspended solids (TSS) were reduced from 344 mg/L to 4.5 mg/L and the biological oxygen demand (BOD₅) was reduced from 275 mg/L to 3.9 mg/L. In plant B, TSS was reduced from 430 mg/L to 4.4 mg/L and BOD₅ was reduced from 270 mg/L to 4.6 mg/L. The quality of the effluent produced must be within the Israel Standard for unrestricted irrigation [21] and most of the produced effluents are used for irrigation. The two volumes of collected wastewater samples to be analyzed were as follows: secondary treated effluent 10 L and tertiary treated effluents 50 L, depends on sample turbidity. Turbidity was measured with 2100p portable turbidity meter (Hatch, Loveland, CO, USA). Grab samples were collected once a month and samples were transported to the laboratory within 2 hours and further analyzed for FC and for the detection of Giardia cysts and Cryptosporidium oocysts.

Fecal coliform (FC) were enumerated on highly selective medium mFC according to Standard Methods [22]. Blue colonies were enumerated and considered FC.

Secondary and tertiary effluent samples were filtered through an Envirochek HV (Pall Laboratories, Washington, USA) filter followed by procedures described in Method 1623.1 of the U.S. Environmental Protection Agency (EPA) [15]. Trapped material on filter was eluted with 250 mL eluate solution (10 ml Laureth −12, 10 ml Tris 1M, pH = 7.4, 2 ml EDTA 1M and 0.15 ml Anti-foam in one liter of distilled water) and then the eluate was centrifuged for 15 min at 1100 × g to concentrate cysts and oocysts. Concentrated parasites were then affinity purified and re-concentrated by immuno-magnetic separation using magnetic beads coated with anti-Cryptosporidium and anti-Giardia monoclonal antibodies according to manufacturer-recommended procedure. At this stage, 50% of the purified sample was examined by immuno-fluorescent staining and microscopic enumeration with an epi-fluorescent microscope (Zeiss, AxioCam MRc). In parallel, the other 50% concentrated sample was used to determine Cryptosporidium oocysts infectivity in cell culture.

Infectious Cryptosporidium was cultivated in human intestinal adenocarcinoma cell-lines (HCT-8) (ATCC CCL 244). HCT-8 cells were cultured and maintained in 25 cm² tissue culture flasks at a constant CO₂ atmosphere (5%) at 37˚C. Cells and HCT-8 cells grown in RPMI medium supplemented with calf serum (5%) were passaged once a week. HCT-8 cells were grown on sterile glass coverslips for Cryptosporidium oocysts infectivity determination. Cells were grown up to 70% to 95% confluence before infection. Experimentally separated oocysts, already attached to magnetic beads were incubated in fresh HBSS (pH = 2) 198 µl, containing 2 µl of trypsin (10%), 9 µl HCl (1N) while a positive control (approx.10⁵ oocysts/ml) was incubated in 20 µl (HBSS, pH = 2) containing 2 µl trypsin (10%), 9 µl HCl (1N) for 1 hour at 37˚C with thorough vortex every 15 minutes. Warm RPMI medium (300 µl) was added carefully to oocysts suspension and sporozoites were concentrated by centrifugation for 4 minutes at 2080 × g. The supernatant was aspirated and the pellet containing sporozoites was suspended in 600 µl RPMI medium for further wash. Centrifugation step was repeated for 4 minutes at 2080 × g and finally washed sporozoites were suspended in 600 µl RPMI medium.

Cryptosporidium infection of HCT-8 cell cultures was accomplished as follows: 1) aspiration of maintenance medium from the cell monolayers; 2) experimental sporozoites samples were added to cells and incubated for 1 hour under CO₂ (5%) atmosphere at 37˚C; 3) then warm growth medium (1.5 ml) was added to infected cell layer and incubated further for additional 72 hours.

To detect Cryptosporidium infected HCT-8 cells, monolayers were dried at room temperature (24˚C ± 2˚C) and fixed with absolute methanol. Then, dried cells were incubated with anti-sporozoite antibodies (Waterborne, Baton Rouge, Lo) for 1 hr at room temperature. The infected cultures were then washed with sterile PBS (0.01 M) and finally air-dried and a 10 µl aliquot of DABCO (2%) was added to each sample and a cover slip was mounted. For the enumeration of infected cells (foci), epi-fluorescent microscope was applied.

Infected cells were washed with warm PBS (10 mM) and warm EDTA-trypsin solution (2 ml), then washed cells were incubated in EDTA-trypsin (2 ml) for 5 minutes in CO₂ atmosphere (5%) at 37˚C. After incubation, cells were transferred to an Eppendorf tube (1.5 ml) and centrifuged for 15 minutes at 6000 × g, the supernatant was discarded and the pellet (concentrated cells) were resuspended in PBS buffer (200 µl). DNA was extracted from those infected cells using QIAamp DNA mini kit (QIAamp DNA blood mini kit, Qiagen GmbH, Germany) according to manufacturer’s instructions with minor modifications. Purified DNA samples were stored at −80˚C for future analysis.

PCR primers specific to C. parvum hsp70 gene were used, which resulted in a 300-bp product. The primer sequences were as follows: forward primer 5'AGTGACAAGAATAACAATACAGG3' and reverse primer 5'CCTGCTTTAAGC ACTCTAATTT3' [23]. PCR was performed with a SimpliAmp model thermo-cycler. The 20 µl PCR mixtures contained 10 µl PCR Mixture, 2 µl reverse primer, 2 µl forward primer, 4 µl Nuclease-Free Water and 2 µl DNA sample. C. parvum template DNA was used as PCR positive control, and molecular grade water was used as negative control. The amplification conditions were as follows: initial denaturation at 96˚C for 5 min; 35 cycles of denaturation at 95˚C for 30 s and annealing at 60˚C for 30 s; extension for 30 s at 72˚C and then a final extension at 72˚C for 7 min. Amplification products were separated by horizontal gel electrophoresis in agarose gel (1%) (CSL-Cleaver Scientific) and visualized under UV light. Gel images were captured using a gel documentation system.

Cell culture growth medium was transferred to Eppendorf tube (1.5 ml) and centrifuged for 15 minutes at 6000 × g. Concentrated sporozoites from medium of infected cultures were suspended in 200 µl buffer (PBS). DNA was extracted and then subjected to PCR as previously described for infected cell culture.

Giardia cysts were present in all secondary effluent samples at an average concentration of 213.8 ± 44.0 cysts/10L, while average concentration of Cryptosporidium oocysts was lower compared to Giardia cysts at an average concentration of 6.9 ± 4.0 oocysts/10L. Gravitational filtration was found to be more efficient compared to rapid sand filtration in the removal of Giardia cysts: 1.2 ± 0.7 cyst/10L and 45.7 ± 29.3 cysts/10L, respectively. Since Cryptosporidium oocyst levels in secondary effluent were very low, the observed difference observed between their removal efficiency by gravitational filtration and rapid sand filtration are negligible. Fecal coliform detected levels in effluents treated by rapid sand filtration and UV disinfection were significantly higher compared to those subjected to gravitational filtration and chlorine (Table 1). These results indicate that the majority of analyzed samples, treated by means of filtration and chlorine disinfection were within the limit of guidelines of effluents used for unrestricted irrigation. On the other hand, the levels of FC in effluents treated by filtration and UV were higher and exceeded the standards for unrestricted irrigation. It is worth noting that the turbidity levels of effluents treated by gravitational filtration or high rate filtration were comparable and averaged 1.7 ± 0.3 NTU, indicating that turbidity removal may be correlated with Cryptosporidium oocysts removal but not to Giardia cysts and fecal coliform. Previous studies had shown that wastewater secondary treatment based on activated sludge, did not reduce Cryptosporidium oocysts levels nor its infectivity; hence this study relied on

established data it was mainly designed to determine Cryptosporidium infectivity reduction by advanced treatment processes of wastewater effluents [12] [24].

The effect of secondary effluent on the detection of infectious Cryptosporidium in tissue culture was compared with their detection in deionized water. Cryptosporidium oocysts were seeded simultaneously in secondary effluent and in deionized water. Following excystation enhancement process, oocysts were inoculated onto HCT-8 cells. Twenty-five infectious zones were detected from seeded deionized water samples, while only 10 infectious zones were detected in seeded secondary effluent. These results indicate that secondary effluent constituents reduce infection efficiency of Cryptosporidium in HCT-8 cell culture. The effect of organic matter concentration coupled with oocysts centrifugation process on infection efficiency was compared to Cryptosporidium oocysts concentrated and purified by IMS method. Oocysts purified by IMS method revealed 20 infectious zones while after simple pelleting (containing higher organic matter) only one infectious zone was detected. Finally, in order to determine the highest efficient solution that can successfully release attached oocysts from the immune magnetic beads, Hank’s Balanced Salt Solution Buffer (pH = 2) (HBSS) was compared to HCl (0.1N solution(. Application of HBSS resulted in 15 infectious zones, while using HCl (0.1N) 55 infectious zones were detected.

Cryptosporidium oocysts were detected in 7 out of 7 (100%) secondary effluent samples by IFA at an average concentration of 6.8 ± 4.4 oocysts/10L. Furthermore, infectious oocysts were detected by cell culture in 7 out of 7 (100%) secondary effluent samples at an average concentration of 1.7 ± 0.7 foci/10L. However, with cell culture PCR method (CC-PCR), only 2 out of 7 (28.6%) samples were found positive indicating that infection detection by cell culture and IFA is far more sensitive compared to CC-PCR (Table 2). PCR method was applied to detect Cryptosporidium in infected HCT-8 cells [18] [25]. Although these methods are highly specific, sensitive and able to screen a large number of samples, PCR based detection had been reported to yield false positive results from mock infections [26]. These authors have also demonstrated IFA superiority over PCR in detecting Cryptosporidium infectivity based on qualitative and quantitative measures [26]. These observations are compatible with results obtained in same study concerning comparison between IFA and PCR for the detection of infectious Cryptosporidium originating from secondary effluent (Table 2).

Even though Cryptosporidium levels in secondary and tertiary effluent were

relatively low, infectious Cryptosporidium foci were detected in 5 out of 7 (71.4%) samples of tertiary effluent samples disinfected by chlorine while no infectious Cryptosporidium foci was detected in UV disinfected effluent samples (Table 3).

Along the train of multi-barrier wastewater treatment, disinfection is considered an important barrier for the reduction of pathogens levels in order to avoid their environmental transmission through wastewater effluents reuse or discharge to receiving water bodies. For decades, chlorination was applied in water and wastewater disinfection, as the final step in multi-barrier train of water treatment plants. The presented results, clearly demonstrate that FC, the conventional microbial water quality indicator is sensitive to chlorine applied for effluent disinfection. FC concentrations were below the standard for unrestricted irrigation (<10 cfu/100ml) when chlorine had been applied. Nevertheless, infectious Cryptosporidium foci were detected in 5 out of 7 effluent samples disinfected by chlorine (Table 3). The present results are in agreement with previously reported data concerning the resistance of Cryptosporidium oocysts to chlorine disinfection. Hirata et al. 2001 reported that CT (C = the concentration of chlorine X multiplied by T = exposure time) in the range of 800 to 900 mg min/L is needed to yield one log reduction in Cryptosporidium infectivity; and further estimation that a CT of 2700 mg^.min/L will be needed for a 3 log reduction of Cryptosporidium oocysts infectivity in animals [27]. High resistance of Cryptosporidium to free chlorine and monochloramine was already demonstrated by Rennecker et al. (2000), who reported a CT of approximately 2000 mg min/L and 12,000 mg min/L will be required to reach an inactivation of 99.9% of Cryptosporidium parvum by chlorine and monochloramine, respectively [28].

Results of the present study demonstrated that UV irradiation is highly

efficient in the reduction of infectious Cryptosporidium oocysts present in filtered effluents. These results are compatible with previously reported data [29] [30] [31]. Different studies demonstrated the effectiveness of low UV irradiation doses to inactivate Cryptosporidium oocysts in various water environments. For example, Morita et al. (2002) showed that a UV dose of 1.0 mWs/cm² at 20˚C was needed to yield a 2-log10 reduction in oocysts infectivity (99% inactivation). Following fluorescent-light irradiation treatment, no infectivity was observed after exposure to or storage in darkness, indicating that the effect of UV irradiation on Cryptosporidium oocysts (determined by animal infectivity) can be conclusively considered irreversible [30].