<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">JBM</journal-id><journal-title-group><journal-title>Journal of Biosciences and Medicines</journal-title></journal-title-group><issn pub-type="epub">2327-5081</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/jbm.2022.106002</article-id><article-id pub-id-type="publisher-id">JBM-117741</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  HindIII and MseI in the Biomolecular Profile of Hemophilia in Cameroon: A Primer Study
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Nsa’Amang</surname><given-names>Carolle Eyebe</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Eyebe</surname><given-names>Serge Eyebe</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kengne</surname><given-names>Jean Paul Chedjou</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tah</surname><given-names>Calvino Fomboh</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Aurélien</surname><given-names>Chendjou</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Verdiane</surname><given-names>Mabopda</given-names></name><xref ref-type="aff" rid="aff6"><sup>6</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Claude</surname><given-names>Tayou</given-names></name><xref ref-type="aff" rid="aff6"><sup>6</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Fon</surname><given-names>Wilfred Mbacham</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>The Biotechnology Centre, University of Yaounde I, Yaounde, Cameroon</addr-line></aff><aff id="aff5"><addr-line>European Institute for Cooperation and Development Delegation, Yaoude, Cameroon</addr-line></aff><aff id="aff3"><addr-line>Department of Biochemistry and Molecular Biology, Faculty of Science, University of Buea, Buea, Cameroon</addr-line></aff><aff id="aff4"><addr-line>Department of Biochemistry, Faculty of Science, University of Yaounde I, Yaounde, Cameroon</addr-line></aff><aff id="aff6"><addr-line>The University Teaching Hospital, Yaoude, Cameroon</addr-line></aff><aff id="aff2"><addr-line>Faculty of Medicine and Biomedical Sciences, University of Yaounde I, Yaounde, Cameroon</addr-line></aff><pub-date pub-type="epub"><day>30</day><month>05</month><year>2022</year></pub-date><volume>10</volume><issue>06</issue><fpage>8</fpage><lpage>19</lpage><history><date date-type="received"><day>24,</day>	<month>April</month>	<year>2022</year></date><date date-type="rev-recd"><day>7,</day>	<month>June</month>	<year>2022</year>	</date><date date-type="accepted"><day>10,</day>	<month>June</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Numerous studies are being carried out on polymorphisms within the genes coding for factors VIII and IX due to their clinical relevance in the context of hereditary disorders. The quests for polymorphism can be used to screen for haemophilia through an affected family. In Cameroon, very few studies on factors VIII and IX gene polymorphisms have been conducted. Thus, this study was aimed at detecting HindIII SNP of the F8 gene and MseI SNP of the F9 gene by the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RLFP) method and determining their involvement in the severity and complications of haemophilia. Fifty-five consented haemophilia patients from the 
  <em>Centre Hospitalier et Universitaire de Yaound&#233;</em> (CHUY) were recruited for this study on a convenience sampling basis. Finger-prick blood was collected and spotted on filter papers from which DNA was extracted and then subjected to the PCR-RFLP. We were able to recruit 55 (37.16%) patients out of the 148 haemophilia patients registered at the CHUY until December 2018. The average age was 15 years. Of the 55 haemophilia patients, 42 (76.36%) had type A haemophilia and 13 (23.64%) had type B haemophilia, 41 patients (74.55%) had a severe form, 10 (18.18%) had a moderate form and 4 (7.27%) a mild form). Of the 55 patients recruited, 38 (69.09%) already had an osteoarticular complication and the remaining 17 (30.91%) had no complication. Fifty-three (96.36%) participants had HindIII SNP and a significant association was found with the severity of hemophilia (P = 0.00). No association (P = 0.56) was found with osteoarticular complications of haemophilia. On the other hand, 15 (27.27%) participants were diagnosed with MseI SNPs and no association was found with the severity (P = 0.89) or complications (P = 0.68) of haemophilia.
 
</p></abstract><kwd-group><kwd>Haemophilia</kwd><kwd> SNP HindIII</kwd><kwd> SNP MseI</kwd><kwd> PCR-RFLP</kwd><kwd> Cameroon</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Life is not possible without blood. Blood loss is not just accidental; there are those related to blood abnormalities, among which hemophilia which is a constitutional hemorrhagic disease, is seriously at risk of fatal hemorrhage, linked to the X chromosome and transmitted genetically according to a recessive mode [<xref ref-type="bibr" rid="scirp.117741-ref1">1</xref>]. This genetic anomaly is characterized by a deficiency of factor VIII (haemophilia A) with an occurrence rate of around 1 in 5000 male births and factor IX (haemophilia B) with an occurrence rate of around 1 in 30,000 male births [<xref ref-type="bibr" rid="scirp.117741-ref2">2</xref>]. Its prevalence is little known in Africa for several reasons: The rarity of the disease, the high cost of treating it, the insufficient number of haematology specialists and the lack of adequate laboratories for the biological diagnosis of this disease [<xref ref-type="bibr" rid="scirp.117741-ref3">3</xref>], for example, a recent study carried out in Madagascar showed only a total of 19 hemophilia [<xref ref-type="bibr" rid="scirp.117741-ref4">4</xref>]. However, it has been established that haemophilia is a ubiquitous condition that affects one in 10,000 to 12,000 births, without distinction of race or geographical region [<xref ref-type="bibr" rid="scirp.117741-ref5">5</xref>]. In Cameroon, the World Federation of Hemophilia reported that in 2016, 176 out of 23,439,189 people had hemophilia [<xref ref-type="bibr" rid="scirp.117741-ref6">6</xref>]. The first cases detected and treated in Cameroon date back to the 1970s, in the haematology department of the Yaound&#233; Hospital and University Centre (CHUY) [<xref ref-type="bibr" rid="scirp.117741-ref7">7</xref>]. The clinical manifestations associated with haemophilia correspond to uncontrolled internal haemorrhagic episodes [<xref ref-type="bibr" rid="scirp.117741-ref8">8</xref>]. The severity and frequency of these manifestations depend directly on the level of circulating plasma factor VIII or factor FIX [<xref ref-type="bibr" rid="scirp.117741-ref9">9</xref>]. The numerous bleeding episodes that individuals with severe hemophilia experience can lead to long-term disability. Recurrent joint bleedings can result in severe arthropathy, muscle atrophy, pseudo-tumors, and lead to chronic pain and impaired mobility that often requires surgery and arthroplasty to improve joint function. Haemophilia A and haemophilia B display similar clinical characteristics; however, several studies have reported possible differences [<xref ref-type="bibr" rid="scirp.117741-ref10">10</xref>]. The possible different clinical evolution of haemophilia B was initially suggested in 1959 by Quick [<xref ref-type="bibr" rid="scirp.117741-ref11">11</xref>]. He observed that haemophilia B, even in its most severe form, can be less incapacitating and disabling than haemophilia A. In some studies, severe haemophilia B has been defined with a factor IX &lt; 2% that could contribute to a less severe bleeding tendency compared to haemophilia A, usually defined with a factor VIII &lt; 1% [<xref ref-type="bibr" rid="scirp.117741-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.117741-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.117741-ref14">14</xref>]. It has also been reported that haemophilia B patients have a less severe arthropathy [<xref ref-type="bibr" rid="scirp.117741-ref15">15</xref>] and less hospital admission rate [<xref ref-type="bibr" rid="scirp.117741-ref12">12</xref>] than haemophilia A patients. Hemophilia is diagnosed in the laboratory by coagulation tests and screening and testing the inhibitor development, now the most serious complication in hemophilia, is vital for any comprehensive hemophilia treatment program to be able to provide medical treatment and eradication of inhibitors [<xref ref-type="bibr" rid="scirp.117741-ref16">16</xref>]; however, most centres around the world do not have inhibitor testing capacities. Genetic assessment of hemophilia is important to define disease biology, establish diagnosis in difficult cases, predict risk of inhibitor development, and provide a prenatal diagnosis if desired. Wherever possible, genotype analysis should be offered to all patients with hemophilia [<xref ref-type="bibr" rid="scirp.117741-ref17">17</xref>]. The mainstay of treatment for hemophilia involves replacing the missing blood coagulation factor VIII in people with hemophilia and factor IX when bleeding episodes occur (on-demand treatment) or by scheduled infusions several times per week (prophylaxis treatment). Both plasma-derived (pd) and recombinant clotting factor concentrates are suitable for these different strategies of hemophilia management [<xref ref-type="bibr" rid="scirp.117741-ref18">18</xref>]. Nowadays, many studies are being carried out on polymorphisms within the genes coding for factors VIII and IX [<xref ref-type="bibr" rid="scirp.117741-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.117741-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.117741-ref21">21</xref>]. Both factor VIII and IX genes contain two types of polymorphisms. Polymorphisms have a scientific interest of their own and are useful in fields as varied as forensics [<xref ref-type="bibr" rid="scirp.117741-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.117741-ref23">23</xref>] and the study of human evolution [<xref ref-type="bibr" rid="scirp.117741-ref24">24</xref>]. They have clinical relevance in the context of hereditary disorders in that they can be used to detect a defective (or normal) patient through an affected family. Linkage studies have been used to study carrier status and prenatal diagnosis in hemophilia A and B [<xref ref-type="bibr" rid="scirp.117741-ref25">25</xref>]. The factor VIII gene contains several SNPs, many of which fall into the subcategory of restriction fragment length polymorphisms (RFLPs), such as the alleles of BclI and HindIII RFLPs, which have very high frequencies in Black Americans compared to other ethnic groups [<xref ref-type="bibr" rid="scirp.117741-ref26">26</xref>]. Depending on the nature of the mutation that causes the disease, the affected clotting factor may be completely absent from the patient's body, or present but in a dysfunctional form [<xref ref-type="bibr" rid="scirp.117741-ref27">27</xref>]. The human factor IX gene contains several SNPs, most of which fall incidentally into the RFLP subcategory, such as the MseI SNP located at −698, so involvement has been described in cases of severe haemophilia [<xref ref-type="bibr" rid="scirp.117741-ref27">27</xref>]. These differences result in varying degrees of severity of the disease. Advances in molecular genetic technologies are becoming routinely integrated into many genetic diagnostic laboratories. Full F8 or F9 gene screening is performed by polymerase chain reaction (PCR) and Sanger sequencing, or next-generation sequencing [<xref ref-type="bibr" rid="scirp.117741-ref28">28</xref>] [<xref ref-type="bibr" rid="scirp.117741-ref29">29</xref>]. Use of these techniques is evolving and increasing internationally. The approach and use of a specific technique depend on the available technical expertise and resources. That’s why we used the RFLP-PCR method that was available to us It was noted that very few studies on polymorphisms of factor VIII and IX genes have been carried out in Africa, particularly in Cameroon. Hence our interest in determining HindIII and MseI in the Biomolecular Profile of Hemophilia in Cameroon: A Primer Study.</p></sec><sec id="s2"><title>2. Methodes</title><sec id="s2_1"><title>2.1. Study Site</title><p>The study was conducted at the Centre Hospitalier et Universitaire de Yaound&#233; (CHUY) located in the central region of Cameroon. The CHUY has a unit for the care of haemophilia patients in Cameroon, and also has a data bank on haemophilia patients. The aforementioned unit was set up thanks to the twinning programme established between the Haematology and Blood Transfusion Department of CHUY and the Haematology Unit of the University Hospital of Geneva in Switzerland since 2009.</p></sec><sec id="s2_2"><title>2.2. Enrolment Procedure, Sample Collection and DNA Extraction</title><p>Oral, written and informed consent was obtained prior to any sampling from the interviewees or their legal guarantor. Indeed, before obtaining this consent, the interviewees were informed of the objectives of the study, explaining that the information collected would be strictly anonymous and confidential. They were also informed of the guarantees taken with regard to the security of the information collected. Before obtaining their consent (signature), patients or parents of under-age patients were truly informed about the nature of the study, the risks and benefits, as well as the possibility of interrupting their participation or that of their child in the study at any time. In order to guarantee the confidentiality of the information collected, all patients selected for the study were registered with an identification code. Moreover, this study received approvals of the National Ethics Committee of Cameroon (CE N˚ 0565/CRERSHC/2018) and that of the Ethics Committee of the Faculty of Medicine and Biomedical Sciences of Yaounde (FMSB) as well as authorisations by the directors to conduct a study in the different centres (CHUY and the Biotechnology Centre of the University of Yaounde I (BTC-UYI)).</p><p>A total of 55 patients were enrolled in the study. These were all collected after completing a questionnaire on anthropometric and medical record information. Finger-prick blood was collected and spotted on filter paper then left to dry at room temperature for 24 hours, then introduced into the envelopes containing silica gel and transported to the molecular biology laboratory. In the laboratory blood spots on the filter paper were excised with a sterile pair of surgical scissors. DNA was extracted from the dried blood spots by bioling in Chelex-100 in buffered Tris-EDTA as previously described. A quantitative spectrophotometric assay of DNA was performed using a Cary 60 UV-visible spectrophotometer. Absorbance was measured at wavelengths of 260 and 280 (A 260 and A 280, respectively) nm. The absorbance quotient (OD 260/OD 280) provides an estimate of DNA purity. An absorbance quotient value of 1.8 ratio (R) 2.0 was considered to be good, purified DNA. A ratio of 1.8 is indicative of protein contamination, where as a ratio of 2.0 indicates RNA contamination. The integrity of genomic DNA was tested by resolving DNA extracts on a 0.8% agarose gel by electrophoresis, followed by visualization with ethidium bromide staining. Each DNA sample was graded, according to the electrophoretic migration of sample DNA compared with a known molecular weight marker (Fermentas, Thermo Scientific). The DNA was stored in a Tris-EDTA buffer at −20˚C until analysis and allelic discrimination analysis.</p></sec><sec id="s2_3"><title>2.3. Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP)</title><p>Two polymorphisms, HindIII of factor VIII and MseI of factor IX, were investigated using PCR-RFLP modified protocol and primer design of Graham et al. [<xref ref-type="bibr" rid="scirp.117741-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.117741-ref31">31</xref>]. The primer sequences used to amplify the factor VIII and Factor IX genes are found in <xref ref-type="table" rid="table1">Table 1</xref>. The amplification was done in a T3 thermal cycler (Biometra, UK). Each PCR cycle was performed in a total volume of 25 μL containing: nuclease-free water, 10&#215; ThermoPol buffer, 10 mM dNTPs (200 μM of each deoxyribonucleotide), 20 pmol of primer, 5 U/μL of Taq polymerase and 100 ng of DNA. For factor VIII gene, after initial denaturation at 95˚C for 5 min, 35 cycles of amplification were carried out with denaturation at 95˚C for 1min, annealing at 62˚C for 55 s and extension at 72˚C for 1 min, followed by a final extension at 72˚C for 10 min. For factor IX gene after initial denaturation at 95˚C for 7 min, 30 cycles of amplification were carried out with denaturation at 91˚C for 1 min, annealing at 60˚C for 1 min and extension at 70˚C for 3 min, followed by a final extension at 70˚C for 7 min. The RFLP reaction conditions for digestion with HindIII (for HindIII polymorphism) and MseI (for MseI polymorphism) (New England Biolabs, USA) were set at 37˚C, both for 16 h each. The products of the digestion reaction were separated on a 2% agarose gel stained with ethidium bromide.</p></sec><sec id="s2_4"><title>2.4. Statistical Analysis</title><p>The variables of interest were the presence of HindIII and MseI SNPs on the factor VIII (F8) and IX (F9) genes respectively. The main variables studied were the severity and presence of osteoarticular complications. Family history, age in years and place of residence were also studied. The data collected was qualitative in nature. A descriptive analysis was also carried out. In order to look for possible associations between the severity on the one hand and the complications on the other hand with the variables of interest, statistical tests (Chi<sup>2</sup>, Pearson and Fischer exact) were used. The statistical analysis was carried out using STATA 15 software. The degree of significance was set at 5%. A p-value of 0.05 or less was considered statistically significant.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primer sequences for the amplification of the F8 and F9 genes</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Genes</th><th align="center" valign="middle" >Primer Code</th><th align="center" valign="middle" >Nucleotide Sequences (Primers)</th><th align="center" valign="middle" >Size after PCR</th><th align="center" valign="middle" >Restriction Enzymes (RE)</th><th align="center" valign="middle" >Results from RFLP</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >Factor VIII (F8)</td><td align="center" valign="middle" >F8-S</td><td align="center" valign="middle" >5’GTGAGTAGCAGTGTGGGCAGA 3'</td><td align="center" valign="middle"  rowspan="2"  >608 bp</td><td align="center" valign="middle"  rowspan="2"  >HindIII</td><td align="center" valign="middle"  rowspan="2"  >(−): 427 and 181 bp (Wild-type) (+): 427, 100 and 81 bp (Mutant)</td></tr><tr><td align="center" valign="middle" >F8-A</td><td align="center" valign="middle" >5’CTGAAATGAAACGGGTGGAAC 3'</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Factor IX (F9)</td><td align="center" valign="middle" >F9-S</td><td align="center" valign="middle" >5’GATAGAGAAACTGGAAGTAGACCC 3'</td><td align="center" valign="middle"  rowspan="2"  >369 bp</td><td align="center" valign="middle"  rowspan="2"  >MseI</td><td align="center" valign="middle"  rowspan="2"  >(−): 83, 73 bp (Wild-type) (+): 57, 73 bp (Mutant)</td></tr><tr><td align="center" valign="middle" >F9-A</td><td align="center" valign="middle" >5’TTAGGTCTTTCACAGAGTAGAATTT 3'</td></tr></tbody></table></table-wrap><p>bp: base pair.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Study Population Characteristics</title><p>We were able to recruit 55 (37.16%) patients out of the 148 haemophilia patients registered at the CHUY until December 2018. The youngest patient was one year old and the oldest was 41 years old. The average age was 15 years. Patients between 6 and 15 years old were the most numerous (45.45%). The Western region and the Central region were the most represented with 24 patients (43.64%) and 13 patients (23.64%) respectively. The vast majority of patients 83.64% (46 patients) resided in Yaound&#233;. Of the 55 haemophilia patients, 42 (76.36%) had type A haemophilia and 13 (23.64%) had type B haemophilia, 41 patients (74.55%) had a severe form, 10 (18.18%) had a moderate form and 4 (7.27%) a mild form. Of the 55 patients recruited, 38 (69.09%) already had an osteoarticular complication and the remaining 17 (30.91%) had no complication. In addition, 34 patients (61.82%) had a family history of haemophilia, while the remaining 21 (38.18%) had no family history of haemophilia (<xref ref-type="table" rid="table2">Table 2</xref>).</p></sec><sec id="s3_2"><title>3.2. Frequencies of HindIII and MseI Polymorphism of F8 and F9 Respectively among Study Participants</title><p>After RFLP-PCR we have obtained For HindIII Polymorphism, The amplified segment was 608 bp in size. Genotypically positive (+) showed 427- and 100-bp fragments. Genotypically negative (−) showed 427-bp and 181-bp fragments. And for MseI Polymorphism the amplified segment was 557 bp in size. Genotypically positive (+) showed 176-bp fragments. Genotypically negative (−) 176-, and 81-bp fragments. Alleles were assigned for presence (+) and absence (−) (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><p>In this study, 96.36% of hemophilia patients had HindIII polymorphism, and 27.27% of hemophilia patients had MseI polymorphism (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Baseline characteristics of the study population</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Patient characteristics</th><th align="center" valign="middle" >Number of cases</th><th align="center" valign="middle" >Frequency (%)</th></tr></thead><tr><td align="center" valign="middle"  colspan="3"  >Age in categories</td></tr><tr><td align="center" valign="middle" >Less than 6 years old</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >14.55</td></tr><tr><td align="center" valign="middle" >6 - 15 years old</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >45.45</td></tr><tr><td align="center" valign="middle" >More than 15 years old</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >40</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle"  colspan="3"  >Place of residence</td></tr><tr><td align="center" valign="middle" >Others</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >16.36</td></tr><tr><td align="center" valign="middle" >Yaound&#233;</td><td align="center" valign="middle" >46</td><td align="center" valign="middle" >83.64</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle"  colspan="3"  >With family history</td></tr><tr><td align="center" valign="middle" >No</td><td align="center" valign="middle" >21</td><td align="center" valign="middle" >38.18</td></tr><tr><td align="center" valign="middle" >Yes</td><td align="center" valign="middle" >34</td><td align="center" valign="middle" >61.82</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle"  colspan="3"  >Type of haemophilia</td></tr><tr><td align="center" valign="middle" >A</td><td align="center" valign="middle" >42</td><td align="center" valign="middle" >76.36</td></tr><tr><td align="center" valign="middle" >B</td><td align="center" valign="middle" >13</td><td align="center" valign="middle" >23.64</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle"  colspan="3"  >With osteo-articular complications</td></tr><tr><td align="center" valign="middle" >No</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >30.91</td></tr><tr><td align="center" valign="middle" >Yes</td><td align="center" valign="middle" >38</td><td align="center" valign="middle" >69.09</td></tr><tr><td align="center" valign="middle"  colspan="3"  >With severity</td></tr><tr><td align="center" valign="middle" >Light</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >7.27</td></tr><tr><td align="center" valign="middle" >Moderate</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >18.18</td></tr><tr><td align="center" valign="middle" >Severe</td><td align="center" valign="middle" >41</td><td align="center" valign="middle" >74.55</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" >100</td></tr></tbody></table></table-wrap></sec><sec id="s3_3"><title>3.3. Association between HindIII and MseI Polymorphism and Severity of Hemophilia</title><p>The study between the HindIII polymorphism of the F8 gene and the severity of haemophilia showed a high significance (P = 0.001) and we observed that all patients with the severity had the HindIII polymorphism of the F8 gene. Moreover, our study revealed that there is no significant association between the HindIII polymorphism of the F8 gene and the complications of haemophilia. On the other hand, our study portrayed that there is no significant association between the MseI polymorphism of the F9 gene and the severity as well as complications of haemophilia (<xref ref-type="table" rid="table3">Table 3</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>The vast majority of haemophilia patients registered at CHUY until December 2018 were not able to participate in the study. Indeed, several authors have been confronted with this problem. This was the case of Driscoll et al. who worked on 29 men including 13 black and 16 white men in 1988 in the United States [<xref ref-type="bibr" rid="scirp.117741-ref25">25</xref>]. Similarly, Lalloz et al. worked on 25 men [<xref ref-type="bibr" rid="scirp.117741-ref32">32</xref>]. In Africa, Diop et al. worked on 54 men with haemophilia. Finally, in Cameroon, different authors have worked</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Association between HindIII and MseI polymorphism and severity of hemophilia</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  ></th><th align="center" valign="middle"  colspan="4"  >Complication</th><th align="center" valign="middle"  colspan="5"  >Severity</th></tr></thead><tr><td align="center" valign="middle" >No n %</td><td align="center" valign="middle" >Yes n %</td><td align="center" valign="middle" >Total n %</td><td align="center" valign="middle" >P</td><td align="center" valign="middle" >Mild n %</td><td align="center" valign="middle" >Moderate n %</td><td align="center" valign="middle" >Severe n %</td><td align="center" valign="middle" >Total n %</td><td align="center" valign="middle" >P</td></tr><tr><td align="center" valign="middle" >SNP HindIII of F8 gene</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Wild-type</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >5.88</td><td align="center" valign="middle" >2.63</td><td align="center" valign="middle" >3.64</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >33.33</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >3.64</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Mutant</td><td align="center" valign="middle" >16</td><td align="center" valign="middle" >37</td><td align="center" valign="middle" >53</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >40</td><td align="center" valign="middle" >53</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >94.12</td><td align="center" valign="middle" >97.37</td><td align="center" valign="middle" >96.36</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >66.67</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >96.36</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Total</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >38</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >40</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >0.56</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >0.001</td></tr><tr><td align="center" valign="middle" >SNP MseI of F9 gene</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Wild-type</td><td align="center" valign="middle" >13</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >40</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >29</td><td align="center" valign="middle" >40</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >76.47</td><td align="center" valign="middle" >71.05</td><td align="center" valign="middle" >72.73</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >66.67</td><td align="center" valign="middle" >77.78</td><td align="center" valign="middle" >72.5</td><td align="center" valign="middle" >72.73</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Mutant</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >23.53</td><td align="center" valign="middle" >28.95</td><td align="center" valign="middle" >27.27</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >33.33</td><td align="center" valign="middle" >22.22</td><td align="center" valign="middle" >27.5</td><td align="center" valign="middle" >27.27</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Total</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >38</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >40</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >0.68</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >0.89</td></tr></tbody></table></table-wrap><p>P: P value; n %: proportions in percentage.</p><p>on samples generally ranging from 9 to 40 patients. According to Doncarli et al., this difficulty is due to the irregular follow-up of minor forms of haemophilia in treatment centres [<xref ref-type="bibr" rid="scirp.117741-ref33">33</xref>]. In our context, the reason for this small sample could be due on the one hand to the refusal of some patients to participate in the study, on the other hand to the fact that many of them did not reside in the city of Yaound&#233; where we conducted the study, and also that some of the patients registered had already died at the time of the study. Three-quarters of our sample had haemophilia type A. This corroborates the global statistics. For example, Doncarli et al. in one of the largest cohort studies in 2005 in France found a trend almost identical to our sample [<xref ref-type="bibr" rid="scirp.117741-ref33">33</xref>]. Furthermore, the vast majority of patients were suffering from severe forms as opposed to the much less common mild forms. On this subject, the literature consulted is not consensual. Some authors such as Antonarakis et al. [<xref ref-type="bibr" rid="scirp.117741-ref34">34</xref>] in an international study in 1995 found that mild haemophilia is the most widespread. Diop et al. in 2003 found that the moderate form was the most widespread [<xref ref-type="bibr" rid="scirp.117741-ref2">2</xref>]. Doncarli et al. 2005 in France [<xref ref-type="bibr" rid="scirp.117741-ref33">33</xref>] and Tagny et al. in 2014 in Cameroon [<xref ref-type="bibr" rid="scirp.117741-ref7">7</xref>] found a trend rather similar to ours, with the severe form more widespread, followed by the moderate form and finally the mild form. Almost all of our patients had HindIII SNP, which corroborates the results of Husain et al. in 2009 and Moharrami et al. 2015 [<xref ref-type="bibr" rid="scirp.117741-ref35">35</xref>] [<xref ref-type="bibr" rid="scirp.117741-ref36">36</xref>]. Indeed, these two authors found a very high frequency of HindIII SNP (&gt;75%) in black Americans, low in whites and Chinese and absent in Japanese. This study does not show any significant link between the HindIII SNP of the F8 gene and the complications of haemophilia. However, the relationship between the HindIII SNP of the F8 gene and the severity of haemophilia showed a highly significant association (P = 0.000). In addition, patients with severe haemophilia all had the F8 gene HindIII SNP. This SNP would therefore be strongly linked to the severity of haemophilia. In this respect, very few studies in the world have mentioned this aspect. In our study, the MseI SNP was only slightly found. This aligns with the results of Winship et al. in 1993 and Bowen 2002 among Caucasians and Thais [<xref ref-type="bibr" rid="scirp.117741-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.117741-ref27">27</xref>]. Our study reveals no significant link between the MseI SNP of the F9 gene and the severity or complications of haemophilia.</p></sec><sec id="s5"><title>5. Conclusion</title><p>Our study revealed that the frequency of HindIII SNP of the F8 gene was higher in the participants and so there is a possible association of HindIII SNP of the F8 gene with the severity and complications of haemophilia, however, we found no significant association of MseI SNP of the F9 gene with the severity and complications of haemophilia.</p></sec><sec id="s6"><title>Acknowledgements</title><p>We gratefully acknowledge the Cameroonian Hemophilia Society. The Laboratory of Public Health Research Biotechnology (LAPHER-BIOTECH); and the Laboratory of Hematology at the University Teaching Hospital of Yaounde.</p></sec><sec id="s7"><title>Authors’ Contributions</title><p>WFM, CT, JPKC, CNE, contributed to the design of the study. CNE, SEE, JPKC, coordinated the study. CNE, AC, VM supervised the enrolment of patients and sample collection. JPKC, CNE, CTF, performed the molecular analysis. SEE, Analyzed data. CNE, SEE, JPKC, writing up the manuscript. All authors contributed in the revision of the manuscript and approved the final version of the manuscript prior to submission.</p></sec><sec id="s8"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s9"><title>Cite this paper</title><p>Eyebe, N.A.C., Eyebe, E.S., Chedjou, K.J.P., Fomboh, T.C., Chendjou, A., Mabopda, V., Tayou, C. and Mbacham, F.W. (2022) HindIII and MseI in the Biomolecular Profile of Hemophilia in Cameroon: A Primer Study. Journal of Biosciences and Medicines, 10, 8-19. https://doi.org/10.4236/jbm.2022.106002</p></sec></body><back><ref-list><title>References</title><ref id="scirp.117741-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Rakoto Alson, A.O., Raherimandimby, H., Rajaofera, T., Rakotovao, A.L., Herisoa, F.R. and Rasamindrakotroka, A. (2009) Mise au point sur la prise en charge de l’hémophilie à Madagascar. RARMU, 1, S1-S6.</mixed-citation></ref><ref id="scirp.117741-ref2"><label>2</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Diop S</surname><given-names> Thiam D</given-names></name>,<name name-style="western"><surname> Toure A.O.</surname><given-names> Diakhate L. </given-names></name>,<etal>et al</etal>. (<year>2003</year>)<article-title>Aspects epidemiologiques et impact medico-social de l’hemophilie au chu de Dakar</article-title><source> Médecine Tropicale</source><volume> 63</volume>,<fpage> 139</fpage>-<lpage>142</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.117741-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Ghosh, K. and Ghosh, K. (2021) Overcoming the Challenges of Treating Hemophilia in Resource-Limited Nations: A Focus on Medication Access and Adherence. Expert Review of Hematology, 14, 721-730. https://doi.org/10.1080/17474086.2021.1957826</mixed-citation></ref><ref id="scirp.117741-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Andrianjafiarinoa, T., Randriamandrato, T., Rakotovao, A., Alson, A. and Rajaonera, A. (2019) Clinical, Therapeutic and Evolutive Aspects of Patients with Hemophilia in the Surgical Resuscitation Care Unit of Joseph Ravoahangy Andrianavalona JRA Hospital Antananarivo. Case Reports in Clinical Medicine, 8, 9-20. https://doi.org/10.4236/crcm.2019.81002</mixed-citation></ref><ref id="scirp.117741-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Diop, S., Seck, M., Sy-Bah, D., Faye, B.F., Sow-Ndoye, A., Gueye, Y.B., Senghor, A.B., Sall-Fall, A., Toure-Fall, A.O., Dièye, T.N., Thiam, D. and Diakhate, L. (2014) Implementing Haemophilia Care in Senegal, West Africa. Haemophilia, 20, 73-77. https://doi.org/10.1111/hae.12249</mixed-citation></ref><ref id="scirp.117741-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">World Federation of Hemophilia (2017) Report on the Annual Global Survey 2016. Montréal, Québec.</mixed-citation></ref><ref id="scirp.117741-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Tagny, C., Moudourou, S., Ndoumba, A. and Mbanya, D. (2014) Hemophilia in Developing Countries: An Analysis of the First Data in Cameroon, Africa. Journal of Blood and Lymph, 4, Article ID: 1000119.</mixed-citation></ref><ref id="scirp.117741-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Mehta, P. and Reddivari, A.K.R. (2022) Hemophilia. StatPearls Publishing, Treasure Island, FL.</mixed-citation></ref><ref id="scirp.117741-ref9"><label>9</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Khair</surname><given-names> K. </given-names></name>,<etal>et al</etal>. (<year>2021</year>)<article-title>Haemophilia: Diagnosis, Management and Nursing Care of Patients</article-title><source> Nursing Times</source><volume> 117</volume>,<fpage> 34</fpage>-<lpage>38</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.117741-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Castaman, G. and Matino, D. (2019) Hemophilia A and B: Molecular and Clinical Similarities and Differences. Haematologica, 104, 1702-1709. https://doi.org/10.3324/haematol.2019.221093</mixed-citation></ref><ref id="scirp.117741-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Quick, A.J. and Hussey, C.V. (1959) Hemophilia B (PTC Deficiency, or Christmas Disease). Archives of Internal Medicine, 103, 762-775.https://doi.org/10.1001/archinte.1959.00270050084014</mixed-citation></ref><ref id="scirp.117741-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Ludlam, C.A., Lee, R.J., Prescott, R.J., et al. (2000) Haemophilia Care in Central Scotland 1980-94. I. Demographic Characteristics, Hospital Admissions and Causes of Death. Haemophilia, 6, 494-503. https://doi.org/10.1046/j.1365-2516.2000.00405.x</mixed-citation></ref><ref id="scirp.117741-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Soucie, J.M., Cianfrini, C., Janco, R.L., et al. (2004) Joint Range-of-Motion Limitations among Young Males with Hemophilia: Prevalence and Risk Factors. Blood, 103, 2467-2473. https://doi.org/10.1182/blood-2003-05-1457</mixed-citation></ref><ref id="scirp.117741-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Santagostino, E., Mancuso, M.E., Tripodi, A., et al. (2010) Severe Hemophilia with Mild Bleeding Phenotype: Molecular Characterization and Global Coagulation Profile. Journal of Thrombosis Haemostasis, 8, 737-743. https://doi.org/10.1111/j.1538-7836.2010.03767.x</mixed-citation></ref><ref id="scirp.117741-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Melchiorre, D., Linari, S., Manetti, M., et al. (2016) Clinical, Instrumental, Serological and Histological Findings Suggest That Hemophilia B May Be Less Severe than Hemophilia A. Haematologica, 101, 219-225.https://doi.org/10.3324/haematol.2015.133462</mixed-citation></ref><ref id="scirp.117741-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Giangrande, P.L.F., Hermans, C., O’Mahony. B., et al. (2018) European Principles of Inhibitor Management in Patients with Haemophilia. Orphanet Journal of Rare Diseases, 13, Article No. 66. https://doi.org/10.1186/s13023-018-0800-z</mixed-citation></ref><ref id="scirp.117741-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Council of Europe and Committee of Ministers (2017) Resolution CM/Res (2017)43 on Principles Concerning Haemophilia Therapies (Replacing Resolution CM/Res(2015)3). Strasbourg, 13 December 2017. https://www.edqm.eu/sites/default/files/resolution_cm_res_2017_43_on_principles_concerning_haemophilia_therapies.pdf</mixed-citation></ref><ref id="scirp.117741-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Blanchette, V.S., Key, N.S., Ljung, L.R., et al. (2014) Definitions in Hemophilia: Communication from the SSC of the ISTH. Journal of Thrombosis Haemostasis, 12, 1935-1939. https://doi.org/10.1111/jth.12672</mixed-citation></ref><ref id="scirp.117741-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Al-Allaf, F.A., Taher, M.M., Abduljaleel, Z., Bouazzaoui, A., Athar, M., Bogari, N.M., Abalkhail, H.A. and Owaidah, T.M. (2017) Molecular Analysis of Factor VIII and Factor IX Genes in Hemophilia Patients: Identification of Novel Mutations and Molecular Dynamics Studies. Journal of Clinical Medicine Research, 9, 317-331. https://doi.org/10.14740/jocmr2876w</mixed-citation></ref><ref id="scirp.117741-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Shen, G., Gao, M., Cao, Q. and Li, W. (2022) The Molecular Basis of FIX Deficiency in Hemophilia B. International Journal of Molecular Sciences, 23, Article No. 2762. https://doi.org/10.3390/ijms23052762</mixed-citation></ref><ref id="scirp.117741-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Bowen, D. J. (2002) Haemophilia A and Haemophilia B: Molecular Insights. Molecular pathology, 55, 1-18. https://doi.org/10.1136/mp.55.1.1</mixed-citation></ref><ref id="scirp.117741-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Gill, P., Jeffreys, A.J. and Werrett, D.J. (1985) Forensic Application of DNA ‘Fingerprints’. Nature, 318, 577-579. https://doi.org/10.1038/318577a0</mixed-citation></ref><ref id="scirp.117741-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Jeffreys, A.J., Wilson, V. and Thein, S.L. (1985) Hypervariable “Minisatellite” Regions in Human DNA. Nature, 314, 67-73. https://doi.org/10.1038/314067a0</mixed-citation></ref><ref id="scirp.117741-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Foley, R. (1998) The Context of Human Genetic Evolution. Genome Research, 8, 339-347. https://doi.org/10.1101/gr.8.4.339</mixed-citation></ref><ref id="scirp.117741-ref25"><label>25</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Driscoll</surname><given-names> C.</given-names></name>,<name name-style="western"><surname> Dispenzieri. A.</surname><given-names> Tobias. E.</given-names></name>,<name name-style="western"><surname> Miller</surname><given-names> C.H. and Aledort LM. </given-names></name>,<etal>et al</etal>. (<year>1988</year>)<article-title>A Second BamHI DNA Polymorphism and Haplotype Association in the Factor IX Gene</article-title><source> Blood</source><volume> 72</volume>,<fpage> 61</fpage>-<lpage>65</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.117741-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Nguyen, B.S.T., Le, X.T.T., Huynh, N., et al. (2021) Determining Common Variants in Patients with Haemophilia A in South Vietnam and Screening Female Carriers in Their Family Members. Journal of Clinical Pathology, 1-6. https://doi.org/10.1136/jclinpath-2021-207703</mixed-citation></ref><ref id="scirp.117741-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Winship, P.R., Nichols, C.E., Chuansumrit, A. and Peake, I.R. (1993) An MseI RFLP in the 5’ Flanking Region of the Factor IX Gene: Its Use for Haemophilia B Carrier Detection in Caucasian and Thai Populations. British Journal of Haematology, 84, 101-105. https://doi.org/10.1111/j.1365-2141.1993.tb03031.x</mixed-citation></ref><ref id="scirp.117741-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Al-Allaf, F.A., Abduljaleel, Z., Bogari, N.M., et al. (2019) Identification of Six Novel Factor VIII Gene Variants Using Next Generation Sequencing and Molecular Dynamics simulation. Acta Biochimica Polonica, 66, 23-31.https://doi.org/10.18388/abp.2018_2339</mixed-citation></ref><ref id="scirp.117741-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Manderstedt, E., Nilsson, R., Lind-Hallden, C., Ljung, R., Astermark, J. and Hallden, C. (2019) Targeted Re-Sequencing of F8, F9 and VWF: Characterization of Ion Torrent Data and Clinical Implications for Mutation Screening. PLOS ONE, 14, e0216179. https://doi.org/10.1371/journal.pone.0216179</mixed-citation></ref><ref id="scirp.117741-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Graham, J.B., Kunkel, G.R., Fowlkes, D.M., et al. (1990) The Utility of a HindIII Polymorphism of Factor VIII Examined by Rapid DNA Analysis. British Journal of Haematology, 76, 75-79. https://doi.org/10.1111/j.1365-2141.1990.tb07839.x</mixed-citation></ref><ref id="scirp.117741-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Graham, J.B., Kunkel, G.R., Tennyson, G.S., Lord, S.T. and Fowlkes, D.M. (1989) The Malmo Polymorphism of Factor IX: Establishing the Genotypes by Rapid Analysis of DNA. Blood, 73, 2104-2107. https://doi.org/10.1182/blood.V73.8.2104.2104</mixed-citation></ref><ref id="scirp.117741-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Lalloz, M.R., McVey, J.H., Pattinson, J.K. and Tuddenham, E.G. (1991) Haemophilia A Diagnosis by Analysis of a Hypervariable Dinucleotide Repeat within the Factor VIII Gene. The Lancet, 338, 207-211. https://doi.org/10.1016/0140-6736(91)90348-S</mixed-citation></ref><ref id="scirp.117741-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Doncarli, A., Demiguel, V., Ghez, M., et al. (2006) Premier état des lieux du suivi de la population hémophile en France (Cohorte FranceCoag), 1994-2005. Bulletin Epidémiologique Hebdomadaire, No. 39, 291-294.</mixed-citation></ref><ref id="scirp.117741-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Antonarakis, S.E., Rossiter, J.P., Young, M., Horst, J., de Moerloose. P., Sommer, S.S., et al. (1995) Factor VIII Gene Inversions in Severe Hemophilia A: Results of an International Consortium Study. Blood, 86, 2206-2212.https://doi.org/10.1182/blood.V86.6.2206.bloodjournal8662206</mixed-citation></ref><ref id="scirp.117741-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Husain, N. (2009) Carrier Analysis for Hemophilia A: Ideal Versus Acceptable. Expert Review of Molecular Diagnostics, 9, 203-207. https://doi.org/10.1586/erm.09.3</mixed-citation></ref><ref id="scirp.117741-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Moharrami, T., Derakhshan, S.M., Pourfeizi, A.A.H. and Khaniani, M.S. (2015) Detection of Hemophilia A Carriers in Azeri Turkish Population of Iran: Usefulness of HindIII and BclI Markers. Clinical and Applied Thrombosis/Hemostasis, 21, 755-759. https://doi.org/10.1177/1076029614526638</mixed-citation></ref></ref-list></back></article>