<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2022.125021</article-id><article-id pub-id-type="publisher-id">AiM-117049</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Unravelling Antimicrobial Resistance Phenotypes and Carriage of Extended-Spectrum &lt;i&gt;β&lt;/i&gt;-Lactamase Genes in &lt;i&gt;Escherichia coli&lt;/i&gt; Isolated from Dairy Farms in Kiambu County, Kenya
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Dan</surname><given-names>Waithiru</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>John</surname><given-names>Mwaniki Njeru</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>John</surname><given-names>M. Maingi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Erastus</surname><given-names>Mulinge</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Benjamin</surname><given-names>Ngugi</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>John</surname><given-names>Maina</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>John</surname><given-names>Kiiru</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Centre for Microbiology Research, Kenya Medical Research Institute, Nairobi, Kenya</addr-line></aff><aff id="aff1"><addr-line>Department of Biochemistry, Biotechnology &amp;amp; Microbiology, Kenyatta University, Nairobi, Kenya</addr-line></aff><pub-date pub-type="epub"><day>09</day><month>05</month><year>2022</year></pub-date><volume>12</volume><issue>05</issue><fpage>295</fpage><lpage>315</lpage><history><date date-type="received"><day>2,</day>	<month>March</month>	<year>2022</year></date><date date-type="rev-recd"><day>7,</day>	<month>May</month>	<year>2022</year>	</date><date date-type="accepted"><day>10,</day>	<month>May</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  The use of antibiotics for prophylaxis and growth enhancement in livestock farming is on the increase globally. This practice has led to the emergence and spread of antimicrobial-resistant bacteria in livestock. Only limited research has been done to establish the role of cattle farming in antimicrobial resistance. The current study sought to establish the carriage of multi-drug resistance and extended-spectrum beta-lactamase genes in 
  Escherichia coli from farmers, their cattle, and cattle slurry within Kiambu County. A total of 286 (81%) 
  E. coli isolates were recovered from 352 samples analysed. Antibiotic resistance profiles showed 114 (40%) isolates were resistant to ≥3 antimicrobial classes and were considered multidrug-resistant. Among multidrug-resistant (MDR) 
  E. coli strains, 40 (14%) were resistant to 3 different antimicrobial classes, while 71 (25%) were resistant to between 4 and 7 antibiotic classes. Extended-spectrum 
  β-lactamase resistance was found in 18 isolates: human (n = 14), cattle (n = 2), and environmental (n = 2). Both the bla
  <sub>CTX-M</sub> and bla
  <sub>TEM</sub> genes were detected in 10 and 15 strains, respectively. Sequence analysis showed that the isolates carried the bla
  <sub>TEM-116</sub> (n = 7), bla
  <sub>TEM-1</sub> (n = 5), and bla
  <sub>CTX-M-15</sub> (n = 8) genes. Genotyping MDR isolates using (GTG) 
  <sub>5</sub> PCR demonstrated that the isolates were not clonal. This data shows antimicrobial resistance profiles and different types of resistance genes in the 
  E. coli population on dairy farms. As a result, more effective, targeted public health policies and measures need to be put in place to control and prevent the emergence and spread of resistant bacteria.
 
</p></abstract><kwd-group><kwd>Humans</kwd><kwd> Cattle Slurry</kwd><kwd> &lt;i&gt;Escherichia coli&lt;/i&gt;</kwd><kwd> Multidrug Resistance</kwd><kwd> Extended-Spectrum &lt;i&gt;β&lt;/i&gt;-Lactamase (ESBL)</kwd><kwd> TEM 116</kwd><kwd> CTX-M-15</kwd><kwd> Kenya</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Veterinary antibiotics are progressively associated with major health issues in the animal health and welfare sector globally. These health issues could be attributed to the increasing antibiotic resistance build-up noted in animal pathogens [<xref ref-type="bibr" rid="scirp.117049-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.117049-ref2">2</xref>]. In Kenya, veterinary practice and livestock production have a mean antibiotic consumption of 14,594 &#177; 1457 kilograms per year [<xref ref-type="bibr" rid="scirp.117049-ref3">3</xref>]. About 60% (between 30% and 90%) of the antibiotics used in veterinary medicine are not entirely metabolised when eliminated through urine or faecal matter [<xref ref-type="bibr" rid="scirp.117049-ref4">4</xref>]. The antibiotic residue from manure could impact the structure and function of microbial communities and promote the spread of antibiotic-resistant bacteria (ARB) and antibiotic resistance genes (ARGs) [<xref ref-type="bibr" rid="scirp.117049-ref5">5</xref>].</p><p>Escherichia coli (E. coli) is among the seven species highlighted as key antimicrobial-resistant bacteria used as a sentinel pathogen for antimicrobial resistance development in human beings and animals [<xref ref-type="bibr" rid="scirp.117049-ref6">6</xref>]. It is possible that E. coli, which is a common microbiota in the digestive tract, can pass on resistance to other bacterial species. This is because E. coli can be pathogenic, and it has been known to develop antimicrobial resistance [<xref ref-type="bibr" rid="scirp.117049-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.117049-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.117049-ref9">9</xref>].</p><p>The rise and spread of extended-spectrum β-lactamase-producing E. coli linked to cattle and other livestock have been a particular source of concern [<xref ref-type="bibr" rid="scirp.117049-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.117049-ref11">11</xref>]. Although clavulanic acid inhibits extended-spectrum β-lactamases (ESBLs), the ability of these enzymes to hydrolyse third-generation cephalosporins and monobactams is common. The spread of different types of ESBLs has changed so far, with a sudden rise in CTX-M enzymes, which are found in the human population, over SHV and TEM variants [<xref ref-type="bibr" rid="scirp.117049-ref12">12</xref>]. The accelerated development and spread of ESBLs in pathogenic E. coli isolate in agricultural farms pose a major problem in treating infections in healthcare facilities because the pathogens are often resistant to aminoglycosides, trimethoprim-sulfamethoxazole, and ﬂuoroquinolones.</p><p>In Kiambu, like many rural areas in Kenya, animal manure is extensively used in crop production as a source of variable plant nutrients. Therefore, farmers are constantly exposed to bacterial strains contained in manure and easily ingest them, especially if proper hygiene is not adhered to. In Africa, data on linkages between bacterial strains recoverable from animal droppings/manure and strains in the human population remains scarce. There is high-intensity mixed farming in these sites, with decreasing farm sizes due to increasing population growth. The commonly used agricultural soil amendment in Kiambu County is cattle slurry, which exhibits a possible transmission pathway of antimicrobial-resistant bacteria (ARB) to the human population. Some of the most critical methods of transmission could be through hands, water, and food contamination.</p><p>This study sought to determine the carriage of multidrug-resistant E. coli and the distribution of ESBL resistance in E. coli in the farming community at the human-livestock-environmental interface. The data provided in-depth knowledge of how farms and animal excreta contribute to the persistence of antimicrobial resistance in both the environment and the human population. The fundamental information provided would help understand the role of farmers, livestock, and farm waste as a reservoir of resistance on agricultural farms.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Study Population and Design</title><p>In this study, 88 randomly selected small-scale dairy farms were enrolled from four sub-counties of Kiambu, including Lari, Githunguri, Gatundu North, and Kiambaa sub-counties, between January and March 2020. The number of dairy farms sampled from each sub-county was determined by proportional allocation. From each farm, non-human samples comprising a fresh faecal sample from each farm were collected from the participating zero-grazed cattle. A slurry sample was also obtained from the farm’s slurry tank. The study obtained human samples with informed consent from farmers who provided fresh faecal materials and hand swab samples. Each sub-county had an equal number of households selected. One dairy farm was randomly selected, and one sample of each type was aseptically collected from every sub-location. Dairy farms in each sub-county had to meet strict inclusion criteria, including having cattle at the time of sampling, and the farmer who provided the samples was working intensively in the dairy unit or the field spread with manure.</p></sec><sec id="s2_2"><title>2.2. Sample Processing</title><p>All fresh faecal and slurry samples were put into Cary-Blair media and transported on ice to the KEMRI-CMR laboratory. Hand swabs from the farmworkers were placed in Amies transport media. In all cases, samples were kept at 4˚C during transit, and isolation of E. coli started within 6 h of collection. Isolation from faecal and slurry samples involved direct culture on MacConkey’s agar (Oxoid, UK) and Eosin Methylene Blue Agar (EMBA) (Oxoid, UK). For hand swab samples, buffered peptone water was used for 18 h to enrich before sub-culturing onto MacConkey’s agar and EMBA.</p><p>A single colony of rapid fermentation (pink-burgundy colour) was randomly picked from the plate for each original sample and tested for indole production and oxidase activity. Indole-positive, oxidase-negative strains were presumptively considered E. coli. All selected isolates were run on API 20e multi-test strips (Biomerieux, USA). All confirmed E. coli isolates were immediately stored at −80˚C in Tryptic-soya broth agar (with 15% glycerol) and were grown on Mueller Hinton Agar (MHA) from frozen stocks for each subsequent characterisation.</p></sec><sec id="s2_3"><title>2.3. Antibiotic Susceptibility Test</title><p>Disc diffusion antibiotic sensitivity tests were carried out following the Clinical and Laboratory Standards Institute (CLSI) guidelines [<xref ref-type="bibr" rid="scirp.117049-ref13">13</xref>]. Briefly, bacterial colonies were picked from MHA plates, initially inoculated, and incubated for 24 h at 37˚C. Each colony sample was emulsified in normal saline until it reached 0.5 McFarland standard concentration before being seeded onto Mueller Hinton (MH) plates. Then, the antibiotics were placed onto the plate surface, with five antibiotic discs per plate (<xref ref-type="table" rid="table1">Table 1</xref>). The measured inhibition zones were interpreted as per the standard measurement table [<xref ref-type="bibr" rid="scirp.117049-ref13">13</xref>]. For consistency, antibiotic</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Antibiotic assay discs, abbreviations, and amount of antibiotic in each disc</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Antibiotics</th><th align="center" valign="middle" >Content</th></tr></thead><tr><td align="center" valign="middle" >Penicillin</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ampicillin (AMP)</td><td align="center" valign="middle" >10 &#181;g</td></tr><tr><td align="center" valign="middle" >Amoxicillin-clavulanic acid (AMC)</td><td align="center" valign="middle" >20/10&#181;g</td></tr><tr><td align="center" valign="middle" >Cephalosporin</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Cefotaxime (CTX)</td><td align="center" valign="middle" >30 &#181;g</td></tr><tr><td align="center" valign="middle" >Ceftazidime (CAZ)</td><td align="center" valign="middle" >30 &#181;g</td></tr><tr><td align="center" valign="middle" >Ceftriaxone (CRO)</td><td align="center" valign="middle" >30 &#181;g</td></tr><tr><td align="center" valign="middle" >Cefepime (FEP)</td><td align="center" valign="middle" >30 &#181;g</td></tr><tr><td align="center" valign="middle" >Cephamycin</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Cefoxitin (FOX)</td><td align="center" valign="middle" >30 &#181;g</td></tr><tr><td align="center" valign="middle" >Carbapenem</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Meropenem (MEM)</td><td align="center" valign="middle" >10 &#181;g</td></tr><tr><td align="center" valign="middle" >Aminoglycoside</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Streptomycin (S10)</td><td align="center" valign="middle" >10 &#181;g</td></tr><tr><td align="center" valign="middle" >Amikacin (AK)</td><td align="center" valign="middle" >30 &#181;g</td></tr><tr><td align="center" valign="middle" >Kanamycin (K)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Quinolones</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Ciprofloxacin (CIP)</td><td align="center" valign="middle" >5 &#181;g</td></tr><tr><td align="center" valign="middle" >Sulphonamide/complex</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Trimethoprim-sulfamethoxazole (SXT)</td><td align="center" valign="middle" >1.25/23.75&#181;g</td></tr><tr><td align="center" valign="middle" >Sulfamethoxazole (RL)</td><td align="center" valign="middle" >25 &#181;g</td></tr><tr><td align="center" valign="middle" >Trimethoprim (W)</td><td align="center" valign="middle" >5 &#181;g</td></tr><tr><td align="center" valign="middle" >Phenicol</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chloramphenicol (C)</td><td align="center" valign="middle" >30 &#181;g</td></tr><tr><td align="center" valign="middle" >Tetracycline</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Tetracycline (T)</td><td align="center" valign="middle" >30 &#181;g</td></tr></tbody></table></table-wrap><p>resistance scores of less than 6 mm (nominal disc size in millimeters) were replaced with 6 mm as a minimum score. Following previous studies, intermediate strains were deemed to be moving towards resistance and thus considered resistant on an evolutionary basis [<xref ref-type="bibr" rid="scirp.117049-ref14">14</xref>]. Therefore, a strain found to be non-susceptible to at least three or more antimicrobial classes was scored as an MDR strain [<xref ref-type="bibr" rid="scirp.117049-ref15">15</xref>]. E. coli ATCC 25922 (ESBL negative) and E. coli NCTC 13,353 (ESBL positive CTXM-15) were used as quality control strains.</p></sec><sec id="s2_4"><title>2.4. Phenotypic Confirmation of ESBL Producing E. coli</title><p>All isolates that gave an inhibition zone indicating resistance or intermediate resistance to Ceftazidime (CAZ) or Cefotaxime (CTX) using standard antibiotic discs were further tested for ESBL production using the BD Total ESBL Confirm Kit (BD, USA) following the guidelines of the manufacturer. Briefly, the combination of CTX and CAZ discs (30 &#181;g of each antibiotic) alone and in a combination with clavulanic acid (CA) was performed. An increase in the diameter of the zone of clearing around a disc ≥ 5 mm for either antimicrobial agent tested in combination with CA versus the diameter of the zone of clearing around a disc containing the agent when tested alone indicated ESBL presence [<xref ref-type="bibr" rid="scirp.117049-ref13">13</xref>]. Control strains used were E. coli ATCC 25922 (ESBL negative) and E. coli NCTC 13353 (ESBL positive).</p></sec><sec id="s2_5"><title>2.5. Genotyping of Isolates</title><sec id="s2_5_1"><title>2.5.1. Detection of bla (ESBL) Genes</title><p>Phenotypically confirmed ESBL-producing E. coli strains were examined further to detect the presence of bla<sub>SHV</sub>, bla<sub>TEM</sub>, bla<sub>OXA</sub>, and bla<sub>CTX</sub><sub>-M</sub> genes by Polymerase Chain Reaction (PCR) [<xref ref-type="bibr" rid="scirp.117049-ref16">16</xref>]. In brief, the test strains were cultured on Mueller Hinton agar for 18 hours at 37˚C to extract DNA using commercial kit (QIAamp DNA kit, Qiagen, Hilden, Germany) following manufacture’s instructions. The purity and concentration of DNA were tested using a NanoDrop ND-1000 UV-vis spectrophotometer (NanoDrop Technologies, Wilmington, USA). Total DNA (2 &#181;l) was used in a 20 &#181;l reaction mixture that contained 4 &#181;l of the Ready to Mix 5&#215; FIREPOL<sup>&#174;</sup> Master Mix (Solis Biodyne, UK), 12.2 &#181;l of nuclease-free water, optimised 1 &#181;l of BSA, and 0.4 &#181;l of each primer. The primers and expected product sizes are given in <xref ref-type="table" rid="table2">Table 2</xref>. E. coli NCTC 13353 was used as a positive control for TEM, Klebsiella pneumoniae NCTC 13368 was used as a positive control for SHV, and E. coli ATCC 25922 was used as a negative control for PCR.</p><p>The cycling conditions included one cycle denaturation for 2 min at 95˚C, 35 cycles of 3 min at 95˚C, 1 min at 55˚C, and 5 min at 72˚C. The PCR reaction ended with a final extension step of 72˚C for 15 min.</p><p>Approximately 5 &#181;l of PCR products were loaded onto horizontal 1.5% w/v agarose gel with a 1 kb plus molecular size marker (Invitrogen, UK) and electrophoresed at 80 V for 40 minutes. The gels were stained with SYBR green dye. The DNA bands were then visualised with a UV transilluminator (UVP Inc.), and the images were taken using black and white Polaroid film.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> List of PCR primers used for detection of β-lactamase genes (SHV, OXA, TEM, and CTX-M). Primer sequences and expected PCR product sizes are shown for each primer</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Oligonucleotide name</th><th align="center" valign="middle" >Primer sequence</th><th align="center" valign="middle" >Annealing temperature (˚C)</th><th align="center" valign="middle" >Product size (bp)</th></tr></thead><tr><td align="center" valign="middle" >CTX-M-F-</td><td align="center" valign="middle" >ATGTGCAGYACCAGTAARGTKATGGC</td><td align="center" valign="middle"  rowspan="2"  >56</td><td align="center" valign="middle"  rowspan="2"  >529</td></tr><tr><td align="center" valign="middle" >CTX-M-R-</td><td align="center" valign="middle" >TGGGTRAARTARGTSACCAGAAYSAGCGG</td></tr><tr><td align="center" valign="middle" >TEM-F-</td><td align="center" valign="middle" >GCGGAACCCCTATTT G</td><td align="center" valign="middle"  rowspan="2"  >50</td><td align="center" valign="middle"  rowspan="2"  >964</td></tr><tr><td align="center" valign="middle" >TEM-R-</td><td align="center" valign="middle" >ACCAATGCTTAATCAGTGAG</td></tr><tr><td align="center" valign="middle" >SHV-F-</td><td align="center" valign="middle" >TTATCTCCCTGTTAGCCACC</td><td align="center" valign="middle"  rowspan="2"  >50</td><td align="center" valign="middle"  rowspan="2"  >796</td></tr><tr><td align="center" valign="middle" >SHV-R-</td><td align="center" valign="middle" >GATTTGCTGATTTCGCTCGG</td></tr><tr><td align="center" valign="middle" >OXA-1-F-</td><td align="center" valign="middle" >ATGAAAAACACAATACATATCAACTTCGC</td><td align="center" valign="middle"  rowspan="2"  >62</td><td align="center" valign="middle"  rowspan="2"  >820</td></tr><tr><td align="center" valign="middle" >OXA-1-R-</td><td align="center" valign="middle" >GTGTGTTTAGAATGGTGATCGCATT</td></tr><tr><td align="center" valign="middle" >OXA-2-F-</td><td align="center" valign="middle" >ACGATAGTTGTGGCAGACGAAC</td><td align="center" valign="middle"  rowspan="2"  >60</td><td align="center" valign="middle"  rowspan="2"  >601</td></tr><tr><td align="center" valign="middle" >OXA-2-R-</td><td align="center" valign="middle" >ATYCTGTTTGGCGTATCRATATTC</td></tr></tbody></table></table-wrap><p>R is a purine; Y is a pyrimidine; S is G or C.</p></sec><sec id="s2_5_2"><title>2.5.2. Purification of PCR Products and Sequencing</title><p>PCR products of the isolates positive for bla genes were purified with the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and subjected to direct sequencing at Macrogen Europe (Amsterdam, Netherlands).</p></sec><sec id="s2_5_3"><title>2.5.3. (GTG)<sub>5</sub>-PCR Banding Pattern Analysis</title><p>E. coli isolates for fingerprint analysis were selected based on resistance profiles, sample type, and sampling area. Representatives of MDR isolates that were resistant to six or more classes of antimicrobials, ESBLs, and fully susceptible isolates were selected for analysis. The GTG5-PCR was done using a single primer (5’-GTGGTGGTGGTGGTG-3’) under the following modified amplification conditions; denaturation step at 95˚C for 7 min followed by 30 cycles (1 min at 94˚C + 1 min at 40˚C + 8 min at 60˚C) and final elongation for 15 min at 65˚C [<xref ref-type="bibr" rid="scirp.117049-ref17">17</xref>]. The resulting PCR products were separated in 1.5% agarose gel electrophoresis at 80 V for 120 min and visualized under UV light.</p></sec></sec><sec id="s2_6"><title>2.6. Data Management and Statistical Analysis</title><p>All statistical analyses were performed using STATA v 13 (Stata Corp LP, College Station, TX, USA). Clustering of antibiotic profiles was carried out using WHONET 2020. Descriptive statistics; frequency and percentages (%) were used to describe antimicrobial susceptibility patterns and the distribution of MDR strains across different sources. For categorical variables, Chi-square was used to test for significance where applicable.</p><p>Diversity analysis of the resistant strains from both humans and the immediate environment was done to determine the possible genetic diversity among recovered E. coli isolates. Generated E. coli electrophoresis images were analysed using Gelcompar&#174; 2 software version 6.6 Bionumeric software and dendrogram tree plotted using the unweighted pair group method (UPGMA) with arithmetic mean using Pearson correlation. A similarity matrix of ≥80% among isolates in various generated dendrogram clusters was considered a significant indication of genetic similarity.</p><p>On the other hand, obtained chromatogram sequencing files were inspected and corrected using the software application GENtle v. 1.9.4 http://gentle.magnusmanske.de [<xref ref-type="bibr" rid="scirp.117049-ref18">18</xref>]. Multiple sequence alignments of the nucleic acid were carried out using the ClustalW program. The sequences were identified by comparing them with those available in the National Centre for Biotechnology Information database (NCBI) using the basic local alignment search tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST/) [<xref ref-type="bibr" rid="scirp.117049-ref19">19</xref>].<sup> </sup></p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Antimicrobial Resistance in Isolates from Clinical and Environmental Samples</title><p>In this study, a total of 352 samples were collected from dairy farms in Kiambu County, including 88 samples from each of the four sample types (human faecal, hand swabs, slurry, and fresh cattle dung). From the 352 samples analysed, 286 (81%) E. coli isolates (non-human samples (n = 163) and human samples (n = 123) were recovered. Out of 286 confirmed E. coli isolates, only 56 (20%) were sensitive to all antibiotics, whereas 230 (80%) showed resistance to at least one antibiotic (<xref ref-type="table" rid="table3">Table 3</xref>) (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Of the total isolates, 114 (40%) were multidrug-resistant (MDR)</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Antimicrobial resistance profiles in Escherichia coli isolates from clinical, animal, and environmental samples</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Sample category</th><th align="center" valign="middle"  rowspan="2"  >Sample type</th><th align="center" valign="middle"  rowspan="2"  >Number of isolates</th><th align="center" valign="middle"  colspan="17"  >Antimicrobial resistance Escherichia coli n (%)</th></tr></thead><tr><td align="center" valign="middle" >AMC</td><td align="center" valign="middle" >AMK</td><td align="center" valign="middle" >AMP</td><td align="center" valign="middle" >CAZ</td><td align="center" valign="middle" >CHL</td><td align="center" valign="middle" >CIP</td><td align="center" valign="middle" >CRO</td><td align="center" valign="middle" >CTX</td><td align="center" valign="middle" >FEP</td><td align="center" valign="middle" >FOX</td><td align="center" valign="middle" >KAN</td><td align="center" valign="middle" >MEM</td><td align="center" valign="middle" >SMX</td><td align="center" valign="middle" >STH</td><td align="center" valign="middle" >SXT</td><td align="center" valign="middle" >TCY</td><td align="center" valign="middle" >TMP</td></tr><tr><td align="center" valign="middle" >Livestock</td><td align="center" valign="middle" >Fresh cattle dung</td><td align="center" valign="middle" >83</td><td align="center" valign="middle" >3 (4)</td><td align="center" valign="middle" >18 (22)</td><td align="center" valign="middle" >21 (25)</td><td align="center" valign="middle" >5 (6)</td><td align="center" valign="middle" >5 (6)</td><td align="center" valign="middle" >3 (4)</td><td align="center" valign="middle" >4 (5)</td><td align="center" valign="middle" >4 (5)</td><td align="center" valign="middle" >4 (5)</td><td align="center" valign="middle" >6 (7)</td><td align="center" valign="middle" >0 (0)</td><td align="center" valign="middle" >0 (0)</td><td align="center" valign="middle" >54 (65)</td><td align="center" valign="middle" >24 (29)</td><td align="center" valign="middle" >7 (8)</td><td align="center" valign="middle" >26 (31)</td><td align="center" valign="middle" >13 (16)</td></tr><tr><td align="center" valign="middle" >Human</td><td align="center" valign="middle" >Hand swab</td><td align="center" valign="middle" >49</td><td align="center" valign="middle" >6 (12)</td><td align="center" valign="middle" >10 (20)</td><td align="center" valign="middle" >10 (20)</td><td align="center" valign="middle" >3 (6)</td><td align="center" valign="middle" >1 (2)</td><td align="center" valign="middle" >1 (2)</td><td align="center" valign="middle" >3 (6)</td><td align="center" valign="middle" >2 (4)</td><td align="center" valign="middle" >6 (12)</td><td align="center" valign="middle" >5 (10)</td><td align="center" valign="middle" >2 (4)</td><td align="center" valign="middle" >0 (0)</td><td align="center" valign="middle" >30 (61)</td><td align="center" valign="middle" >13 (27)</td><td align="center" valign="middle" >4 (8)</td><td align="center" valign="middle" >19 (39)</td><td align="center" valign="middle" >11 (22)</td></tr><tr><td align="center" valign="middle" >Human</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >74</td><td align="center" valign="middle" >8 (11)</td><td align="center" valign="middle" >10 (14)</td><td align="center" valign="middle" >19 (26)</td><td align="center" valign="middle" >5 (7)</td><td align="center" valign="middle" >2 (3)</td><td align="center" valign="middle" >1 (1)</td><td align="center" valign="middle" >6 (8)</td><td align="center" valign="middle" >3 (4)</td><td align="center" valign="middle" >8 (11)</td><td align="center" valign="middle" >3 (4)</td><td align="center" valign="middle" >3 (4)</td><td align="center" valign="middle" >0 (0)</td><td align="center" valign="middle" >52 (70)</td><td align="center" valign="middle" >22 (30)</td><td align="center" valign="middle" >5 (7)</td><td align="center" valign="middle" >24 (32)</td><td align="center" valign="middle" >15 (21)</td></tr><tr><td align="center" valign="middle" >Environmental</td><td align="center" valign="middle" >Slurry</td><td align="center" valign="middle" >80</td><td align="center" valign="middle" >1 (1)</td><td align="center" valign="middle" >11 (14)</td><td align="center" valign="middle" >23 (29)</td><td align="center" valign="middle" >4 (5)</td><td align="center" valign="middle" >3 (4)</td><td align="center" valign="middle" >1 (1)</td><td align="center" valign="middle" >4 (5)</td><td align="center" valign="middle" >2 (3)</td><td align="center" valign="middle" >4 (5)</td><td align="center" valign="middle" >8 (10)</td><td align="center" valign="middle" >1 (1)</td><td align="center" valign="middle" >1 (1)</td><td align="center" valign="middle" >52 (65)</td><td align="center" valign="middle" >26 (33)</td><td align="center" valign="middle" >9 (11)</td><td align="center" valign="middle" >24 (30)</td><td align="center" valign="middle" >19 (24)</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >All</td><td align="center" valign="middle" >286</td><td align="center" valign="middle" >18 (6)</td><td align="center" valign="middle" >49 (17)</td><td align="center" valign="middle" >73 (26)</td><td align="center" valign="middle" >17 (6)</td><td align="center" valign="middle" >11 (4)</td><td align="center" valign="middle" >6 (2)</td><td align="center" valign="middle" >17 (6)</td><td align="center" valign="middle" >11 (4)</td><td align="center" valign="middle" >22 (8)</td><td align="center" valign="middle" >22 (8)</td><td align="center" valign="middle" >6 (2)</td><td align="center" valign="middle" >1 (0.3)</td><td align="center" valign="middle" >188 (66)</td><td align="center" valign="middle" >85 (30)</td><td align="center" valign="middle" >25 (9)</td><td align="center" valign="middle" >93 (33)</td><td align="center" valign="middle" >58 (21)</td></tr></tbody></table></table-wrap><p>Key: Antimicrobial activity of Escherichia coli isolates was tested against 17 antibiotics against that includes; AMP: Ampicillin, AMC: Amoxicillin-clavulanic acid, CRO: Ceftriaxone, FEP: Cefepime, FOX: Cefoxitin, MEM: Meropenem, AMK: Amikacin, KAN: Kanamycin, STH: Streptomycin; CIP: Ciprofloxacin, SXT: Trimethoprim-sulfamethoxazole, CHL: Chloramphenicol and TCY: Tetracycline, CAZ: Ceftazidime; CTX: Cefotaxime, TMP: Trimethoprim, SMX: Sulfamethoxazole.</p><p>as earlier defined [<xref ref-type="bibr" rid="scirp.117049-ref15">15</xref>] and showed resistance to at least one antibiotic from three or more different classes (<xref ref-type="fig" rid="fig2">Figure 2</xref>). The highest number of the MDR isolates were recovered from human faecal samples, 39 (34%), followed by fresh cattle dung, 35 (31%), then slurry, 20 (18%), and hand swab samples, 20 (18%), respectively (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The resistance profile of MDR strains ranged from 3 to 8 antimicrobial classes (<xref ref-type="fig" rid="fig2">Figure 2</xref>). The highest percentage of MDR isolates were resistant to antibiotics in three antimicrobial classes, 40 (14%), and 3 (1%) were resistant to agents in 8 classes. This study detected a significant difference in multiple antimicrobial resistance phenotypes in E. coli isolates from human and non-human samples (P = 0.000264, O.R: 6.375, C.I: 2.0871 - 19.472). In all isolates analysed, prevalent resistance was recorded towards sulfamethoxazole 188 (66%), tetracycline 93 (33%), and ampicillin 73 (26%). Meropenem and Kanamycin had the least frequent resistance, with only 1 (0.3%) and 6 (2%) resistances noted, respectively. Isolates analysed in this study were co-resistant to between 1 - 10 antimicrobial agents tested (<xref ref-type="fig" rid="fig1">Figure 1</xref>). However, a significant proportion of 66 (23%) of the isolates in this study were resistant to 2 or 3 antimicrobial agents (<xref ref-type="fig" rid="fig1">Figure 1</xref>). E. coli isolates from cattle slurry and human faecal samples had the most antimicrobial resistance combinations, with over 12% resistant to 2, 3, or 4 antimicrobial agents (<xref ref-type="fig" rid="fig4">Figure 4</xref>). The E. coli isolates from human faecal samples were resistant to most of the tested antimicrobial agents, ranging between 0% - 70%, followed by hand swab isolates with ranges of between 0% - 61% (<xref ref-type="table" rid="table3">Table 3</xref>). In non-human samples, isolates from the slurry sample were resistant to up to 7 antimicrobial agents ranging from1% - 65%.</p><p>E. coli isolates from fresh cattle dung were resistant to up to 6 antimicrobial agents with a range of 0% - 65% (<xref ref-type="table" rid="table3">Table 3</xref>).</p></sec><sec id="s3_2"><title>3.2. Extended β-Lactamases Phenotype and Genotype</title><p>A total of 286 E. coli isolates were screened for antimicrobial activities, and 28 (10%) of these were resistant to either ceftazidime or cefotaxime (<xref ref-type="table" rid="table3">Table 3</xref>). These isolates were further analysed to confirm the ESBL phenotype. The confirmatory test kit showed that 15 (54%) of the 28 isolates were ESBL phenotypes</p><p>(<xref ref-type="table" rid="table4">Table 4</xref>). The ESBL phenotype was more common in human faecal isolates (7 (47%), followed by isolates in hand swabs (4 (26%), cattle dung (2 (13%), and Slurry 2 (13%).</p><p>The PCR test for bla genes carriage showed that 10 (56%) of the 18 screened ESBL producers were positive for bla<sub>CTX</sub><sub>-M</sub>. Fifteen (83%) isolates had bla<sub>TEM</sub> genes (<xref ref-type="table" rid="table5">Table 5</xref>). The carriage of bla<sub>CTX</sub><sub>-M</sub> and bla<sub>TEM</sub> was common in isolates from human faecal samples, with 5 (50%) and 7 (47%), respectively (<xref ref-type="table" rid="table5">Table 5</xref>). In addition, 10 (67%) of the screened isolates were positive for carriage of both bla<sub>CTX</sub><sub>-M</sub> and bla<sub>TEM</sub>. None of the 18 confirmed ESBL producers was positive for carriage of OXA and SHV genes.</p></sec><sec id="s3_3"><title>3.3. Heatmap Representation of Antimicrobial Resistance in Extended-Spectrum β-Lactam Phenotypes</title><p>In a heatmap generated, 4 (40%) of the E. coli isolates with TEM and CTX-M co-carriage clustered together, reflecting similarity in antimicrobial resistance profiles. Similar results were also noted where 6 (46%) of the fully susceptible isolates tested clustered together. Isolates that harboured the TEM gene only were, however, scattered in various clusters in the heatmap (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p></sec><sec id="s3_4"><title>3.4. Sequences Analysis and Polymorphism</title><sec id="s3_4_1"><title>3.4.1. Analysis of CTX-M Gene (bla<sub>CTX</sub><sub>-M</sub>)</title><p>The CTX-M gene sequences from eight bla<sub>CTX</sub><sub>-M</sub> positive isolates were 100%</p><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Double disk diffusion for confirmation of ESBL phenotype</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Isolate ID</th><th align="center" valign="middle" >Sample type</th><th align="center" valign="middle" >CAZ</th><th align="center" valign="middle" >CAZ + C</th><th align="center" valign="middle" >D</th><th align="center" valign="middle" >CTX</th><th align="center" valign="middle" >CTX + C</th><th align="center" valign="middle" >D</th><th align="center" valign="middle" >ESBL phenotype</th></tr></thead><tr><td align="center" valign="middle" >5519_HDS</td><td align="center" valign="middle" >Hand swab</td><td align="center" valign="middle" >29</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5521_FCD</td><td align="center" valign="middle" >Cattle dung</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >Non-ESBL</td></tr><tr><td align="center" valign="middle" >5530_FCD</td><td align="center" valign="middle" >Cattle dung</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >29</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >26</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >Non-ESBL</td></tr><tr><td align="center" valign="middle" >5534_HDS</td><td align="center" valign="middle" >Hand swab</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >16</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5534_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5540_CDS</td><td align="center" valign="middle" >Slurry</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >Non-ESBL</td></tr><tr><td align="center" valign="middle" >5542_CDS</td><td align="center" valign="middle" >Slurry</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5548_FCD</td><td align="center" valign="middle" >Cattle dung</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5550_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >Non-ESBL</td></tr><tr><td align="center" valign="middle" >5551_FCD</td><td align="center" valign="middle" >Cattle dung</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >Non-ESBL</td></tr><tr><td align="center" valign="middle" >5552_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >Non-ESBL</td></tr><tr><td align="center" valign="middle" >5555_CDS</td><td align="center" valign="middle" >Slurry</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5555_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5556_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >29</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5558_HDS</td><td align="center" valign="middle" >Hand swab</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >13</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5558_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5559_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >13</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5560_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >26</td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5561_HDS</td><td align="center" valign="middle" >Hand swab</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5562_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >29</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5569_HDS</td><td align="center" valign="middle" >Hand swab</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >Non-ESBL</td></tr><tr><td align="center" valign="middle" >5572_FCD</td><td align="center" valign="middle" >Cattle dung</td><td align="center" valign="middle" >26</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >Non-ESBL</td></tr><tr><td align="center" valign="middle" >5572_HDS</td><td align="center" valign="middle" >Hand swab</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >Non-ESBL</td></tr><tr><td align="center" valign="middle" >5576_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5577_HDS</td><td align="center" valign="middle" >Hand swab</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5577_FCD</td><td align="center" valign="middle" >Cattle dung</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >5588_HDS</td><td align="center" valign="middle" >Hand swab</td><td align="center" valign="middle" >26</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >Non-ESBL</td></tr><tr><td align="center" valign="middle" >5590_HFD</td><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >NCTC 13353</td><td align="center" valign="middle" >Control</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >27</td><td align="center" valign="middle" >ESBL</td></tr><tr><td align="center" valign="middle" >E. cloacae</td><td align="center" valign="middle" >Control</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >Non-ESBL</td></tr></tbody></table></table-wrap><p>Phenotypic verification of the ESBL phenotype was done by measuring the differences in inhibition zone of a cephalosporin-inhibitor (CAZ + clav, CTX + clav) and cephalosporin (CAZ and CTX) antimicrobial disk. The description of various acronyms used in this table is as follows; CAZ: Ceftazidime, CTX: Cefotaxime, clav: clavulanic acid (bacterial growth inhibitor), AMR: Antimicrobial resistance, ESBL: Extended-spectrum β-lactamases, FCD: fresh cattle dung, HDS: Hand swab, CDS: Cattle dung slurry and HFD: Human faecal sample, D: Difference of ≥ 5 mm indicates ESBL presence.</p><table-wrap id="table5" ><label><xref ref-type="table" rid="table5">Table 5</xref></label><caption><title> β-lactamases genes detected by PCR in Escherichia coli isolates</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Sample type</th><th align="center" valign="middle"  rowspan="2"  >Number of isolates</th><th align="center" valign="middle"  rowspan="2"  >ESBL-phenotype</th><th align="center" valign="middle"  colspan="4"  >β-lactamases genes in E. coli isolates</th></tr></thead><tr><td align="center" valign="middle" >blaTEM</td><td align="center" valign="middle" >blaCTX-M</td><td align="center" valign="middle" >bla SHV</td><td align="center" valign="middle" >blaOXA</td></tr><tr><td align="center" valign="middle" >Human faecal</td><td align="center" valign="middle" >74</td><td align="center" valign="middle" >9 (12%)</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Hand swabs</td><td align="center" valign="middle" >49</td><td align="center" valign="middle" >5 (10%)</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Slurry</td><td align="center" valign="middle" >80</td><td align="center" valign="middle" >2 (3%)</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Fresh cattle dung</td><td align="center" valign="middle" >83</td><td align="center" valign="middle" >2 (2%)</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >286</td><td align="center" valign="middle" >18 (6%)</td><td align="center" valign="middle" >15 (83%)</td><td align="center" valign="middle" >10 (56%)</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr></tbody></table></table-wrap><p>Polymerase chain reaction (PCR) was used to screen for the carriage of the common β-lactamase gene (bla) that includes the Temoneria (bla<sub>TEM</sub>), Cefotaxime Munich (bla<sub>CTX</sub><sub>-M</sub>), Oxacillin (bla<sub>OXA</sub>), and Sulfhydryl (bla<sub>SHV</sub>) variants. The screened Escherichia coli isolates were from human faecal, hand swabs, slurry, and fresh cattle dung samples.</p><p>identical to the class A β-lactamase, CTX-M-15 gene, extended-spectrum isolate with accession number KP268826 from the United Kingdom [<xref ref-type="bibr" rid="scirp.117049-ref20">20</xref>]. A representative sequence was deposited in the GenBank under accession number MZ314090.</p></sec><sec id="s3_4_2"><title>3.4.2. Analysis of TEM Gene (bla<sub>TEM</sub>)</title><p>Twelve bla<sub>TEM</sub> positive isolates were sequenced and compared with other published bla<sub>TEM</sub> genes in E. coli strains from GenBank. Two different bla<sub>TEM</sub> alleles were identified, 5 (42%) with the classical allele and 7 (58%) with a variant that differed from TEM-1 by two amino acids, in the single peptide region at positions 82 [blaTEM-1 (V82I)] and 182 [blaTEM-1 (A182V)] (<xref ref-type="table" rid="table6">Table 6</xref>). The variant showed 5 different SNPs with positions indicated at 18, 228, 244, 396, and 545 (<xref ref-type="table" rid="table7">Table 7</xref>). The TEM-1 classical isolates were 100% identical to the class A broad-spectrum β-lactamase TEM-1 with accession number MW646301 [<xref ref-type="bibr" rid="scirp.117049-ref20">20</xref>], and a representative sequence was deposited in the GenBank under accession number MZ314091. Meanwhile, the variant isolates were 100% identical to the class a broad-spectrum β-lactamase TEM-116 of an Acinetobacter baumannii isolate with accession number KU180704 [<xref ref-type="bibr" rid="scirp.117049-ref21">21</xref>]. The variant sequences are represented in the GenBank under the sequence accession number MZ314092.</p><table-wrap id="table6" ><label><xref ref-type="table" rid="table6">Table 6</xref></label><caption><title> Amino acid substitutions of TEM-1 and TEM-116 β-lactamase</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >β-lactamase</th><th align="center" valign="middle"  colspan="2"  >The residue (coding triplet) at amino acid</th></tr></thead><tr><td align="center" valign="middle" >82</td><td align="center" valign="middle" >182</td></tr><tr><td align="center" valign="middle" >TEM-1</td><td align="center" valign="middle" >Val (GTT)</td><td align="center" valign="middle" >Ala (GCA)</td></tr><tr><td align="center" valign="middle" >TEM-116</td><td align="center" valign="middle" >Ile (ATT)</td><td align="center" valign="middle" >Val (GTA)</td></tr></tbody></table></table-wrap><table-wrap id="table7" ><label><xref ref-type="table" rid="table7">Table 7</xref></label><caption><title> Single nucleotide substitutions of bla<sub>TEM</sub> gene found in twelve haplotypes of Escherichia coli</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Haplotype</th><th align="center" valign="middle"  colspan="5"  >bla<sub>TEM</sub></th></tr></thead><tr><td align="center" valign="middle" >18</td><td align="center" valign="middle" >228</td><td align="center" valign="middle" >244</td><td align="center" valign="middle" >396</td><td align="center" valign="middle" >545</td></tr><tr><td align="center" valign="middle" >MW646301</td><td align="center" valign="middle" >T</td><td align="center" valign="middle" >T</td><td align="center" valign="middle" >G</td><td align="center" valign="middle" >T</td><td align="center" valign="middle" >C</td></tr><tr><td align="center" valign="middle" >5548 FCD</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td></tr><tr><td align="center" valign="middle" >5534 HDS</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td></tr><tr><td align="center" valign="middle" >5560 HFD</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >A</td><td align="center" valign="middle" >G</td><td align="center" valign="middle" >T</td></tr><tr><td align="center" valign="middle" >5577 HDS</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >A</td><td align="center" valign="middle" >G</td><td align="center" valign="middle" >T</td></tr><tr><td align="center" valign="middle" >5559 HFD</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >A</td><td align="center" valign="middle" >G</td><td align="center" valign="middle" >T</td></tr><tr><td align="center" valign="middle" >5577 HFD</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >A</td><td align="center" valign="middle" >G</td><td align="center" valign="middle" >T</td></tr><tr><td align="center" valign="middle" >5558 HDS</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td></tr><tr><td align="center" valign="middle" >5556 HFD</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >A</td><td align="center" valign="middle" >G</td><td align="center" valign="middle" >T</td></tr><tr><td align="center" valign="middle" >5558 HFD</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >A</td><td align="center" valign="middle" >G</td><td align="center" valign="middle" >T</td></tr><tr><td align="center" valign="middle" >5542 CDS</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >C</td><td align="center" valign="middle" >A</td><td align="center" valign="middle" >G</td><td align="center" valign="middle" >T</td></tr><tr><td align="center" valign="middle" >5555 CDS</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td></tr><tr><td align="center" valign="middle" >5555 HFD</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td><td align="center" valign="middle" >.</td></tr></tbody></table></table-wrap><p>The substitutional sites are numbered from the initiation codon of the TEM-1 gene. The length of the TEM-1 gene sequence was 861 bp. A complete gene sequence from the United Kingdom, accession number MW 646301, was used as the reference sequence.</p></sec></sec><sec id="s3_5"><title>3.5. Diversity of Clinical and Environmental E. coli Isolates</title><p>Most E. coli isolates did not cluster based on sample type or sampling location in the phylogenetic analysis. For instance, isolates recovered from faecal, hand swabs, and fresh cattle dung samples from farms in Githunguri were scattered across the cluster groups (<xref ref-type="fig" rid="fig2">Figure 2</xref>). There was also no homogeneity in antimicrobial resistance profiles in isolates recovered from the same region. However, two isolates from faecal and hand swab samples from Gatundu North (cluster group VI) had a similarity index of 100%, indicating that these isolates are genetically similar. However, the two isolates slightly varied in their antimicrobial resistance profiles, resulting from acquiring resistance genes via mobile genetic elements (<xref ref-type="fig" rid="fig6">Figure 6</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>The menace of antimicrobial resistance (AMR) is an increasing global health concern and negatively impacts the fight against infectious diseases caused by bacterial pathogens [<xref ref-type="bibr" rid="scirp.117049-ref22">22</xref>]. Over the years, the emergence and gradual increase in antimicrobial resistance have been driven by misuse and over-use of antimicrobials in human healthcare and, more recently indiscriminate use in livestock and agriculture farming [<xref ref-type="bibr" rid="scirp.117049-ref23">23</xref>]. Although much is known about the drivers and burden of AMR on human health, research on livestock and agriculture has only recently started to gain traction.</p><p>To have an overview of the burden of AMR in livestock farming, the current study investigated Escherichia coli since it is a suitable indicator species for antimicrobial resistance [<xref ref-type="bibr" rid="scirp.117049-ref24">24</xref>]. A prevalence of 28% E. coli in untreated cattle slurry was recorded and was close to the 29% found in fresh cattle dung samples. These findings indicate that these bacterial isolates can survive for a long period, even beyond 90 days in harsh environmental conditions [<xref ref-type="bibr" rid="scirp.117049-ref25">25</xref>]. Cattle manure has traditionally been used as a rich source of essential nutrients for crop agriculture and is often deemed safer than chemical fertilisers that have a compounding effect on soil chemical composition after prolonged use [<xref ref-type="bibr" rid="scirp.117049-ref26">26</xref>]. However, manure is used in crop farming without prior treatment in most developing countries due to a lack of capital and technology. The use of untreated manure and animal slurry contaminates water and has been a source of enteric pathogens associated with foodborne infections [<xref ref-type="bibr" rid="scirp.117049-ref25">25</xref>]. The Food Safety Modernisation act recommends a 90 to 120-day waiting period from the time of untreated manure use and before crop harvest [<xref ref-type="bibr" rid="scirp.117049-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.117049-ref27">27</xref>]. This waiting period significantly reduces foodborne infections that may result from consuming vegetables or fruits contaminated with enteric of manure origin.</p><p>Cattle farming is prevalent in areas surrounding Nairobi County due to a broad market for milk. Urban cattle farming is also favourable due to direct contact with customers, removing the middlemen to increase profit margins. However, zero-grazing in animal sheds close to the homestead is an everyday phenomenon due to space limitations. Dung disposal is also a problem, and animal slurry in homestead compounds on farms with limited space is also very common [<xref ref-type="bibr" rid="scirp.117049-ref28">28</xref>]. Most farmers handling animal dung and slurry lack protective gear. Therefore, this poses a risk of animal-human enteric bacterial cross-contamination, which can eventually cause zoonotic diseases. Although the origin of E. coli isolates from hands swabs was not determined in this study, some of these bacteria may have emanated from handling the animal dung, slurry, or even human faecal, as no homogenous clustering patterns per sample type were observed. Non-bloody diarrhea has been associated with pathogenic strains such as Shiga-toxin Escherichia coli (STEC) of animal origin [<xref ref-type="bibr" rid="scirp.117049-ref29">29</xref>]. Caution, therefore, needs to be taken to avoid contamination of animal products such as meat and milk with these bacterial strains.</p><p>In this study, most of the MDR E. coli isolates (n = 40) were resistant to three antimicrobial classes, followed by 37 (13%) resistant to four antimicrobial classes. Three (1%) MDR isolates were resistant to eight antimicrobial classes. These findings agree with those reported in an earlier study [<xref ref-type="bibr" rid="scirp.117049-ref30">30</xref>], which found that 36.7% of MDR isolates recovered from selected sites in Kenya. There is a great need to investigate the presence of mutations in the general outer membrane porins that drugs use for entry, assess the increased expression of efflux systems, integrons, and plasmids associated with AMR, and mutations in other genes encoding resistance enzymes.</p><p>The antimicrobial resistance profiles analysis by sample type revealed that non-susceptible isolates from human faecal were more predominant than those from animal samples, which is consistent with findings from a previous study in Kenya [<xref ref-type="bibr" rid="scirp.117049-ref31">31</xref>]. Although isolates from animal samples have relatively minimal AMR compared to human samples, AMR in livestock samples has increased in Africa and other parts of the globe [<xref ref-type="bibr" rid="scirp.117049-ref32">32</xref>]. We found that most isolates from cattle dung and slurry are susceptible to most antimicrobial agents. Resistance towards tetracycline, aminoglycosides, and sulfonamides ranged between 2% - 34%, which is lower than the 37% - 58% reported earlier [<xref ref-type="bibr" rid="scirp.117049-ref31">31</xref>]. Resistance determinants against these antimicrobials are often situated in the same plasmid together with genes mediating resistance to heavy metals and some antibiotics such as streptomycin [<xref ref-type="bibr" rid="scirp.117049-ref33">33</xref>]. The use of household disinfectants and acaricides is reported to select multi-resistant mutants either by a mutation on the target gene or in the regulatory mar system, providing pleiotropic resistance to disinfectants and multiple structurally unrelated antibiotics and oxidative stress agents [<xref ref-type="bibr" rid="scirp.117049-ref34">34</xref>]. According to this report, other factors other than the use of veterinary and human medicines could be leading to the stability of antibiotic resistance in dairy farms. In the current study, resistance towards cephalosporins and amoxicillin-clavulanic acids ranged between 2% - 23%, higher than the 2% - 3% in the previous study [<xref ref-type="bibr" rid="scirp.117049-ref31">31</xref>]. The difference in AMR profiles could result from variation in antimicrobial use in both humans and livestock in different sub-counties in Kiambu.</p><p>In this study, all E. coli isolates producing bla<sub>CTX</sub><sub>-M</sub> enzymes also had the bla<sub>TEM</sub> gene. However, these isolates showed no relationship in their resistance profiles. This phenomenon of co-carriage of the ESBL gene has previously been reported in a similar study [<xref ref-type="bibr" rid="scirp.117049-ref30">30</xref>]. Among the E. coli isolates resistant to 3<sup>rd</sup> generation cephalosporins and phenotypically positive for ESBL production, 3 (17%) isolates were bla<sub>CTX</sub><sub>-M</sub> and bla<sub>TEM</sub> negative. These results suggest that the isolates could have mutations in the promoter region of the multi-resistance gene cassette or due to point mutations within the primer regions [<xref ref-type="bibr" rid="scirp.117049-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.117049-ref35">35</xref>]. There is a risk of spreading and exchanging the bla genes between animal, environmental, and clinical samples. A previous study showed that the increased prevalence of the CTX-M-15 E. coli in some cattle groups and immediate environments was related to husbandry, general hygiene, and antimicrobial usage [<xref ref-type="bibr" rid="scirp.117049-ref36">36</xref>]. Although not investigated in this study, the presence of ESBL mediated resistance could result from using cephalosporins to treat mastitic and diarrhoeal diseases such as scour in calves and co-selection through using other classes of antibiotics that can select for ESBLs. Another study reported a similar co-acquisition of resistance genes in E. coli strains isolated from a dairy farm [<xref ref-type="bibr" rid="scirp.117049-ref37">37</xref>].</p><p>This study found two bla<sub>TEM</sub> variants (TEM-1 &amp; TEM-116) and bla<sub>CTX-M-15</sub> genes circulating within Kiambu county. The TEM-variant differed from the TEM-1 gene by two-point mutations at amino acids, substituting the valine residue at position 82 for isoleucine (Val82Ile) and alanine at position 182 for valine (Ala182Val). These two mutations were encountered in TEM-116 β-lactamase. In addition, three nucleotides of this variant were silent point mutations: T-to-C exchange at nucleotides 18 and 228, and a T-to-G at nucleotide 396. These amino acid mutations, which were not previously detected in other TEM type variants, may be involved in the TEM-116 enzyme’s high affinity for ceftazidime, cefotaxime, and other extended-spectrum β-lactams [<xref ref-type="bibr" rid="scirp.117049-ref38">38</xref>]. TEM-1 β-lactamase is found at high frequencies in antimicrobial-resistant bacteria (ARB). While TEM-1 has a spectrum limited to penicillins and early cephalosporins, it has given rise to more than 180 descendent alleles, such as TEM-116. These alleles confer resistance to most modern β-lactam antibiotics. We believe this is the first report on the presence of TEM-116 in a dairy farm set-up in Africa. Therefore, these findings highlight the remarkable possibility of circulating TEM-116 in Kenya and her neighbouring countries. Whether isolates of E. coli in the farm produce other ESBLs and whether the TEM-types are the direct evolutionary consequences of the original TEM-1 is worthy of further study.</p><p>The (GTG)5 PCR has the highest discriminatory power of all the Rep-PCR methods [<xref ref-type="bibr" rid="scirp.117049-ref17">17</xref>]. This study’s fingerprinting technique (GTG)5 was used for its ability to intraspecies differentiation of E. coli genomes [<xref ref-type="bibr" rid="scirp.117049-ref39">39</xref>] and showed that the isolates from cattle handlers, immediate environment, and cattle dung had no absolute distinction and were dispersed across all the cluster groups. Previous studies of E. coli from cattle feces and farm environments have shown that clonally related strains harbor the same ESBL genes seen in cultivated soil embedded with manure a year before [<xref ref-type="bibr" rid="scirp.117049-ref40">40</xref>]. The genotyping method employed in this study showed genomic diversity in the E. coli isolates with no evidence of clonal lines. Moreover, identical genotypes had different antibiotic resistance profiles. Both of these findings suggest the presence of mobile resistance determinants in the population. Since the study used low-resolution fingerprinting techniques, there is a need to access the virulence factors and genetic features of such isolates using high-resolution methods such as whole-genome sequencing.</p></sec><sec id="s5"><title>5. Conclusion</title><p>The data from this study draws a clear picture of high antibiotic resistance patterns towards sulfamethoxazole/trimethoprim, tetracycline, ampicillin, and other β-lactams. This study also showed that meropenem and kanamycin antimicrobials are still potent against human and livestock bacterial isolates. Although isolates from human samples have the highest prevalent AMR profiles, isolates from animal samples have relatively high resistance. There is, therefore, a potential for MDR bacterial strains to ensue from livestock reservoirs. The high prevalence of MDR phenotypes and co-carriage of resistance genes calls for further studies on the molecular basis of resistance amongst these isolates and their mobility. Although cattle dung is a cheap source of organic manure for crop farming, the risk of untreated manure should not be overlooked.</p></sec><sec id="s6"><title>Acknowledgements</title><p>The authors would like to thank the Centre for Microbiology Research (CMR) team at the Kenya Medical Research Institute (KEMRI) for their technical assistance.</p></sec><sec id="s7"><title>Authors’ Contributions</title><p>D. Waithiru was involved in the conception, design, data collection, and analysis and drafted the manuscript. J. Mwaniki, J. Maingi, and J. Kiiru provided expert advice in designing, implementing, and coordinating the study. E. Mulinge, J. Maina, and B. Ngugi assisted with the data collection and analysis. All authors contributed to the writing of the manuscript and approved the submission of the final manuscript.</p></sec><sec id="s8"><title>Ethical Consideration</title><p>This study was approved by the KEMRI IRB (SERU); KEMRI/SERU/CMR/ P00127/3927 before the sample collection was started. In addition, permission to conduct this study was obtained from the National Commission for Science, Technology, and Innovation (NACOSTI): NACOSTI/P/22/15775 and Kiambu county public health and veterinary services.</p></sec><sec id="s9"><title>Funding</title><p>This study was funded by the Medical Research Council (grant number MR/S004785/1) and the Kenya Medical Research Institute (KEMRI) (grant number RG-0351). The funders had no role in the study design, data collection, analysis, and the decision to publish, or preparation of the manuscript. This paper is published with the permission of the Director-General, KEMRI.</p></sec><sec id="s10"><title>Conflicts of Interest</title><p>There is no conflict of interest.</p></sec><sec id="s11"><title>Cite this paper</title><p>Waithiru, D., Njeru, J.M., Maingi, J.M., Mulinge, E., Ngugi, B., Maina, J. and Kiiru, J. (2022) Unravelling Antimicrobial Resistance Phenotypes and Carriage of Extended-Spectrum β-Lactamase Genes in Escherichia coli Isolated from Dairy Farms in Kiambu County, Kenya. Advances in Microbiology, 12, 295-315. https://doi.org/10.4236/aim.2022.125021</p></sec></body><back><ref-list><title>References</title><ref id="scirp.117049-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">O’neill, J. (2015) Antimicrobials in Agriculture and the Environment: Reducing Unnecessary Use and Waste. The Review on Antimicrobial Resistance, London.</mixed-citation></ref><ref id="scirp.117049-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Davies, S.C., Fowler, T., Watson, J., Livermore, D.M. and Walker, D. (2013) Annual Report of the Chief Medical Officer: Infection and the Rise of Antimicrobial Resistance. The Lancet, 381, 1606-1609. https://doi.org/10.1016/S0140-6736(13)60604-2</mixed-citation></ref><ref id="scirp.117049-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Kariuki, S. and Winters, C. (2010) GARP Activities in Kenya. The Center for Disease Dynamics, Economics &amp; Policy/Global Antibiotic Resistance Partnership, Washington DC.</mixed-citation></ref><ref id="scirp.117049-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Sarmah, A.K., Meyer, M.T. and Boxall, A.B.A. (2006) A Global Perspective on the Use, Sales, Exposure Pathways, Occurrence, Fate and Effects of Veterinary Antibiotics (VAs) in the Environment. Chemosphere, 65, 725-759. https://doi.org/10.1016/j.chemosphere.2006.03.026</mixed-citation></ref><ref id="scirp.117049-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Menz, J., Olsson, O. and Kümmerer, K. (2019) Antibiotic Residues in Livestock Manure: Does the EU Risk Assessment Sufficiently Protect against Microbial Toxicity and Selection of Resistant Bacteria in the Environment? Journal of Hazardous Materials, 379, Article ID: 120807. https://doi.org/10.1016/j.jhazmat.2019.120807</mixed-citation></ref><ref id="scirp.117049-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">United States Centers for Disease Control (2013) Antibiotic Resistance Threats in the United States, 2013.</mixed-citation></ref><ref id="scirp.117049-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Hendriksen, R.S., Mevius, D.J., Schroeter, A., Teale, C., Jouy, E., Butaye, P., et al. (2008) Occurrence of Antimicrobial Resistance among Bacterial Pathogens and Indicator Bacteria in Pigs in Different European Countries from Year 2002-2004: The ARBAO-II Study. Acta Veterinaria Scandinavica, 50, Article No. 19. https://doi.org/10.1186/1751-0147-50-19</mixed-citation></ref><ref id="scirp.117049-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Van den Bogaard, A.E.J.M. (2000) Antimicrobial Resistance in Pig Faecal Samples from the Netherlands (Five Abattoirs) and Sweden. Journal of Antimicrobial Chemotherapy, 45, 663-671. https://doi.org/10.1093/jac/45.5.663</mixed-citation></ref><ref id="scirp.117049-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Armoni, A., Barbón, J.L. and Petkou, A.C. (2002) Rotating Strings in Confining AdS/CFT Backgrounds. Journal of High Energy Physics, 2002, Article No. 69. https://doi.org/10.1088/1126-6708/2002/10/069</mixed-citation></ref><ref id="scirp.117049-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Pfeifer, Y., Cullik, A. and Witte, W. (2010) Resistance to Cephalosporins and Carbapenems in Gram-Negative Bacterial Pathogens. International Journal of Medical Microbiology, 300, 371-379. https://doi.org/10.1016/j.ijmm.2010.04.005</mixed-citation></ref><ref id="scirp.117049-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Bush, K. and Jacoby, G.A. (2010) Updated Functional Classification of β-Lactamases. Antimicrobial Agents and Chemotherapy, 54, 969-976. https://doi.org/10.1128/AAC.01009-09</mixed-citation></ref><ref id="scirp.117049-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Literak, I., Dolejska, M., Radimersky, T., Klimes, J., Friedman, M., Aarestrup, F.M., et al. (2010) Antimicrobial-Resistant Faecal Escherichia coli in Wild Mammals in Central Europe: Multiresistant Escherichia coli Producing Extended-Spectrum Beta-Lactamases in Wild Boars. Journal of Applied Microbiology, 108, 1702-1711. https://doi.org/10.1111/j.1365-2672.2009.04572.x</mixed-citation></ref><ref id="scirp.117049-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">CLSI (2020) CLSI M100-ED29: 2021 Performance Standards for Antimicrobial Susceptibility Testing, 30th Edition. Vol. 40.</mixed-citation></ref><ref id="scirp.117049-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Hassell, J.M., Ward, M.J., Muloi, D., Bettridge, J.M., Robinson, T.P., Kariuki, S., et al. (2019) Clinically Relevant Antimicrobial Resistance at the Wildlife-Livestock-Human Interface in Nairobi: An Epidemiological Study. The Lancet Planetary Health, 3, e259-e269. https://doi.org/10.1016/S2542-5196(19)30083-X</mixed-citation></ref><ref id="scirp.117049-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Magiorakos, A.P., Srinivasan, A., Carey, R.B., Carmeli, Y., Falagas, M.E., Giske, C.G., et al. (2012) Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clinical Microbiology and Infection, 18, 268-281. https://doi.org/10.1111/j.1469-0691.2011.03570.x</mixed-citation></ref><ref id="scirp.117049-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Dierikx, C., van der Goot, J., Fabri, T., van Essen-Zandbergen, A., Smith, H. and Mevius, D. (2013) Extended-Spectrum-β-Lactamase- and AmpC-β-Lactamase-Producing Escherichia coli in Dutch Broilers and Broiler Farmers. Journal of Antimicrobial Chemotherapy, 68, 60-67. https://doi.org/10.1093/jac/dks349</mixed-citation></ref><ref id="scirp.117049-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Mohapatra, B.R., Broersma, K. and Mazumder, A. (2007) Comparison of Five Rep-PCR Genomic Fingerprinting Methods for Differentiation of Fecal Escherichia coli from Humans, Poultry and Wild Birds. FEMS Microbiology Letters, 277, 98-106. https://doi.org/10.1111/j.1574-6968.2007.00948.x</mixed-citation></ref><ref id="scirp.117049-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Manske, M. (2006) GENtle, a Free Multi-Purpose Molecular Biology Tool. Doctoral Dissertation, Verlag Nicht Ermittelbar, Bern, 1-89. https://doi.org/10.1007/978-3-8349-9336-6_5</mixed-citation></ref><ref id="scirp.117049-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Altschul, S.F., Madden, T.L., Sch&amp;auml;ffer, A.A., Zhang, J., Zhang, Z., Miller, W., et al. (1997) Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs. Nucleic Acids Research, 25, 3389-3402. https://doi.org/10.1093/nar/25.17.3389</mixed-citation></ref><ref id="scirp.117049-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Bevan, E.R., Powell, M.J., Toleman, M.A., Thomas, C.M., Piddock, L.J.V. and Hawkey, P.M. (2021) Molecular Characterization of Plasmids Encoding blaCTX-M from Faecal Escherichia coli in Travellers Returning to the UK from South Asia. Journal of Hospital Infection, 114, 134-143. https://doi.org/10.1016/j.jhin.2021.03.030</mixed-citation></ref><ref id="scirp.117049-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Agoba, E.E., Govinden, U., Peer, A.K.C., Osei Sekyere, J., Essack, S.Y. (2018) ISAba1 Regulated OXA-23 Carbapenem Resistance in Acinetobacter baumannii Strains in Durban, South Africa. Microbial Drug Resistance, 24, 1289-1295. https://doi.org/10.1089/mdr.2017.0172</mixed-citation></ref><ref id="scirp.117049-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Aslam, B., Wang, W., Arshad, M.I., Khurshid, M., Muzammil, S., Rasool, M.H., et al. (2018) Antibiotic Resistance: A Rundown of a Global Crisis. Infection and Drug Resistance, 11, 1645-1658. https://doi.org/10.2147/IDR.S173867</mixed-citation></ref><ref id="scirp.117049-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Lhermie, G., Gr&amp;ouml;hn, Y.T. and Raboisson, D. (2017) Addressing Antimicrobial Resistance: An Overview of Priority Actions to Prevent Suboptimal Antimicrobial Use in Food-Animal Production. Frontiers in Microbiology, 7, Article No. 2114. https://doi.org/10.3389/fmicb.2016.02114</mixed-citation></ref><ref id="scirp.117049-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Shrivastava, S.R., Shrivastava, P.S. and Ramasamy, J. (2018) World Health Organization Releases Global Priority List of Antibiotic-Resistant Bacteria to Guide Research, Discovery, and Development of New Antibiotics. Journal of Medical Society, 32, 76-77. https://doi.org/10.4103/jms.jms_25_17</mixed-citation></ref><ref id="scirp.117049-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Sharma, M., Millner, P.D., Hashem, F., Vinyard, B.T., East, C.L., Handy, E.T., et al. (2018) Survival of Escherichia coli in Manure-Amended Soils Is Affected by Spatiotemporal, Agricultural, and Weather Factors in the Mid-Atlantic United States. Applied and Environmental Microbiology, 85, e02392-18. https://doi.org/10.1128/AEM.02392-18</mixed-citation></ref><ref id="scirp.117049-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Durán-Lara, E.F., Valderrama, A. and Marican, A. (2020) Natural Organic Compounds for Application in Organic Farming. Agriculture, 10, Article 41. https://doi.org/10.3390/agriculture10020041</mixed-citation></ref><ref id="scirp.117049-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Strawn, L.K. and Truitt, L. (2019) Food Safety Modernization Act Produce Safety Rule Add-On Module General Rules: Soil Amendments. Virginia Cooperative Extension, 1-18.</mixed-citation></ref><ref id="scirp.117049-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Wilson, R.T. (2018) Domestic Livestock in African Cities: Production, Problems and Prospects. Open Urban Studies and Demography Journal, 4, 1-14. https://doi.org/10.2174/2352631901804010001</mixed-citation></ref><ref id="scirp.117049-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Fairbrother, J.M. and Nadeau, é. (2006) Escherichia coli: On-Farm Contamination of Animals. OIE Revue Scientifique et Technique, 25, 555-569. https://doi.org/10.20506/rst.25.2.1682</mixed-citation></ref><ref id="scirp.117049-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Taitt, C.R., Leski, T.A., Erwin, D.P., Odundo, E.A., Kipkemoi, N.C., Ndonye, J.N., et al. (2017) Antimicrobial Resistance of Klebsiella pneumoniae Stool Isolates Circulating in Kenya. PLoS ONE, 12, e0178880. https://doi.org/10.1371/journal.pone.0178880</mixed-citation></ref><ref id="scirp.117049-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Muloi, D., Kiiru, J., Ward, M.J., Hassell, J.M., Bettridge, J.M., Robinson, T.P., et al. (2019) Epidemiology of Antimicrobial-Resistant Escherichia coli Carriage in Sympatric Humans and Livestock in a Rapidly Urbanizing City. International Journal of Antimicrobial Agents, 54, 531-537. https://doi.org/10.1016/j.ijantimicag.2019.08.014</mixed-citation></ref><ref id="scirp.117049-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Mouiche, M.M.M., Moffo, F., Akoachere, J.F.T.K., Okah-Nnane, N.H., Mapiefou, N.P., Ndze, V.N., et al. (2019) Antimicrobial Resistance from a One Health Perspective in Cameroon: A Systematic Review and Meta-Analysis. BMC Public Health, 19, Article No. 1135. https://doi.org/10.1186/s12889-019-7450-5</mixed-citation></ref><ref id="scirp.117049-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Jacoby, G.A. and Sutton, L. (1991) Properties of Plasmids Responsible for Production of Extended-Spectrum β-Lactamases. Antimicrobial Agents and Chemotherapy, 35, 164-169. https://doi.org/10.1128/AAC.35.1.164</mixed-citation></ref><ref id="scirp.117049-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Moken, M.C., McMurry, L.M. and Levy, S.B. (1997) Selection of Multiple-Antibiotic-Resistant (Mar) Mutants of Escherichia coli by Using the Disinfectant Pine Oil: Roles of the Mar and acrAB Loci. Antimicrobial Agents and Chemotherapy, 41, 2770-2772. https://doi.org/10.1128/AAC.41.12.2770</mixed-citation></ref><ref id="scirp.117049-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Liebana, E., Batchelor, M., Hopkins, K.L., Clifton-Hadley, F.A., Teale, C.J., Foster, A., et al. (2006) Longitudinal Farm Study of Extended-Spectrum Β-lactamase-mediated Resistance. Journal of Clinical Microbiology, 44, 1630-1634. https://doi.org/10.1128/JCM.44.5.1630-1634.2006</mixed-citation></ref><ref id="scirp.117049-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Watson, E., Jeckel, S., Snow, L., Stubbs, R., Teale, C., Wearing, H., et al. (2012) Epidemiology of Extended Spectrum Beta-Lactamase E. coli (CTX-M-15) on a Commercial Dairy Farm. Veterinary Microbiology, 154, 339-346. https://doi.org/10.1016/j.vetmic.2011.07.020</mixed-citation></ref><ref id="scirp.117049-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Ibrahim, D.R., Dodd, C.E.R., Stekel, D.J., Ramsden, S.J. and Hobman, J.L. (2016) Multidrug Resistant, Extended Spectrum β-Lactamase (ESBL)-Producing Escherichia coli Isolated from a Dairy Farm. FEMS Microbiology Ecology, 92, fiw013. https://doi.org/10.1093/femsec/fiw013</mixed-citation></ref><ref id="scirp.117049-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Lahlaoui, H., Dahmen, S., Moussa, M.B. and Omrane, B. (2011) First Detection of TEM-116 Extended-Spectrum β-Lactamase in a Providencia stuartii Isolate from a Tunisian Hospital. Indian Journal of Medical Microbiology, 29, 258-261. https://doi.org/10.4103/0255-0857.83909</mixed-citation></ref><ref id="scirp.117049-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Gevers, D., Huys, G. and Swings, J. (2001) Applicability of rep-PCR Fingerprinting for Identification of Lactobacillus Species. FEMS Microbiology Letters, 205, 31-36. https://doi.org/10.1111/j.1574-6968.2001.tb10921.x</mixed-citation></ref><ref id="scirp.117049-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Hartmann, A., Locatelli, A., Amoureux, L., Depret, G., Jolivet, C., Gueneau, E., et al. (2012) Occurrence of CTX-M Producing Escherichia coli in Soils, Cattle, and Farm Environment in France (Burgundy Region). Frontiers in Microbiology, 3, Article No. 83. https://doi.org/10.3389/fmicb.2012.00083</mixed-citation></ref></ref-list></back></article>