<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJMB</journal-id><journal-title-group><journal-title>American Journal of Molecular Biology</journal-title></journal-title-group><issn pub-type="epub">2161-6620</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajmb.2022.122005</article-id><article-id pub-id-type="publisher-id">AJMB-116781</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Investigation of &lt;i&gt;Plasmodium falciparum&lt;/i&gt; Resistance Biomarkers among Primary School Children in Western Kenya
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Otilmoi</surname><given-names>Poul Stephen</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tonny</surname><given-names>Teya Nyandwaro</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Robinson</surname><given-names>Mugasiali Irekwa</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Rebecca</surname><given-names>Wanjiku Waihenya</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Matthew</surname><given-names>Mutinda Munyao</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Peter</surname><given-names>Kipkemboi Rotich</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Caroline</surname><given-names>Wangui Njoroge</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Anne</surname><given-names>Wanjiru Mwangi</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Joanne</surname><given-names>Jepkemei Yego</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Nicole</surname><given-names>Sian Tanchu</given-names></name><xref ref-type="aff" rid="aff6"><sup>6</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Dawala</surname><given-names>Koromtili Oumar</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Grace</surname><given-names>Ngendo Kanyita</given-names></name><xref ref-type="aff" rid="aff7"><sup>7</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Primrose</surname><given-names>Muthoni Ndungu</given-names></name><xref ref-type="aff" rid="aff8"><sup>8</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Samson</surname><given-names>Muuo Nzou</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib></contrib-group><aff id="aff5"><addr-line>Centre for Microbiology Research, Kenya Medical Research Institute, Nairobi, Kenya</addr-line></aff><aff id="aff8"><addr-line>Department of Pharmacology and Pharmacognosy, University of Nairobi, Nairobi, Kenya</addr-line></aff><aff id="aff6"><addr-line>Nagasaki University Institute of Tropical Medicine, Kenya Medical Research Institute (NUITM-KEMRI), Nairobi, Kenya</addr-line></aff><aff id="aff1"><addr-line>Department of Molecular Biology and Biotechnology, Pan-African University Institute of Basic Sciences, Technology and Innovation, Nairobi, Kenya</addr-line></aff><aff id="aff2"><addr-line>Innovation, Technology Transfer Department, Kenya Medical Research Institute (ITTD-KEMRI), Nairobi, Kenya</addr-line></aff><aff id="aff3"><addr-line>Zoology Department, School of Biological Sciences, College of Pure and Applied Sciences, Jomo Kenyatta University of Agriculture and Technology, Nairobi, Kenya</addr-line></aff><aff id="aff4"><addr-line>Production Department, KEMRI, Nairobi, Kenya</addr-line></aff><aff id="aff7"><addr-line>Department of Biochemistry, Microbiology and Biotechnology, Kenyatta University, Nairobi, Kenya</addr-line></aff><pub-date pub-type="epub"><day>06</day><month>04</month><year>2022</year></pub-date><volume>12</volume><issue>02</issue><fpage>43</fpage><lpage>53</lpage><history><date date-type="received"><day>24,</day>	<month>February</month>	<year>2022</year></date><date date-type="rev-recd"><day>23,</day>	<month>April</month>	<year>2022</year>	</date><date date-type="accepted"><day>26,</day>	<month>April</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  <b>Background:</b> A marked decrease in malaria-related deaths worldwide has been attributed to the administration of effective antimalarials against 
  Plasmodium falciparum. However, the continuous spread of 
  P. falciparum resistance to anti-malarial drugs is raising a serious problem in controlling Malaria to the vulnerable children’s immune system. In recent studies, 
  Plasmodium falciparum Kelch 13 propeller gene (
  Pfk13) has been reported to develop resistance to artemisinin in South Asia. In this study, we checked 
  Plasmodium falciparum chloroquine resistance transporter gene (
  Pfcrt) involved in chloroquine (CQ) resistance. 
  <b>Method:</b> In this study, archived 280 samples were collected from Alupe primary school children in Busia, Western Kenya from May, 2016 to November, 2016. Genomic DNA was extracted using the MightyPrep reagent. The samples were investigated for 
  P. falciparum positivity out of which 67 of them tested positive giving a prevalence rate of 24%. The sixty-seven were subjected to PCR amplification for the molecular marker resistance to 
  Pfcrt. After PCR amplification, the amplicons were purified and sequenced using Sanger Sequencing. The sequence data were analyzed using BioEdit software to identify point mutations. 
  <b>Results:</b> 14 samples sequences were analyzed on Bioedit software giving the following amino acid changes F76C, Y66H, L70A, Y58C, T59V, V65I, P67L, T81L, Y60S, Y66S, P67T and I71F). New mutations have been reported at position 76 leading to an amino acid change, one of Pfcrt gold standard biomarkers. However, amino acid changes Y66H, L70A, Y58C, T59V, V65I, P67L, T81L, Y60S, Y66S, P67T and I71F are newly reported giving an increase in Pfcrt prevalence of concern from zero to 5.0%. A phylogenetic evolutionary relationship was constructed as shown below. Generally, the results showed a continuous resistance of 
  P.
  
  falciparum to Pfcrt which calls for robust continuous monitoring and surveillance.
  <b> Conclusion:</b> Due to the increase of the resistant Pfcrt gene prevalence, continuous development of new mutants against chloroquine indicates that there is need to repurpose anti-malarial drugs for future partner drugs.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;P. falciparum</kwd><kwd> Chloroquine&lt;/i&gt;</kwd><kwd> Drug Resistance</kwd><kwd> Malaria</kwd><kwd> &lt;i&gt;P. falciparum&lt;/i&gt; Chloroquine Resistance Transporter Gene</kwd><kwd> Mutations</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Despite numerous advances in malaria control strategies, the disease still kills countless children worldwide, mainly in Sub-Saharan African countries. Assessing the genetic diversity of P. falciparum populations in different regions may allow tracking malaria parasites circulating across different geographic areas [<xref ref-type="bibr" rid="scirp.116781-ref1">1</xref>]. Malaria continues to cause unacceptably high levels of disease and death, as documented in successive editions of the World malaria report [<xref ref-type="bibr" rid="scirp.116781-ref2">2</xref>]. According to the latest report, there were estimated 229 million cases and 409,000 deaths globally in 2019. Malaria is preventable and treatable, and the global priority is to reduce the burden of disease and death while retaining the long-term vision of malaria eradication [<xref ref-type="bibr" rid="scirp.116781-ref3">3</xref>]. According to the world malaria report 2016, there were 212 million cases of malaria and approximately 438,000 deaths due to malaria infections. 90% of these deaths occur in Sub-Saharan Africa and 70% are children aged below 5 years old. It is the leading cause of morbidity in children with 10% of all deaths among the under-fives which is equivalent to one child in Sub-Saharan Africa dying of malaria every two minutes. In Kenya, more than 4 million cases of malaria are reported annually and P. falciparum is the most frequently associated with severe Malaria accounting to 80% - 90% of all the cases in the country. P. falcciparum is the cause of high mortality rate in Africa [<xref ref-type="bibr" rid="scirp.116781-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.116781-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.116781-ref6">6</xref>]. Five years before, it was reported that malaria caused around 627,000 deaths in 2013, mostly of children aged less than 5 years living in Africa. There are now a large number of regular prevalence surveys of childhood parasitaemia, as most malaria deaths occur in children, but published surveys of parasitaemia in the general adult population are very scarce [<xref ref-type="bibr" rid="scirp.116781-ref7">7</xref>]. P. falciparum had developed high levels of resistance to the available, cheap and safe drugs such as, quinolones derivatives [<xref ref-type="bibr" rid="scirp.116781-ref8">8</xref>]. Chloroquine (CQ) was one of the first safe and effective antimalarials to be employed. It is characterized by potent and selective cytotoxic action against P. falciparum and the spread of drug resistance is a major obstacle for this achievement [<xref ref-type="bibr" rid="scirp.116781-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.116781-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.116781-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.116781-ref12">12</xref>]. CQ exerts its antimalarial effect by preventing the polymerization of toxic heme released during proteolysis of hemoglobin in the P. falciparum digestive vacuole, hence blocking the hemozoin elongation reaction in the absence of protein causing digestive vacuole swelling and pigment clumping [<xref ref-type="bibr" rid="scirp.116781-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.116781-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.116781-ref15">15</xref>]. Molecular markers of drug-resistance are very useful in identifying drug resistant P. falciparum, other examples are; quantitative trait locus (QTL), construction of genetic linkage maps, population studies. They are used in epidemiological surveillance of drug-resistance including their emergence and spread monitoring. Molecular markers have been described for many of the common anti-malarial drugs and are constituted of either single nucleotide substitution (SNP) or concatenated SNP in genes involved in parasite interaction with drugs [<xref ref-type="bibr" rid="scirp.116781-ref1">1</xref>]. In addition, long-term monitoring of parasite sensitivity to previously withdrawn anti-malarial drugs, such as CQ, can provide useful surveillance information if these drugs target similar resistance markers to current candidate ACT partner drugs [<xref ref-type="bibr" rid="scirp.116781-ref16">16</xref>].</p></sec><sec id="s2"><title>2. Material and Methods</title><sec id="s2_1"><title>2.1. Ethics Statement</title><p>The study was approved by the Jomo Kenyatta University of Agriculture and Technology Institutional Ethics Review Committee (JKUAT-IERC) under the Reference number JKU/IERC/02316/0516. The study was conducted on archived primary school children samples that were positive for P. falciparum using a gold standard microscopy, stored at −80˚C at Nagasaki University, Institute of Tropical Medicine based at the Kenya Medical Research Institute (NUITM-KEMRI). The study samples were collected from Busia County primary schools, in Western Kenya with written informed consent from their parents or guardians.</p></sec><sec id="s2_2"><title>2.2. Prevalence</title><p>P. falciparum was extracted from dried blood spots then subjected to direct Polymerase chain reaction. The percentage prevalence was determined using descriptive statistics, where, the number of positive samples was divided by the total number of samples collected from primary school children multiplied by 100%.</p><p>That is, Percentage prevalence = frequency Total number of   samples &#215; 100 .</p></sec><sec id="s2_3"><title>2.3. Detection of P. falciparum</title><sec id="s2_3_1"><title>2.3.1. Sample Preparation</title><p>280 Dried Blood Spots (DBS) Deoxyribonucleic Acid (DNA) lysates were prepared using the MightyPrep reagent (TAKARA BIO INC, Kusatsu, Shiga Prefecture, Japan; Cat No: 9182) following the manufacture’s protocol with slight modifications. One Dried Blood Spot (DBS) was carefully cut and put into a 1.5 ml Eppendorf tube, 100 &#181;l of MightyPrep reagent for DNA was added to the tube, spun at 15,000 rpm for 1 minute and heated at 95˚C for 15 minutes while shaking at 800 rpm and later cooled down on a heat block. The sample was hard vortexed for 1 minute, spun at 15,000 rpm for 2 minutes and stored at −30˚C ready for downstream processing.</p></sec><sec id="s2_3_2"><title>2.3.2. Direct PCR Amplication of P. falciparum</title><p>Polymerase chain reaction (PCR) was performed on the DBS lysate to confirm malaria infection by P. falciparum. Primers are specific to P. falciparum (<xref ref-type="table" rid="table1">Table 1</xref>). A master mix was prepared which contained a total of 20 &#181;l per reaction. 5.38 &#181;l water, 10 &#181;l of 2&#215; Buffer V3, 2 &#181;l of 10&#215; additive, 0.12 &#181;l primer mix, 0.5 &#181;l MightAmp V3 and 2 &#181;l STD lysate and water as negative control (NC). The PCR was performed on the following conditions: 98˚C for 2 minutes to inactivate the blocking antibody, 40 cycles, denaturation at 98˚C for 10 seconds, annealing at 60˚C for 15 seconds, extension at 68˚C for 1 minute and 42 seconds max 1.7 kb (CT) (1 min/1kbp), 4˚C for 2 minutes to cool down the sample and left on hold at 4˚C∞.</p></sec></sec><sec id="s2_4"><title>2.4. Agarose Gel Electrophoresis</title><p>The PCR amplicons were subjected to 2.0% agarose S (Lot No. 17047B, Japan). 6x loading dye (Nippon Gene; Cat No: 314-90261) was diluted with sample to make 1x and loaded onto the gel. The 100 bp GelPilot<sup>&#174;</sup> Ladder marker (Qiagen; Cat No: 239035) was used and run at 100 V for 35 minutes. The gels were stained with 2x GelRed™ Nucleic Acid Gel Stain (Biotium; Cat No: 41003) for one hour on a shaker. The image was viewed using the Ultra Slim Blue Light Transilluminator (Maestrogen).</p></sec><sec id="s2_5"><title>2.5. Amplification of Chloroquine Resistance Transporter Genes (Pfcrt)</title><p>Malaria positive samples with P. falciparum were subjected to second nested</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers for amplification of P. falciparum</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  colspan="4"  >Plasmodium falciparum</th></tr></thead><tr><td align="center" valign="middle" >Primers</td><td align="center" valign="middle" >Sequences</td><td align="center" valign="middle" >Melting Temperature (TM)</td><td align="center" valign="middle" >Product Size</td></tr><tr><td align="center" valign="middle" >rPLU1 F'</td><td align="center" valign="middle" >TCAAAGATTAAGCCATGCAAGTGA</td><td align="center" valign="middle" >60</td><td align="center" valign="middle" >1638 bp</td></tr><tr><td align="center" valign="middle" >rPLU5 R'</td><td align="center" valign="middle" >CCTGTTGTTGCCTTAAACTCC</td><td align="center" valign="middle" >59</td><td align="center" valign="middle" >1638 bp</td></tr></tbody></table></table-wrap><p>PCR to amplify the amplicons using P. falciparum chloroquine resistance transporter genes specific primers (<xref ref-type="table" rid="table2">Table 2</xref>). A total of 20 &#181;L reaction per PCR was set up as follows; 2 &#181;L of PCR products was added to 18 &#181;L Thermo Scientific™ DreamTaq™ Hot Start Green PCR Master Mix (2x) (Lot No. 00783196). PCR reaction was performed in separate reactions at different conditions. The PCR program was set at initial denaturation at 95˚C for 3 minutes, 35 cycles for both Pfcrt forward and reverse primers 95˚C for 30 seconds, annealing at 58˚C seconds and 72˚C for 60 seconds and final extension at 72˚C for 15 minutes in the SimpliAmp™ Thermal Cycler (Thermo Fisher Scientific). The PCR products were run on 2.0% agarose gel for 35 minutes at 100 V and the gel was stained with 2x GelRed for 1 hour and visualized using Ultra Slim Blue Light Transilluminator (Maestrogen).</p></sec><sec id="s2_6"><title>2.6. Gel Extraction and DNA Purification</title><p>All the samples that showed bands for Pfcrt gene were excised using a scalpel on an Ultra Slim Blue Light Transilluminator (Maestrogen). The excised gel containing the DNA of interest was placed in a sterile 1.5 eppendorf tube. The samples were purified using QIAquick gel extraction kit (Cat. Number 28704) from Qiagen following the manufacturers’ instructions. 3 volumes of buffer QG was added to 1 volume (100 mg gel~100 ul), incubated at 50˚C for 10 minutes. In addition, equal volume of isopropanol to 1 gel volume was added and mixed followed by spinning at 13,000 rpm for 1 minute. Furthermore, 500 ul of QG buffer was added to the sample and spun for 1 minute and 750 ul of PE buffer was added followed by spinning at 13,000 rpm for 1 minute and the final column was transferred to a new Eppendorf tube and finally eluted by adding 50 ul buffer EB and spun at 13,000 rpm for 1 minute.</p></sec><sec id="s2_7"><title>2.7. Pfcrt Gene Sequence Analysis</title><p>The PCR products containing the amplified PCR gene were sequenced using Sanger sequencing for forward primer (Macrogen Europe B.V, Amsterdam Netherland). The samples’ sequences were trimmed on a Chromas tool followed by analysis using Bioedit software. The sequences were blasted before multiple sequence alignment was conducted (https://blast.ncbi.nlm.nih.gov).</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Chloroquine resistance transporter (Pfcrt) gene primers</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  colspan="4"  >Plasmodium falciparum chloroquine resistance transporter gene (Pfcrt)</th></tr></thead><tr><td align="center" valign="middle" >Primers</td><td align="center" valign="middle" >Sequences</td><td align="center" valign="middle" >Melting Temperature (TM)</td><td align="center" valign="middle" >Size</td></tr><tr><td align="center" valign="middle" >Pfcrt F'</td><td align="center" valign="middle" >GTTCTTGTCTTGGTAAATGT</td><td align="center" valign="middle" >56.6</td><td align="center" valign="middle" >530 bp</td></tr><tr><td align="center" valign="middle" >Pfcrt R'</td><td align="center" valign="middle" >CGGATGTTACAAAACTATAGTT</td><td align="center" valign="middle" >60.9</td><td align="center" valign="middle" >530 bp</td></tr></tbody></table></table-wrap></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. P. falciparum Chloroquine Resistance Transporter Gene Analysis</title><p><xref ref-type="fig" rid="fig1">Figure 1</xref> shows the samples that were amplified for P. falciparum using rPLU1 forward and rPLU5 reverse primers. Bands were observed on positive samples, a negative control (NC), a positive control (PC), and a 100 bp ladder at both ends in a 13-well agarose gel with a target size of 1638 bp.</p><p>P. faciparum was detected in 280 samples dried blood spot (DBS). <xref ref-type="fig" rid="fig2">Figure 2</xref> shows, second nested detection of amplified PCR products targeting the P. falciparum chloroquine resistance transporter gene (Pfcrt). Sample lane 2, 11, 12, 14, 17, 19, 22 showed clear bands in a 26-well agarose gel at Pfcrt gene target size 530 bp.</p><p>The gel contains both positive and negative samples for Pfcrt gene. The samples that turned positive for Pfcrt gene are denoted with numbers with positive control (PC) and negative control (NC) as the marker.</p><p>Point mutations were identified as a result of substitutions in 14 samples, that is, S017 had point mutations at positions 196 (T196C) and 209 (T209A) with amino acid changes Y66H and L70A respectively. However, S048 had a transitional</p><p>substitution at position A173G, A175G, G193A, C200T, T241C with amino acid changes Y58C, T59V, V65I, P67L, T81L and substitution by transversion at position A179C, A197C, C199A, A211T, T227G with amino acid changes Y60S, Y66S, P67T, I71F and F76C. No amino acid changes were found at positions C198T, T222C and T234C.</p></sec><sec id="s3_2"><title>3.2. Evolutionary Relationships of Pfcrt Gene among Sample</title><p>Using the NCBI Reference Sequence NC_004328, a phylogenetic tree was constructed showing evolutionary relationship among 14 samples (S17, S38, S42, S45, S47, S48, S50, S56, S58, S59, S61, S62, S65 and S67) using Protdist Neighbor-Joining method as shown in <xref ref-type="fig" rid="fig3">Figure 3</xref> below.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>CQ resistance is strongly associated with a single nucleotide polymorphism (SNP), resulting in a Lys76Thr change in the pfcrt gene, which encodes the CQ resistance transporter [<xref ref-type="bibr" rid="scirp.116781-ref17">17</xref>]. In Africa, the pfcrt Lys76Thr change appears to be a reliable marker for CQ resistance [<xref ref-type="bibr" rid="scirp.116781-ref17">17</xref>]. This study detected 2 samples which conferred P. falciparum CQ resistance transporter (Pfcrt) gene leading to the following amino acid changes Y66H, L70A, Y58C, T59V, V65I, P67L, T81L, Y60S, Y66S, P67T, I71F and F76C as shown in (<xref ref-type="table" rid="table3">Table 3</xref>). The percentage prevalence of pfcrt marker in Busia County was 5.0%, this showing in every 20 samples, one patient had developed resistance. Studies from Western Kenya demonstrated that in 2008, the prevalence of parasites with the Pfcrt genotype was 72.4%, which was shown to decline to 32.1% by 2011, 7% by 2013, 18% in 2010 to 0% by 2013 [<xref ref-type="bibr" rid="scirp.116781-ref18">18</xref>]. However, our study showed an increase of Pfcrt gene to 5.0% from 0% according to Luchi et al., study reported in 2015. High prevalence of Pfcrt mutant gene in this present study could be as a result of the treatment of malaria infection with the use of chloroquine in which long time exposure of the parasite to the drug could bring about mutation leading to development of the Pfcrt mutant genes [<xref ref-type="bibr" rid="scirp.116781-ref19">19</xref>]. The simultaneous presence of very low and high prevalence of CQ could be related to a between-regions difference of CQ pressure and</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Point mutation and amino acids changes</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Gene</th><th align="center" valign="middle"  rowspan="2"  ></th><th align="center" valign="middle"  colspan="2"  >Samples</th></tr></thead><tr><td align="center" valign="middle" >S017</td><td align="center" valign="middle" >S048</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >Plasmodium falciparum 3D7 genome assembly, chromosome: 7 Pfcrt (PF3D7_0709000)</td><td align="center" valign="middle" >Point mutations</td><td align="center" valign="middle" >T196C T209A</td><td align="center" valign="middle" >A173G, A175G, A179C, G193A, A197C, C198T (No Change), C199A, C200T, A211T, T222C (No Change), T227G, T234C (No Change), T241C</td></tr><tr><td align="center" valign="middle" >Amino Acids (AA) Changes</td><td align="center" valign="middle" >Y66H L70 STOP</td><td align="center" valign="middle" >Y58C, T59V, Y60S, V65I, Y66S, Y66Y (No Change), P67T, P67L, I71F, F74F (No change), F76C, F78F (No Change), F81L</td></tr></tbody></table></table-wrap><p>also to the effect of selection for CQ resistance depending on the genetic structure of parasite populations, which have been shown to vary significantly across the country [<xref ref-type="bibr" rid="scirp.116781-ref20">20</xref>].</p><p>This study reported new mutational changes which might be as a result of the high levels of gene flow between lowland and highland populations facilitating the introduction of new alleles from endemic lowland sites. Lack of genetic structure between highland and lowland populations, as determined by the analysis of molecular variance may result from human travel between highland and lowland sites [<xref ref-type="bibr" rid="scirp.116781-ref21">21</xref>]. Busia, Western Kenya borders Uganda on the West. ACT rarely reaches such remote areas of the county, hence many results to over-the counter medicine to the old drugs AQ and SP.</p><p>There was no statistical difference in the mutational frequencies at F76C, such a high frequency of the Pfcrt K76T mutation suggests that the fitness costs associated with this mutation is not high enough to cause dramatic reduction in its frequency [<xref ref-type="bibr" rid="scirp.116781-ref21">21</xref>]. Alternatively, infrequent but continuous use of AQ, a 4-aminoquinoline compound related to CQ and artemisinin or in combination with SP or artesunate to treat uncomplicated malaria infections in children might have been the reason for CQ resistance recrudescence. These quinolines-based compounds like amodiaquine, mefloquine, primaquine, and piperaquine share a similar structure [<xref ref-type="bibr" rid="scirp.116781-ref22">22</xref>] Resistance also develops more quickly where a large population of parasites are exposed to drug pressure removing sensitive parasites, while resistant parasites would survive [<xref ref-type="bibr" rid="scirp.116781-ref23">23</xref>]. The study showed novel nucleotide substitutions not reported before.</p><p>The phylogenetic relationship showed that the reference gene (accession number MW275076), the root for the samples has a common ancestral origin with the samples resistance to Pfcrt. The topology of the dendrogram is a rooted cladogram structure and is well defined in samples S17, S38, S42, S45, S50, S56, S58, S59, S61, S65 and S67 have the most recent common ancestry which can form a clade. Sample S45 and S50 are sisters with same evolutionary relationship origin, the same applies to samples S47 and S59, and S17, S61, S58, S38, S56 and S67. Sample 48 has a longer branching, and the longer the branching the more the genetic change divergence.</p></sec><sec id="s5"><title>5. Conclusion and Recommendation</title><p>The study found novel and synonymous mutations in CQ resistance transporter gene coupled with increased SNPs. In this view continuous surveillance is required to monitor of prospect related drugs such as AQ and 4-aminoquilones. Findings suggest that SNPs in Pfcrt genes could be as a result of the related drugs recrudescence. However, the impact of P. falciparum chloroquine resistance transporter gene mutation requires further study with its related drugs altogether.</p></sec><sec id="s6"><title>Acknowledgements</title><p>This study was strongly supported by Nagasaki University Institute of Tropical Medicine in collaboration with Kenya Medical Research Institute (NUITM-KEMRI). The authors appreciate the African Union Commission through the Pan African University Institute of Basic Science and Technology (PAUSTI) hosted by Jomo Kenyatta University of Agriculture and Technology (JKUAT) for their input in this study.</p></sec><sec id="s7"><title>Authors’ Contribution</title><p>Conceptualization, Methodology, Investigation, Manuscript review, O. P. S: Methodology, Manuscript review T.T.N, R.M.I: Supervision, R.W.W: Investigation, M.M.M, P.K.R, C.W.N, A.W.M, J.J.Y, N.S.T, D.K.O, G.N.K, P.M.N: Conceptualization, Methodology, Investigation, Manuscript review, Supervision S.M.N.</p></sec><sec id="s8"><title>Funding</title><p>The study was funded by the African Union Commission through Pan African University Institute of Basic Science, Technology and Innovation (PAUSTI) and Nagasaki University Institute of Tropical Medicine at Kenya Medical Research Institute (NUITM-KEMRI).</p></sec><sec id="s9"><title>Competing Interest</title><p>The authors declare that there are no competing interests.</p></sec><sec id="s10"><title>Cite this paper</title><p>Stephen, O.P., Nyandwaro, T.T., Irekwa, R.M., Waihenya, R.W., Munyao, M.M., Rotich, P.K., Njoroge, C.W., Mwangi, A.W., Yego, J.J., Tanchu, N.S., Oumar, D.K., Kanyita, G.N., Ndungu, P.M. and Nzou, S.M. (2022) Investigation of Plasmodium falciparum Resistance Biomarkers among Primary School Children in Western Kenya. American Journal of Molecular Biology, 12, 43-53. https://doi.org/10.4236/ajmb.2022.122005</p></sec><sec id="s11"><title>Abbreviations</title><p>Pfcrt: Plasmodium falciparum chloroquine resistance transporter; PCR: Polymerase Chain Reaction; SNPs: Single Nucleotide Polymorphism; DBS: Dried Blood Spot; CQ: Chloroquine; DR: Drug Resistance; ACT: Artemisinin based Combination Therapy; AQ: Amodiaquine; SP: Sulfadoxine pyrimethamine.</p></sec></body><back><ref-list><title>References</title><ref id="scirp.116781-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Diakité, S.A.S., Traoré, K., Sanogo, I., Clark, T.G., Campino, S., Sangaré, M., et al. (2019) A Comprehensive Analysis of Drug Resistance Molecular Markers and Plasmodium falciparum Genetic Diversity in Two Malaria Endemic Sites in Mali. Malaria Journal, 18, Article No. 361. https://doi.org/10.1186/s12936-019-2986-5</mixed-citation></ref><ref id="scirp.116781-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2020) World Malaria Report: 20 Years of Global Progress and Challenges. Vol. WHO/HTM/GM, World Health Organization, Geneva, 299 p. https://www.who.int/publications/i/item/9789240015791</mixed-citation></ref><ref id="scirp.116781-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2021, July 13) WHO Guidelines for Malaria, 2021. Geneva. http://apps.who.int/bookorders</mixed-citation></ref><ref id="scirp.116781-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">(2018) Microsoft Word—Abstract 47—Prevalence of Malaria Infection among the Under-Fives Attending Busia County Referral Hospital Laboratory. 2-3.</mixed-citation></ref><ref id="scirp.116781-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Fontecha, G., Pinto, A., Archaga, O., Betancourth, S., Escober, L., Henríquez, J., et al. (2021) Assessment of Plasmodium falciparum Anti-Malarial Drug Resistance Markers in pfcrt and pfmdr1 Genes in Isolates from Honduras and Nicaragua, 2018-2021. Malaria Journal, 20, Article No. 465.  
https://doi.org/10.1186/s12936-021-03977-8</mixed-citation></ref><ref id="scirp.116781-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, T., Xu, X., Jiang, J., Yu, C., Tian, C. and Li, W. (2018) Surveillance of Antimalarial Resistance Molecular Markers in Imported Plasmodium falciparum Malaria Cases in Anhui, China, 2012-2016. American Journal of Tropical Medicine and Hygiene, 98, 1132-1136. https://doi.org/10.4269/ajtmh.17-0864</mixed-citation></ref><ref id="scirp.116781-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Jenkins, R., Omollo, R., Ongecha, M., Sifuna, P., Othieno, C., Ongeri, L., et al. (2015) Prevalence of Malaria Parasites in Adults and Its Determinants in Malaria Endemic Area of Kisumu County, Kenya. Malaria Journal, 14, Article No. 263.  
https://doi.org/10.1186/s12936-015-0781-5</mixed-citation></ref><ref id="scirp.116781-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Wangai, L., Geoffrey, M., Omar, S., Magoma, G., Kimani, F., Mwangi, J., et al. (2011) Molecular Screening for Plasmodium falciparum Resistance Markers for Artemisinins in Mbita, Kenya. African Journal of Clinical and Experimental Microbiology, 12, 106-110. https://doi.org/10.4314/ajcem.v12i3.4</mixed-citation></ref><ref id="scirp.116781-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Silva, S.R., Almeida, A.C.G., Da Silva, G.A.V., Ramasawmy, R., Lopes, S.C.P., Siqueira, A.M., et al. (2018) Chloroquine Resistance Is Associated to Multi-Copy Pvcrt-o Gene in Plasmodium vivax Malaria in the Brazilian Amazon. Malaria Journal, 17, Article No. 267. https://doi.org/10.1186/s12936-018-2411-5</mixed-citation></ref><ref id="scirp.116781-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Ross, L.S., Dhingra, S.K., Mok, S., Yeo, T., Wicht, K.J., Kümpornsin, K., et al. (2018) Emerging Southeast Asian PfCRT Mutations Confer Plasmodium falciparum Resistance to the First-Line Antimalarial Piperaquine. Nature Communications, 9, 25-28.  
https://doi.org/10.1038/s41467-018-05652-0</mixed-citation></ref><ref id="scirp.116781-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Sekihara, M., Tachibana, S.I., Yamauchi, M., Yatsushiro, S., Tiwara, S., Fukuda, N., et al. (2018) Lack of Significant Recovery of Chloroquine Sensitivity in Plasmodium falciparum Parasites Following Discontinuance of Chloroquine Use in Papua New Guinea. Malaria Journal, 17, Article No. 434.  
https://doi.org/10.1186/s12936-018-2585-x</mixed-citation></ref><ref id="scirp.116781-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Relitti, N., Federico, S., Pozzetti, L., Butini, S., Lamponi, S., Taramelli, D., et al. (2021) Synthesis and Biological Evaluation of Benzhydryl-Based Antiplasmodial Agents Possessing Plasmodium falciparum Chloroquine Resistance Transporter (PfCRT) Inhibitory Activity. European Journal of Medicinal Chemistry, 215, Article ID: 113227. https://doi.org/10.1016/j.ejmech.2021.113227</mixed-citation></ref><ref id="scirp.116781-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Sullivan, D.J., Gluzman, I.Y., Russell, D.G. and Goldberg, D.E. (1996) On the Molecular Mechanism of Chloroquine’s Antimalarial Action. Proceedings of the National Academy of Sciences of the United States of America, 93, 11865-11870.  
https://doi.org/10.1073/pnas.93.21.11865</mixed-citation></ref><ref id="scirp.116781-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Wicht, K.J., Mok, S. and Fidock, D.A. (2020) Molecular Mechanisms of Drug Resistance in Plasmodium falciparum Malaria. Annual Review of Microbiology, 74, 431-454. https://doi.org/10.1146/annurev-micro-020518-115546</mixed-citation></ref><ref id="scirp.116781-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Ross, L.S. and Fidock, D.A. (2019) Elucidating Mechanisms of Drug-Resistant Plasmodium falciparum. Cell Host &amp; Microbe, 26, 35-47.  
https://doi.org/10.1016/j.chom.2019.06.001</mixed-citation></ref><ref id="scirp.116781-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Shah, M., Omosun, Y., Lal, A., Odero, C., Gatei, W., Otieno, K., et al. (2015) Assessment of Molecular Markers for Anti-Malarial Drug Resistance after the Introduction and Scale-Up of Malaria Control Interventions in Western Kenya. Malaria Journal, 19, Article No. 291. https://doi.org/10.1186/s12936-015-0588-4</mixed-citation></ref><ref id="scirp.116781-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Conrad, M.D. and Rosenthal, P.J. (2019) Antimalarial Drug Resistance in Africa: The Calm before the Storm? The Lancet Infectious Diseases, 19, e338-e351.  
https://doi.org/10.1016/S1473-3099(19)30261-0</mixed-citation></ref><ref id="scirp.116781-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Lucchi, N.W., Komino, F., Okoth, S.A., Goldman, I., Onyona, P., Wiegand, R.E., et al. (2015) In Vitro and Molecular Surveillance for Antimalarial Drug Resistance in Plasmodium falciparum Parasites in Western Kenya Reveals Sustained Artemisinin Sensitivity and Increased Chloroquine Sensitivity. Antimicrobial Agents and Chemotherapy, 59, 7540-7547. https://doi.org/10.1128/AAC.01894-15</mixed-citation></ref><ref id="scirp.116781-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Simon-Oke, I.A., Obimakinde, E.T. and Afolabi, O.J. (2018) Prevalence and Distribution of Malaria, Pfcrt and Pfmdr 1 Genes in Patients Attending FUT Health Centre, Akure, Nigeria. Beni-Suef University Journal of Basic and Applied Sciences, 7, 98-103. https://doi.org/10.1016/j.bjbas.2017.07.009</mixed-citation></ref><ref id="scirp.116781-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Yobi, D.M., Kayiba, N.K., Mvumbi, D.M., Boreux, R., Kabututu, P.Z., Situakibanza, H.N.T., et al. (2021) Assessment of Plasmodium falciparum Anti-Malarial Drug Resistance Markers in pfk13-Propeller, pfcrt and pfmdr1 Genes in Isolates from Treatment Failure Patients in Democratic Republic of Congo, 2018-2019. Malaria Journal, 20, Article No. 465. https://doi.org/10.1186/s12936-021-03636-y</mixed-citation></ref><ref id="scirp.116781-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Bonizzoni, M., Afrane, Y., Baliraine, F.N., Amenya, D.A., Githeko, A.K. and Yan, G. (2009) Genetic Structure of Plasmodium falciparum Populations between Lowland and Highland Sites and Antimalarial Drug Resistance in Western Kenya. Infection, Genetics and Evolution, 9, 806-812. https://doi.org/10.1016/j.meegid.2009.04.015</mixed-citation></ref><ref id="scirp.116781-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Foguim, F.T., Bogreau, H., Gendrot, M., Mosnier, J., Fonta, I., Benoit, N., et al. (2020) Prevalence of Mutations in the Plasmodium falciparum Chloroquine Resistance Transporter, PfCRT, and Association with ex Vivo Susceptibility to Common Anti-Malarial Drugs against African Plasmodium falciparum Isolates. Malaria Journal, 19, Article No. 201.</mixed-citation></ref><ref id="scirp.116781-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Eyasu, M. (2015) Antimalarial Drug Resistance: In the Past, Current Status and Future Perspectives. British Journal of Pharmacology and Toxicology, 6, 1-15.  
https://doi.org/10.19026/bjpt.6.5186</mixed-citation></ref></ref-list></back></article>