<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJST</journal-id><journal-title-group><journal-title>Open Journal of Stomatology</journal-title></journal-title-group><issn pub-type="epub">2160-8709</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojst.2022.124011</article-id><article-id pub-id-type="publisher-id">OJST-116587</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Medicine&amp;Healthcare</subject></subj-group></article-categories><title-group><article-title>
 
 
  Isolation and Identification Methods for &lt;i&gt;Actinomyces israelii&lt;/i&gt; Involved in Actinomycosis
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Osamu</surname><given-names>Tsuzukibashi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Akira</surname><given-names>Fukatsu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mana</surname><given-names>Fuchigami</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Satoshi</surname><given-names>Uchibori</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Chiaki</surname><given-names>Komine</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Koji</surname><given-names>Umezawa</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Sachiyo</surname><given-names>Hayashi</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Takashi</surname><given-names>Asano</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Taira</surname><given-names>Kobayashi</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Masahiko</surname><given-names>Fukumoto</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Laboratory Medicine for Dentistry for the Compromised Patient, Nihon University School of Dentistry at Matsudo, Chiba, Japan</addr-line></aff><aff id="aff2"><addr-line>Department of Fixed Prosthodontics, Nihon University School of Dentistry at Matsudo, Chiba, Japan</addr-line></aff><aff id="aff3"><addr-line>Department of Special Needs Dentistry, Nihon University School of Dentistry at Matsudo, Chiba, Japan</addr-line></aff><pub-date pub-type="epub"><day>08</day><month>04</month><year>2022</year></pub-date><volume>12</volume><issue>04</issue><fpage>108</fpage><lpage>118</lpage><history><date date-type="received"><day>11,</day>	<month>March</month>	<year>2022</year></date><date date-type="rev-recd"><day>15,</day>	<month>April</month>	<year>2022</year>	</date><date date-type="accepted"><day>18,</day>	<month>April</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Purpose: Actinomyces israelii is known as the key species to cause classical actinomycosis. Although 
  <em>A. israelii</em> is frequently isolated from human oral cavities, the distribution of this microorganism has been little reported. The purpose of the present study was to develop selective media (AISM) for the isolation of 
  <em>A. israelii</em> and to assess the prevalence of this organism in the oral cavity. 
  Methods: To examine the bacterial population in the oral cavity, a novel selective medium (AISM) was developed for isolating 
  <em>A. israelii</em>. AISM consists of BHI, yeast extract, agar, ofloxacin, fosfomycin, colistin, and sodium fluoride. 
  Results: 
  <em>A. israelii</em> strains grew well on AISM. 
  <em>A. israelii</em> was detected in all dental plaque samples collected from 20 subjects and the mean number of this organism in the samples was 7.9 &#215; 104 CFU/ml. 
  Conclusion: These results indicated that the selective medium was useful for the isolation of 
  <em>A. israelii </em>and this organism was a part of the normal flora in the human oral cavity.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Actinomyces israelii&lt;/i&gt;</kwd><kwd> Selective Medium</kwd><kwd> Oral Cavity</kwd><kwd> Actinomycosis</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Although the genus Actinomyces was already described in 1919, a lot of new species have been found recently. At present, the genus Actinomyces comprises 235 species and 7 subspecies (http://www.bacterio.net/actinomyces.html). Actinomyces consists of gram-positive, anaerobic, and aero-tolerant, non-spore- forming, non-motile pleomorphic rods with various degrees of branching. Actinomyces species are frequently found as members of the normal micro-flora, especially in the oral cavity of humans; however, they are also found to be etiologic agents in infections, such as in classical actinomycosis, human bite wounds, and abscesses at different body sites, eye infections, and oral, genital, and urinary tract infections [<xref ref-type="bibr" rid="scirp.116587-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.116587-ref2">2</xref>]. The detection of Actinomyces species in clinical specimens is important, as it may affect the prognosis and patient management, but identification by conventional biochemical methods can be difficult.</p><p>Actinomycosis is a chronic disease characterized by inflammatory lesions of the lymph nodes, abscess formation, tissue fibrosis, and a discharge of sulfur granules. It most commonly affects healthy individuals, but may occur in persons with diminished host defenses, and generally has few systemic signs. Cervicofacial tissues are the most commonly involved in actinomycosis, followed by thoracic, abdominopelvic regions, and central nervous systems [<xref ref-type="bibr" rid="scirp.116587-ref3">3</xref>]. The portal of entry is usually through a disruption of the mucosal barrier after trauma or surgery [<xref ref-type="bibr" rid="scirp.116587-ref4">4</xref>].</p><p>Actinomycosis is most commonly caused by Actinomyces israelii [<xref ref-type="bibr" rid="scirp.116587-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.116587-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.116587-ref7">7</xref>]. However, it currently remains unclear whether this organism is part of the normal oral flora. Thus, a suitable selective medium is needed to assess the prevalence of A. israelii involved in actinomycosis as well as eye infection, such as keratitis and canaliculitis, dental caries, endodontic infections, osteomyelitis of the sternum, and infective endocarditis [<xref ref-type="bibr" rid="scirp.116587-ref8">8</xref>] - [<xref ref-type="bibr" rid="scirp.116587-ref13">13</xref>].</p><p>The accurate identification and enumeration of Actinomyces species are required to determine their role in oral ecology, dental disease, and also systemic diseases such as actinomycosis. Although conventional biochemical assays are used to identify Actinomyces species, they are often imprecise due to the phenotypic variations displayed by these bacteria. Although sequence analysis of several target genes is the most reliable method, it is expensive, laborious, and time-consuming. Thus, a simple and more reliable assay for identifying oral Actinomyces species is required.</p><p>The purpose of the present study was to develop selective media for the isolation of A. israelii, a simple and more reliable assay for identifying it, and also to assess the prevalence of this organism in the oral cavity.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Bacterial Strains and Culture Conditions</title><p>All bacterial strains used in the present study are listed in <xref ref-type="table" rid="table1">Table 1</xref>. The anaerobic bacteria (i.e., A. israelii, and Actinomyces meyeri) used in the present study were maintained by cultivating them on Bact<sup>TM</sup> Brain Heart Infusion (BHI, Becton, Dickinson and Co., Sparks, MD, USA) and 1.5% agar (BHI agar). These organisms were cultured at 37˚C for 48 h in an anaerobic jar with a gas pack system (AnaeroPack<sup>&#210;</sup>, Mitsubishi Gas Chemical Co., Inc., Tokyo, Japan). A. israelii isolates (NUM-Ai 7071, NUM-Ai 7072, and NUM-Ai 7074) were obtained with a non-selective medium, i.e., BHI agar, from the human oral cavity in our previous studies.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Recovery of A. israelii and other bacteria on BHI agar and AISM</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Strain</th><th align="center" valign="middle" >BHI-Y</th><th align="center" valign="middle" >AISM</th><th align="center" valign="middle"  rowspan="2"  >Recovery, %</th></tr></thead><tr><td align="center" valign="middle" >CFU/ml, &#215;10<sup>7</sup></td><td align="center" valign="middle" >CFU/ml, &#215;10<sup>7</sup></td></tr><tr><td align="center" valign="middle" >Actinomyces israelii</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 12102</td><td align="center" valign="middle" >2.5 &#177; 0.2<sup>a</sup></td><td align="center" valign="middle" >2.5 &#177; 0.3</td><td align="center" valign="middle" >98.5</td></tr><tr><td align="center" valign="middle" >NUM-Ai 7071</td><td align="center" valign="middle" >2.6 &#177; 0.3</td><td align="center" valign="middle" >2.5 &#177; 0.3</td><td align="center" valign="middle" >97.8</td></tr><tr><td align="center" valign="middle" >NUM-Ai 7072</td><td align="center" valign="middle" >2.1 &#177; 0.1</td><td align="center" valign="middle" >1.9 &#177; 0.1</td><td align="center" valign="middle" >94.5</td></tr><tr><td align="center" valign="middle" >NUM-Ai 7074</td><td align="center" valign="middle" >1.1 &#177; 0.1</td><td align="center" valign="middle" >1.1 &#177; 0.2</td><td align="center" valign="middle" >99.6</td></tr><tr><td align="center" valign="middle" >Actinomyces viscosus</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 15987</td><td align="center" valign="middle" >2.6</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Actinomyces naeslundii</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 12104</td><td align="center" valign="middle" >1.3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Actinomyces johnsonii</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >JCM 16129</td><td align="center" valign="middle" >0.8</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Actinomyces oris</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 27044</td><td align="center" valign="middle" >1.1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Actinomyces odontolyticus</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 17929</td><td align="center" valign="middle" >0.5</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Actinomyces georgiae</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DSM 6843</td><td align="center" valign="middle" >0.7</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Actinomyces dentalis</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >CCUG 48064</td><td align="center" valign="middle" >0.5</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Actinomyces graevenitzii</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >CCUG 27294</td><td align="center" valign="middle" >0.7</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Actinomyces gerencseriae</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >JCM 12963</td><td align="center" valign="middle" >0.8</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Actinomyces meyeri</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >JCM 3067</td><td align="center" valign="middle" >1.3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Streptococcus mitis</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 49456</td><td align="center" valign="middle" >2.1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Streptococcus gordonii</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 10558</td><td align="center" valign="middle" >1.8</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Streptococcus oralis</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 10557</td><td align="center" valign="middle" >3.3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Streptococcus salivarius</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >JCM 5707</td><td align="center" valign="middle" >2.2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Streptococcus anginosus</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 33397</td><td align="center" valign="middle" >5.1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Streptococcus mutans</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >NCTC 10449</td><td align="center" valign="middle" >6.6</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Rothia dentocariosa</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >JCM 3067</td><td align="center" valign="middle" >1.3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Rothia mucilaginosa</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >JCM 10910</td><td align="center" valign="middle" >2.5</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Corynebacterium matruchotii</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 14266</td><td align="center" valign="middle" >1.4</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Corynebacterium durum</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 33449</td><td align="center" valign="middle" >1.9</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Neisseria sicca</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ATCC 29256</td><td align="center" valign="middle" >5.5</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr></tbody></table></table-wrap><p><sup>a</sup>Ave &#177; SD.</p><p>Strains other than anaerobic bacteria were maintained by cultivating them also on BHI agar. These organisms were cultured at 37˚C overnight in an atmosphere of 5% CO<sub>2</sub> in a CO<sub>2</sub> incubator (NAPCO<sup>&#174;</sup> Model 5400; Precision Scientific, Chicago, IL, USA).</p></sec><sec id="s2_2"><title>2.2. Development of the New Selective Medium</title><sec id="s2_2_1"><title>2.2.1. Evaluation of the Base Medium</title><p>BHI supplemented with 1% yeast extract (BHI-Y), BHI-Y supplemented with 5% sheep blood (BHI-Y blood), and anaerobic blood agar (CDC) were examined as the base medium in the selective medium. CDC composed of a Tryptic soy agar (Becton, Dickinson and Co., Sparks, MD, USA) base supplemented with vitamin K<sub>1</sub> (10 μg/ml), hemin (5 μg/ml), L-cysteine (800 μg/ml), 0.5% yeast extract, and 5% sheep blood. Ten-fold dilutions of cultures were made in 0.9 ml of Tris-HCl buffer (0.05 M, pH 7.2) and aliquots of 0.1 ml were spread onto the test media. The plates on which bacteria, except anaerobic bacteria, were inoculated were cultured at 37˚C for 72 h in an atmosphere of 5% CO<sub>2</sub> in a CO<sub>2</sub> incubator, and the plates on which anaerobic bacteria were inoculated were cultured at 37˚C for 72 h under anaerobic conditions. After cultivation, the number of colony-forming units (CFU)/ml was counted.</p></sec><sec id="s2_2_2"><title>2.2.2. Susceptibility Tests</title><p>Preliminary studies of antibiotic selection were also performed using disk susceptibility tests (Sensi-Disk, Becton Dickinson Co., MD, USA). The microbroth dilution method was used for susceptibility testing [<xref ref-type="bibr" rid="scirp.116587-ref14">14</xref>].</p></sec></sec><sec id="s2_3"><title>2.3. Recovery of A. israelii and Other Representative Oral Bacteria</title><p>The recoveries of the A. israelii reference strain, A. israelii isolates, and other representative oral bacteria were calculated as CFU/ml on a selective medium and compared with those on CDC for total cultivable bacteria. All bacterial strains used in the present study are listed in <xref ref-type="table" rid="table1">Table 1</xref>.</p><p>All bacterial strains, except anaerobic bacteria, were pre-incubated in BHI broth at 37˚C overnight in an atmosphere of 5% CO<sub>2</sub> in a CO<sub>2</sub> incubator. Anaerobic bacteria were pre-incubated in tryptic soy broth (Becton, Dickinson and Co., Sparks, MD, USA) supplemented with vitamin K<sub>1</sub> (10 μg/ml), hemin (5 μg/ml), and 0.5% yeast extract at 37˚C overnight under anaerobic conditions. Ten-fold dilutions of cultures were made in 0.9 ml of Tris-HCl buffer (0.05 M, pH 7.2) and aliquots of 0.1 ml were spread onto the test media. The plates on which bacteria, except anaerobic bacteria, were inoculated were cultured at 37˚C for 72 h in an atmosphere of 5% CO<sub>2</sub> in a CO<sub>2</sub> incubator, and those on which anaerobic bacteria were inoculated were cultured at 37˚C for 72 h under anaerobic conditions. After cultivation, the number of CFU/ml was counted.</p></sec><sec id="s2_4"><title>2.4. Clinical Samples</title><p>Twenty volunteers (9 men, 11 women; mean age 42 years, range 18 - 61 years) participated in the present study. They had no systemic disease and received no antibiotic therapy for at least 3 months. All participants were asked not to brush, rinse, or smoke immediately prior to the assessment and not to eat or drink for at least 2 h beforehand.</p><p>Dental plaque samples on the buccal surfaces of the first permanent molars of all subjects were obtained using sterile micro-applicators (Benda<sup> </sup>Micro, Centrix, Inc., Shelton, CT, USA) and placed in a sterile microcentrifuge tube containing 1.0 ml of Tris-HCl buffer (0.05 M, pH 7.2). Samples were dispersed, and 0.1 ml of each was diluted and inoculated on BHI-Y and selective medium plates according to a previously described procedure <sup>17)</sup>. BHI-Y plates for total cultivable bacteria and selective medium plates were cultured at 37˚C for 3 days under anaerobic conditions. After cultivation, CFU/ml in each sample was calculated. The present study was approved by the Ethics Committee of Nihon University School of Dentistry at Matsudo, Japan (EC 18-17-012-1). Informed consent was obtained from all volunteers.</p></sec><sec id="s2_5"><title>2.5. Identification of A. israelii Isolated from Clinical Samples</title><p>Twenty-four of the approximately 50 colonies that grew on the selective medium plate per subject were randomly isolated and subcultured, and their identity was then confirmed by PCR analysis.</p></sec><sec id="s2_6"><title>2.6. Design of Species-Specific Primers for A. israelii</title><p>The design of species-specific primers for A. israelii was performed as follows. The 16S rRNA sequences of A. naeslundii (accession no. AB618790), A. johnsonii (AB545933), A. oris (AB545935), A. odontolyticus (AB818950), A. israelii (AB849123), A. georgiae (X80413), A. dentalis (AJ697609), A. graevenitzii (AJ540309), A. gerencseriae (X80414), and A. meyeri (X82451) were obtained from the DNA Data Bank of Japan (DDBJ; Mishima, Japan), and multiple sequence alignment analyses were performed using the CLUSTAL W program; i.e., the 16S rRNA sequences of four specieswere aligned and analyzed. Homologies among the primers selected for A. israelii were confirmed by a BLAST search.</p></sec><sec id="s2_7"><title>2.7. Development of a PCR Method for Identifying A. israelii Using Designed Primers</title><p>A PCR method for identifying A. israelii using the designed primers was developed as follows. Bacterial cells were cultured in a BHI broth overnight, and 1 ml of the sample was then collected in a microcentrifuge tube and resuspended at a density of 1.0 McFarland standard (approximately 10<sup>7</sup> CFU in 1 ml of sterile distilled water). A total of 3.6 μl of the suspension was then used as a PCR template. The detection limit for PCR was assessed by serially diluting known numbers of bacterial cells in sterile distilled water and then subjecting each suspension to PCR. The PCR mixture contained 2 μM of each primer, 10 μl of 2 &#215; MightyAmp Buffer Ver.2 (Takara Bio Inc., Shiga, Japan), 0.4 μl of MightyAmp DNA Polymerase (Takara), and 3.6 μl of the template in a final volume of 20 μl. PCR was performed in a DNA thermal cycler (Applied Biosystems 2720 Thermal Cycler; Applied Biosystems, Carlsbad, CA). PCR conditions included an initial denaturation step at 98˚C for 2 min, followed by 30 cycles consisting of 98˚C for 10 s and 68˚C for 1 min. PCR products were analyzed by 2.0% agarose gel electrophoresis before being visualized by electrophoresis in 1 &#215; Tris-borate-EDTA on a 2% agarose gel stained with ethidium bromide. A 100-bp DNA ladder (Takara Biomed, Shiga, Japan) was used as a molecular size marker.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Development of Selective Medium</title><sec id="s3_1_1"><title>3.1.1. Selection of the Base Medium</title><p>The selection of a base medium for the growth of A. israelii was performed. A. israelii grew well on BHI-Y as same as BHI-Y blood and CDC (data not shown). Because of the low cost, BHI-Y without blood was ultimately selected as the base medium.</p></sec><sec id="s3_1_2"><title>3.1.2. Susceptibility to Antibiotics</title><p>A. israelii was more resistant to colistin than oral Gram-negative cocci, such as Neisseria and Veillonella species. The minimal inhibitory concentration (MIC) of colistin for A. israelii was 1000 μg/ml. Oral Gram-negative cocci were sensitive to 10 μg/ml of colistin. A. israelii was more resistant to ofloxacin than oral Gram-negative rods, such as Aggregatibacter, Fusobacterium, Porphyromonas, and Prevotella species. The MIC of ofloxacin for A. israelii was 10 μg/ml. Oral Gram-negative bacteria were sensitive to 4 μg/ml of ofloxacin. A. israelii was more resistant to fosfomycin than oral Rothia species. The MIC of fosfomycin for A. israelii was 10 μg/ml. Oral Rothia species were sensitive to 5 μg/ml of fosfomycin. A. israelii was more resistant to sodium fluoride than oral Corynebacterium species and oral Actinomyces species. The MIC of sodium fluoride for A. israelii was 800 μg/ml. Oral Corynebacterium species and oral Actinomyces species except A. israelii were sensitive to 50 μg/ml of sodium fluoride.</p></sec><sec id="s3_1_3"><title>3.1.3. Composition of the New Selective Medium</title><p>The new selective medium, designated A. israelii selective medium (AISM), was composed of the following (per liter): 37 g of BHI, 10 g of yeast extract, 15 g of agar, 4 mg of ofloxacin, 5 mg of fosfomycin, 20 mg of colistin, and 150 mg of sodium fluoride. Antibiotics, i.e., ofloxacin, fosfomycin, and colistin, were added after the base medium had been sterilized and cooled to 50˚C.</p></sec></sec><sec id="s3_2"><title>3.2. PCR Method for Identifying A. israelii</title><sec id="s3_2_1"><title>3.2.1. Primer Design</title><p>The specific primer set covering the upstream region of the 16S rDNA sequence of A. israelii was designed in the present study (<xref ref-type="table" rid="table2">Table 2</xref>). The amplicon size of A. israelii was 907 bp.</p></sec><sec id="s3_2_2"><title>3.2.2. Detection Limit</title><p>A PCR method was used to identify the A. israelii-amplified DNA fragment of the expected size for this organism (<xref ref-type="fig" rid="fig1">Figure 1</xref>). The detection limit was assessed in the presence of titrated bacterial cells, and the detection sensitivity of the PCR assay was 50 - 100 CFU per PCR template (5.6 μl) for the A. israelii-specific primer set with the ATCC 12102 strain (data not shown).</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Locations and sequences of species-specific primers for the16S rDNA of A. israelii</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Species</th><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Sequence</th><th align="center" valign="middle" >Product size (bp)</th><th align="center" valign="middle" >Position</th><th align="center" valign="middle" >Accession number</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >A. israelii</td><td align="center" valign="middle" >AIF</td><td align="center" valign="middle" >CTCACTTCTGGATAACCGCT</td><td align="center" valign="middle"  rowspan="2"  >907</td><td align="center" valign="middle" >129 - 148</td><td align="center" valign="middle"  rowspan="2"  >AB849123</td></tr><tr><td align="center" valign="middle" >AIR</td><td align="center" valign="middle" >GGGAGGCCCCCGTCTCCAGGA</td><td align="center" valign="middle" >1035 - 1015</td></tr></tbody></table></table-wrap></sec><sec id="s3_2_3"><title>3.2.3. Assay of A. israelii and Representative Oral Bacteria</title><p>The PCR method used to identify A. israelii produced positive bands from the A. israelii reference strain ATCC 12102 (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Some Streptococci and Actinomyces except A. israelii, Neisseria, Corynebacterium, and Rothia species were used as representative oral bacteria in PCR using the designed primer set. No amplicons were produced from any of the representative oral bacteria (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p></sec></sec><sec id="s3_3"><title>3.3. Recovery of A. israelii and Inhibition of Other Representative Oral Bacteria on Selective Medium</title><p><xref ref-type="table" rid="table1">Table 1</xref> shows the recovery of the A. israelii reference strain ATCC 12102 and isolates on AISM relative to BHI-Y. The growth recoveries of the S. moorei reference strains and isolates on AISM were between 94.5% and 99.6% (average 97.6%) that on BHI-Y.</p><p><xref ref-type="table" rid="table1">Table 1</xref> also shows the inhibition of other representative oral bacteria on AISM relative to BHI-Y. The growth of other representative oral bacteria was markedly inhibited on the selective medium.</p></sec><sec id="s3_4"><title>3.4. Clinical Examination</title><p>The detection frequencies of A. israelii in dental plaque samples from twenty healthy subjects are shown in <xref ref-type="table" rid="table3">Table 3</xref>. A. israelii was detected in all samples from the subjects. The mean numbers of total bacteria and A. israelii in all healthy subjects were 1.7 &#215; 10<sup>7</sup> CFU/ml (range: 0.2 &#215; 10<sup>7</sup> - 4.6 &#215; 10<sup>7</sup>) and 7.9 &#215; 10<sup>4</sup> CFU/ml (range: 1.9 &#215; 10<sup>4</sup> - 8.1 &#215; 10<sup>5</sup>), respectively.</p><p>In the first isolation, A. israelii colonies on AISM commonly had a rough, dry, folded and convex appearance, and adhered to the agar medium such that they were not easily scraped off. The colony color and average colony size of A. israelii on AISM were light white and 1.4 mm in diameter, respectively (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Proportion of A. israelii in dental plaque samples</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Sublect (n = 20)</th><th align="center" valign="middle" >BHI-Y</th><th align="center" valign="middle" >AISM</th><th align="center" valign="middle" >Detection ratio</th></tr></thead><tr><td align="center" valign="middle" >Total bacteria CFU/ml, &#215;10<sup>7</sup></td><td align="center" valign="middle" >A. israelii CFU/ml, &#215;10<sup>4</sup></td><td align="center" valign="middle" >%</td></tr><tr><td align="center" valign="middle" >Average</td><td align="center" valign="middle" >1.7</td><td align="center" valign="middle" >7.9</td><td align="center" valign="middle" >0.46</td></tr></tbody></table></table-wrap></sec></sec><sec id="s4"><title>4. Discussion</title><p>The genus Actinomyces consists of species that are Gram-positive, pleomorphic ore filamentous, non-spore-forming, and anaerobic or microaerophilic bacteria. Some Actinomyces species have been related to the diseases of humans. These organisms include the strict anaerobic bacteria such as A. israelii, and the facultative anaerobic species such as A. naeslundii, A. odontolyticus, A. viscosus, A. meyeri, and A. gerencseriae (formerly A. israelii serotype II) [<xref ref-type="bibr" rid="scirp.116587-ref2">2</xref>]. Actinomyces are commensals and normal inhabitants of the oropharynx, gastrointestinal tract, and female genital tract of humans.</p><p>A. israelii has long been recognized as a causative agent of actinomycosis. During the past 3 decades, a large number of novel Actinomyces species have been found. The detection and identification of these organisms in clinical microbiology laboratories and also clinical settings have been attempted. With the introduction of advanced molecular methods, knowledge about their clinical relevance is gradually increasing, and the spectrum of diseases associated with Actinomyces and Actinomyces-like organisms is widening accordingly; for example, Actinomyces meyeri, Actinomyces neuii, and Actinomyces turicensis as well as Actinotignum (formerly Actinobaculum) schaalii are emerging as important causes of specific infections as various body sites.</p><p>Human actinomycosis, a chronic, granulomatous infectious disease, has been recognized for a long time, and its causative agent, originally named Streptothrix israeli (currently A. israelii) was described in 1896 by Kruse [<xref ref-type="bibr" rid="scirp.116587-ref15">15</xref>]. However, it currently remains unclear whether this organism is part of the normal oral flora. Moreover, difficulties are associated with the isolation of A. israelii due to the differential exhibition of phenotypic characteristics. Thus, a suitable selective medium and reliable identification method are needed in order to assess the prevalence of A. israelii involved in actinomycosis as well as eye infection such as keratitis and canaliculitis, dental caries, endodontic infections, osteomyelitis of the sternum, and infective endocarditis [<xref ref-type="bibr" rid="scirp.116587-ref8">8</xref>] - [<xref ref-type="bibr" rid="scirp.116587-ref13">13</xref>].</p><p>In the present study, we designed species-specific primers to identify A. israelii using a PCR method. These primers were able to distinguish A. israeliiand did not react with representative oral bacteria other than this organism. Moreover, the PCR method in the present study directly uses bacterial cells with MightyAmp DNA Polymerase Ver.3 (Takara) and is completed within approximately 2 hours.</p><p>A useful selective medium for isolating A. israelii may contribute to the correct and rapid diagnosis of infectious diseases caused by this organism. However, a selective medium that is useful for the isolation of A. israelii has not ever been developed. In the present study, A. israelii strains were more resistant to sodium fluoride, ofloxacin, fosfomycin, and colistin than other representative oral bacteria. The growth of oral bacteria detected in the oral cavity was inhibited by the addition of 4 mg/L ofloxacin, 5 mg/L fosfomycin, 20 mg/L colistin, and 150 mg/L sodium fluoride to BHI-Y agar. All of the A. israelii reference strains and isolates tested grew well on the new selective medium, designated as AISM, while the growth of other bacteria was markedly inhibited (<xref ref-type="table" rid="table1">Table 1</xref>). Moreover, AISM allowed for the identification of A. israelii by its characteristic colony morphology.</p><p>The distribution of A. israelii in the oral cavity of humans has not yet been reported in detail. In the present study, A. israelii was detected in all samples from healthy subjects by a culture method using the selective medium, i.e., AISM. Moreover, A. israelii was detected at 0.46% to total bacteria of 1.7 &#215; 10<sup>7</sup> CFU/ml on BHI-Y agar in their oral cavities. These results indicated that A. israelii was a part of the normal oral flora.</p><p>We developed a selective medium, designated AISM, to isolate A. israelii in the oral cavity of humans. Since AISM is highly selective for A. israelii, it will be useful for assessing the distribution and role of this organism at various locations in humans. Actinomycosis is usually diagnosed by recovering the organism in culture. Labs are unable to recover the organisms from the culture in over 50% of cases. This is likely due to the overgrowth of concomitant organisms, inadequate anaerobic transport and culture techniques [<xref ref-type="bibr" rid="scirp.116587-ref3">3</xref>]. The isolation method for A. israelii using AISM herein might help to overcome such problems.</p></sec><sec id="s5"><title>5. Conclusion</title><p>The selective medium (AISM) and our PCR method as isolation and identification methods, respectively, for A. israelii, may contribute to the diagnosis of actinomycosis as well as eye infection, such as keratitis and canaliculitis, dental caries, endodontic infections, osteomyelitis of the sternum, and infective endocarditis, which are caused by this organism.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s7"><title>Cite this paper</title><p>Tsuzukibashi, O., Fukatsu, A., Fuchigami, M., Uchibori, S., Komine, C., Umezawa, K., Hayashi, S., Asano, T., Kobayashi, T. and Fukumoto, M. (2022) Isolation and Identification Methods for Actinomyces israelii Involved in Actinomycosis. Open Journal of Stomatology, 12, 108-118. https://doi.org/10.4236/ojst.2022.124011</p></sec></body><back><ref-list><title>References</title><ref id="scirp.116587-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Sabbe, L., van de Merwe, D., Schouls, L., Bergmans, A., Vaneechoutte, M. and Vandamme, P. (1999) Clinical Spectrum of Infections Due to the Newly Described Actinomyces Species A. turicensis, A. radingae, and A. europaeus. Journal of Clinical Microbiology, 37, 8-13. https://doi.org/10.1128/JCM.37.1.8-13.1999</mixed-citation></ref><ref id="scirp.116587-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Schaal, K.P. and Lee, H.J. (1992) Actinomycete Infections in Humans—A Review. Gene, 115, 201-211. https://doi.org/10.1016/0378-1119(92)90560-C</mixed-citation></ref><ref id="scirp.116587-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Bennhoff, D. (1984) Actinomycosis: Diagnostic and Therapeutic Considerations and a Review of 32 Cases. Laryngoscope, 94, 1198-1217. https://doi.org/10.1288/00005537-198409000-00013</mixed-citation></ref><ref id="scirp.116587-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Miller, M. and Haddad, A. (1998) Cervicofacial Actinomycosis. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology, 85, 496-508.https://doi.org/10.1016/S1079-2104(98)90280-3</mixed-citation></ref><ref id="scirp.116587-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Dailey, A.T., LeRoux, P.D. and Grady, M.S. (1993) Resolution of an Actinomycotic Abscess with Nonsurgical Treatment: Case Report. Neurosurgery, 32, 134-136. https://doi.org/10.1227/00006123-199301000-00022</mixed-citation></ref><ref id="scirp.116587-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Peabody, J.W. and Seabury, J.H. (1960) Actinomycosis and Nocardiosis. A Review of Basic Differences in Therapy. The American Journal of Medicine, 28, 99-115. https://doi.org/10.1016/0002-9343(60)90226-6</mixed-citation></ref><ref id="scirp.116587-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Wong, V.K., Turmrzei, T.D. and Weston, V.C. (2011) Actinomycosis. British Medical Journal, 343, Article 6099. https://doi.org/10.1136/bmj.d6099</mixed-citation></ref><ref id="scirp.116587-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Karimian, F., Feizi, S. Nazari, R. and Zarin-Bakhsh, P. (2008) Delayed-Onset Actinomyces Keratitis after Laser in situ Keratomileusis. Cornea, 27, 843-846. https://doi.org/10.1097/ICO.0b013e31816a624a</mixed-citation></ref><ref id="scirp.116587-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Hussain, I., Bonshek, R.E., Loudon, K., Armstrong, M. and Tullo, A.B. (1993) Canalicular Infection Caused by Actinomyces. Eye, 7, 542-544. https://dx.doi.org/10.1038/eye.1993.118</mixed-citation></ref><ref id="scirp.116587-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Tang, G., Yip, H.K., Samaranayake, L.P., Luo, G. Lo, E.C.M. and Teo, C.S. (2003) Actinomyces spp. in Supragingival Plaque of Ethnic Chinese Preschool Children with and without Active Dental Caries. Caries Research, 37, 381-390. https://dx.doi.org/10.1159/000072172</mixed-citation></ref><ref id="scirp.116587-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Xia, T. and Baumgartner, J.C. (2003) Occurrence of Actinomyces in Infections of Endodontic Origin. Journal of Endodontics, 29, 549-552. https://dx.doi.org/10.1097/00004770-200309000-00001</mixed-citation></ref><ref id="scirp.116587-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Pinilla, I., Martin-Hervás, C. and Gil-Garay, E. (2006) Primary Sternal Osteomyelitis Caused by Actinomyces israelii. Southern Medical Journal, 99, 96-97. https://dx.doi.org/10.1097/01.smj.0000197512.82441.41</mixed-citation></ref><ref id="scirp.116587-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Adajia, A.A. and Vergis, E.N. (2010) Actinomyces israelii Endocarditis Misidentified as “Diptheroids”. Anaerobe, 16, 472-473. https://doi.org/10.1016/j.anaerobe.2010.05.003</mixed-citation></ref><ref id="scirp.116587-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Hirasawa, M. and Takada, K. (2002) Susceptibility of Streptococcus mutans and Streptococcus sobrinus to Cell Wall Inhibitors and Development of a Novel Selective Medium for S. sobrinus. Caries Research, 36, 155-160. https://doi.org/10.1159/000059329</mixed-citation></ref><ref id="scirp.116587-ref15"><label>15</label><mixed-citation publication-type="book" xlink:type="simple">Kruse, W. (1896) Systematik der Streptothricheen und Bakterien. In Flugge, C., Ed., Die Mikroorganismen, 3rd Edition, Vol. 2, Vogel, Leipzig, 48-96.</mixed-citation></ref></ref-list></back></article>