<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2022.133026</article-id><article-id pub-id-type="publisher-id">AJPS-116285</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Dominance of Brassica and No Effects of &lt;i&gt;Raphanus&lt;/i&gt; in Mature Seed Production in Intergeneric Hybrid between &lt;i&gt;Brassica rapa&lt;/i&gt; ssp. &lt;i&gt;Pekinensis&lt;/i&gt; and &lt;i&gt;Raphanus&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Soo-Seong</surname><given-names>Lee</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Cho</surname><given-names>Yee Son</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Eunsil</surname><given-names>Kim</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hosub</surname><given-names>Shin</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jeong</surname><given-names>Eun Park</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Seung</surname><given-names>Hwa Yu</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jin</surname><given-names>Hoe Huh</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>BioBreeding Institute, Anseong, Gyeonggi, South Korea</addr-line></aff><aff id="aff2"><addr-line>Department of Agriculture, Forestry and Bioresources, College of Agriculture &amp;amp; Life Science, Seoul National University, Seoul, South Korea</addr-line></aff><pub-date pub-type="epub"><day>09</day><month>03</month><year>2022</year></pub-date><volume>13</volume><issue>03</issue><fpage>416</fpage><lpage>432</lpage><history><date date-type="received"><day>19,</day>	<month>January</month>	<year>2022</year></date><date date-type="rev-recd"><day>28,</day>	<month>March</month>	<year>2022</year>	</date><date date-type="accepted"><day>31,</day>	<month>March</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  We succeeded in producing mature seed from a line of 
  Brassica rapa ssp. 
  pekinensis that had been hybridized with 
  Raphanus
   sativus var. major
  . Our focus was on dominance of 
  B. rapa ssp. 
  pekinensis; radish (
  R. 
  sativus var. 
  major) had no influence. Marker tests for similarity showed that the original CR291M-64 x HwiM-2 hybrid was an inbred CR291M-64, rather than a genuine cross; this appears to have resulted from weak self-incompatibility in this strain. The plants from the mature seed bloomed with reddish flowers differently shown up to present. The intergeneric hybrid between 
  Brassica inbred and 
  Raphanus hybrid was very weak in strength compared to the 
  Brassica inbred which was self-pollinated even though the cause of the weak was not identified. The hybrids between 
  Brassica hybrid, dominant and elite recessive, and 
  Raphanus can be developed in large quantities using mature hybrid seed without resorting to ovule culture techniques.
 
</p></abstract><kwd-group><kwd>Intergeneric Hybrid</kwd><kwd> Brassica Dominance</kwd><kwd> No Raphanus Effect</kwd><kwd> Mature Seed</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>For variety improvement, research regarding interspecific hybridization in cruciferous plants has focused on crosses between diploid plants or between diploids and tetraploids in the triangle of U [<xref ref-type="bibr" rid="scirp.116285-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref5">5</xref>]. Intergeneric crosses between cultivated varieties and wild species have also been used to enhance the genetic base [<xref ref-type="bibr" rid="scirp.116285-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref8">8</xref>]. Concerning the genus Raphanus, two hybrids with Brassica have been available: a cross between R. sativus and B. oleracea, and a cross between B. rapa and R. sativus [<xref ref-type="bibr" rid="scirp.116285-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref11">11</xref>]. The first crossbreeding in a cruciferous crop was between R. sativus and B. oleracea, by Augustin Sageret ( [<xref ref-type="bibr" rid="scirp.116285-ref12">12</xref>] cited from [<xref ref-type="bibr" rid="scirp.116285-ref10">10</xref>]). Karpechenko succeeded in obtaining F<sub>2</sub> intergeneric hybrid seeds [<xref ref-type="bibr" rid="scirp.116285-ref13">13</xref>]. Intensive research was carried out by McNaughton [<xref ref-type="bibr" rid="scirp.116285-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref15">15</xref>]. Chen and Wu published details of the world’s first stable intergeneric hybrid [<xref ref-type="bibr" rid="scirp.116285-ref16">16</xref>], which was later utilized to improve B. napus trait [<xref ref-type="bibr" rid="scirp.116285-ref17">17</xref>]. All hybridization efforts were performed using radish (Raphanus sativus L.) as a female parent.</p><p>Some subspecies of B. rapa have different morphologies and display distinct features in their intergeneric hybridization with Raphanus. The known subspecies include pekinensis (heading Chinese cabbage), chinensis (pakchoi), rapifera (turnip), narinosa (rosette pakchoi), parachinensis (flowering pakchoi), japonica (mizuna), and oleifera (turnip rape) [<xref ref-type="bibr" rid="scirp.116285-ref18">18</xref>]. The world’s first Brassica x Raphanus hybrid seed was obtained by Terasawa [<xref ref-type="bibr" rid="scirp.116285-ref19">19</xref>]. Subsequently, the seed was used to transfer nematode-resistance traits from the wild radish to inter-cropped Chinese cabbage [<xref ref-type="bibr" rid="scirp.116285-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref21">21</xref>]. Dolstra (1982) collected varieties of turnip, pakchoi, turnip rape, and heading Chinese cabbage worldwide, then hybridized them with radish varieties. No seed was produced by heading Chinese cabbage (ssp. Pekinensis), but seed was obtained from the other three subspecies. Although young hybrid ovules were not obtained in the cross between ssp. pekinensis and Raphanus [<xref ref-type="bibr" rid="scirp.116285-ref22">22</xref>], this cross has been used subsequently to develop intergeneric hybrids. A culture system of ovules between ssp. pekinensis x Raphanus was established during plant acquisition [<xref ref-type="bibr" rid="scirp.116285-ref23">23</xref>] and was improved in a subsequent study [<xref ref-type="bibr" rid="scirp.116285-ref24">24</xref>]. Many hybrids can potentially be obtained using these techniques [<xref ref-type="bibr" rid="scirp.116285-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref27">27</xref>], and good stabilization has been achieved when the hybrid was used [<xref ref-type="bibr" rid="scirp.116285-ref28">28</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref30">30</xref>]. The stabilized intergeneric hybrid has been used for analysis of constituent components [<xref ref-type="bibr" rid="scirp.116285-ref31">31</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref33">33</xref>].</p><p>To date, hybrid seeds or plants have been obtained with Brassica as a maternal line [<xref ref-type="bibr" rid="scirp.116285-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref34">34</xref>]. Young hybrid ovules should be cultured to generate intergeneric hybrids. A combination of ssp. pekinensis, CR291M-64 x HwiM-2—identified as an inbred variety of CR291M-64 according to markers analysis later—produced mature seeds as a dominant in hybridization with R. sativus var. major, and R. sativus were not effective on this mature seed production. Therefore, intergeneric hybrids between Brassica hybrid with CR291M-64 which was originated from a line of ECD-4, and Raphanus can be developed using mature hybrid seed in the future. It does mean that resorting to ovule culture techniques is not necessary. These results are expected to support major advances in intergeneric breeding.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. The CR291M-64 Line Produced Mature Seeds of Dominant Character and Radish Has No Effects</title><p>The letter “M” in the names of material lines refers to the origin of a particular microspore culture. For example, the line HwiM-2 is the second strain derived from the microspore culture of a leading cultivar Hwiparam. The line CR291M was selected for resistance against clubroot and a virus, following microspore culture of a hybrid with BR079 x ECD-4 (IT number: 04-33-3) to target clubroot and with 3M-291 to induce virus resistance. All lines incorporating CR291M in these experiments, such as CR291M-64, therefore have resistance to two diseases.</p><p>Three F<sub>1</sub> Brassica, C218M-13 x HagamM-50, CC507 x BulM-68 and CR291-7M-64 x HwiM-2 had sown for this trial with KB-68 x WY-25 Raphanus first. Female parent plants were B. rapa ssp. pekinensis. Because inbred intergeneric crosses may be sterile [<xref ref-type="bibr" rid="scirp.116285-ref27">27</xref>], F<sub>1</sub> crosses were sown to produce offspring similar BB#12. BB#12 was developed using both female and male F<sub>1</sub> hybrids. The seed of the combinations including CR291M-64 x HwiM-2 was produced in mutual crossing by bees in small net cages that were 2 m long &#215; 1 m wide &#215; 2 m high. Two cultivars of ssp. rapifera (turnip) were included in dominant investigation later.</p><p>The KB-68 x WY-25 radish has round, red, fleshy roots and purple leaf veins. It was employed to understand the segregation pattern of the flesh color in the intergeneric hybrid, because both parents have red flesh, although the female Chinese cabbage are F<sub>1</sub> hybrids. Ovule culture was conducted 10 days after hybridization between Brassica and Raphanus. However, a flower branch of CR291M-64 x HwiM-2 was unexpectedly maintained for approximately 25 days, and the seed pods appeared to grow well. Because many of the ovules had already been cultured at that time, ovule culture was stopped to assess mature seed production. Eventually, the CR291M-64 x HwiM-2 hybrid produced mature seed from its cross with Raphanus. To our knowledge, this is the first report of mature seed production in an F<sub>1</sub> Brassica. Thirty-six plants (from 64 hybrid seeds) appeared to have similar morphology, including purple veins and leaves in the growing point area, regardless of their production from the hybrid CR291M-64 x HwiM-2, with different traits in Brassica. A marker test for similarity was requested from Seoul National University.</p><p>The combination of CR291M-64 x HwiM-2 and its parental inbred, together with crosses of reciprocal hybrids of both parents and two accessions of Raphanus, KB-68 x WY-25 and locally inbred, were sown to investigate the dominance relationships and the effect of radish in mature seed. Because dominance and no effects were recognized in this experiment, we established 11 further plantings to confirm the dominance relationships and no influence of radish already observed; we also obtained additional information concerning the production of mature seed. These experiments deployed two crosses from each of the CR291M-64 and CR291M-96 strains, five fraternal lineages (CR291M-2, CR291M-5, CR291M-10, CR291M-66, and CR291M-96), Shogoin turnip (introduced from Japan), and Kangwha turnip (our line). Two F<sub>1</sub> combinations, KB-68 x WY-25 and TBM-48 x BDM-7, were sown together with an inbred Shogoin radish to investigate radish effects. The synthesis of TBM-48 x BDM-7 has white flesh and short, fat roots. The inbred Shogoin radish had completely white skin and flesh, as well as a slender root. This appearance was therefore quite different from the appearance of the KB-68 x WY-25 hybrid. Thirty-one radish varieties were sown on August 20 for an autumn test. These varieties were secured and hybridized with CR291M-64 to investigate their ability to produce mature seed.</p><p>In total, 432 hybrid non-dry seeds were sown by the end of December. Of these, 328 germinated plants grew by the end of the following June and were able to self-pollinate. The 305 grains of dry seed obtained from CR291M-64 x HwiM-2 were sown to examine the differences between non-dried and dry seeds. Some large seeds were observed during sowing, but they were excluded from analysis because non-dried seeds could not be distinguished by seed size and every plant exhibited purple central veins and leaves. Some green plants germinated from these large seeds primarily; because they were all similar in appearance (distinct from hybrids crossed with radish at the five-leaf stage), a marker test was requested from Seoul National University.</p><p>Seeds of Chinese cabbage and radish were sown in a fall crop on August 10 and 20, respectively. Some plants from this sowing were chosen for seed production at the adult stage. For analysis of absolute seed production only, seeds were sown and vernalized under natural conditions from September to February of the following year. If seeding was requested from March to June, the seedling tray was incubated in a refrigerator at 4˚C - 5˚C for at least 45 days to prevent de-vernalization in summer. Sowing in July and August was postponed until September seeding time.</p><p>Temperatures rose to 35˚C on some days in July and August, but generally fell below 25˚C at night. Beginning in mid-November, heating facilities were used to prevent exposure of plant materials to nighttime temperatures below 5˚C. The plants were therefore grown at temperatures of 5˚C - 25˚C from October until the following February, with minimum temperatures of about 15˚C from March to June. If vernalization was needed, nursery-stage plants were moved to unheated plastic greenhouses and maintained at minimum temperatures of 2.0˚C - 4.0˚C and a maximum temperature of 12.0˚C by ventilation. All stamens of Brassica were removed within 1 day of flowering. They were then hybridized immediately with radish pollen and covered with an oiled paper bag. The pollinated branches were usually harvested at 35 days after mating; however, they were harvested 45 days after mating during winter, regardless of heating system usage. All other management protocols followed the standard practices of the BioBreeding Institute.</p></sec><sec id="s2_2"><title>2.2. Marker Test</title><p>The numbering systems of chromosomes 1 and 5 were used for marker investigation in radish. Thirty plants were collected from the BioBreeding Institute for marker investigation. Single nucleotide polymorphisms of KB68 (KB) and Wonyeon25 (WY) radish were discovered using the Genome Analysis Toolkit (version 3.6-0) HaplotypeCaller [<xref ref-type="bibr" rid="scirp.116285-ref35">35</xref>]. Genomic sequences of WK10039 in radish [<xref ref-type="bibr" rid="scirp.116285-ref36">36</xref>] were used as reference genomes. Variant filtration was performed manually based on read depth. For CAPS marker design, digestibility of flanking regions from filtered single nucleotide polymorphism sites of two cultivars was examined to identify candidate regions for CAPS markers. For each pair of sequences, if only one sequence was the target site of the restriction enzyme Hind III (AAGCTT), primer sets were designed around the target region. Two primer sets were designed to distinguish hybrids from KB68 and WY25 strains. Polymerase chain reaction was performed using 20-μl reactions containing 200 ng of genomic DNA, 4 units of Taq polymerase (Takara), 0.2 mM dNTPs, and 0.2 mM primers, combined with 1&#215; polymerase chain reaction buffer (Takara). Polymerase chain reactions were performed under the following conditions: denaturation at 95˚C for 5 min followed by 30 cycles of amplification (95˚C for 30 sec, 60˚C for 30 sec, and 72˚C for 1 min) and a final extension at 72˚C for 10 min. Amplicons were digested with Hind III (New England Biolabs) and visualized with 2% agarose gel electrophoresis. This procedure was generally similar to the protocol used in the radish marker test on dry-seed-derived green plants of Chinese cabbage CR291M-64 and HwiM-2, although it used standards CR (CR291M-64), Hwi (Hwi-M2), BF1 (CR x Hwi), KB (KB-68), WY (WY-25), and RF1 (KB x WY). The line Chiifu-401 [<xref ref-type="bibr" rid="scirp.116285-ref37">37</xref>] was used as the reference genome. Four primer sets were designed to distinguish CR291M-64 and HwiM-2, using 3 purple and 9 green plants.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. The CR291M-64 Line Produced Mature Seeds of Dominant Character and Radish Has No Effects</title><p>CR291M-64 x HwiM-2 hybrids produced pods that were 3.5 - 5.3 cm in length by day 37 and the others not produced seeds (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Sixty-four seeds from 11 pods were placed on filter paper in Petri dishes (Table1). Seeds sown on filter paper generally germinate within 2 - 3 days at 25˚C; in this trial, germination began on day 9 and continued for 33 days (Supplementary TableS1). In addition, the germinated plants appeared fragile. They were therefore kept in the Petri dish for several more days before transplantation into soil. Retardation and extension of germination were presumably caused by seed dormancy that was found in the sowing of the dry seed.</p><p>Individuals subjected to marker analysis at Seoul National University were genetically differentiated and became morphologically dissimilar as they grew into adult plants. In a dominance trial, the combination of CR291M-64 x HwiM-2 generated mature seeds. The parent CR291M-64 plants also produced seeds, but the cross counterpart HwiM-2 did not produce seed. Mature seeds from the CR291M-64 line were definitively dominant. Because the line HwiM-2</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1"><xref ref-type="table" rid="table">Table </xref>1</xref></label><caption><title> Number of pollinated buds, pod length, hybrid seeds sown and color of pedigree plant of (CR291M-64 x HwiM-2) x (KB-68 x WY-25) hybrid</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Maternal combination</th><th align="center" valign="middle" >Number of Pollinated buds</th><th align="center" valign="middle" >Length of pods (cm)</th><th align="center" valign="middle" >Number of seeds sown</th><th align="center" valign="middle" >Color of plants</th></tr></thead><tr><td align="center" valign="middle" >(CR291M-64 x HwiM-2) x (KB-68 x WY-25)</td><td align="center" valign="middle" >6 + 5 = 11</td><td align="center" valign="middle" >3.5 - 5.3 long</td><td align="center" valign="middle" >64 grains</td><td align="center" valign="middle" >purple</td></tr></tbody></table></table-wrap><p>was recessive, a CR291M-40 x HwiM-2 hybrid was used to generate dominant seeds. The strain CR291M-180 was uncertain because it was crossed with the dominant line CR291-64. The HwiM-2 x CR68M-107 hybrid failed to produce seeds; so, the CR68M-107 line was recessive, which derived from BulM-68 through microspore culture for virus resistant line after hybridization with 3M-291 (Table2). Four combinations and five inbred lines, including two turnip strains were mated with one, two, or all three radish cultivars; they produced mature, dominant seed. Since the line of C218M-13 is recessive, CR291M-96 is a dominance stain: that is as the line test (Table3). On the other hand, the CR291M-64 line produced intergeneric mature seed without exception when hybridized with 31 radish strains cultured for fall cropping (Supplementary TableS2). It has known that radish is no influence on mature seed production of intergeneric hybrid between Chinese cabbage and radish.</p><p>Two hundred and fifty-four of 305 dry seeds germinated without delay and continued growing for an extended duration. Among the germinated plants, 25 that originated from larger seeds were green and grew more vigorously than did purple plants that sprouted concurrently (<xref ref-type="fig" rid="fig2">Figure 2</xref>). The results of marker examination indicated that the green plants were induced from self-pollination or apomixis of the CR291M-64 strain. Three purple individuals were true hybrids</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2"><xref ref-type="table" rid="table">Table </xref>2</xref></label><caption><title> Seed yield of parents and reciprocal combinations by parents of CR291M-64 x HwiM-2 with two radish cultivars of intergeneric hybrids between Brassica and Raphanus</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Maternal parents</th><th align="center" valign="middle"  colspan="2"  >The number of seeds by paternal parents</th></tr></thead><tr><td align="center" valign="middle" >KB-68 x WY-25</td><td align="center" valign="middle" >Local inbred (05-80-14B)</td></tr><tr><td align="center" valign="middle" >CR291M-64 x HwiM-2</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >6</td></tr><tr><td align="center" valign="middle" >CR291M-64</td><td align="center" valign="middle" >212</td><td align="center" valign="middle" >12</td></tr><tr><td align="center" valign="middle" >HwiM-2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >CR291-64 x CR291-96</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >10</td></tr><tr><td align="center" valign="middle" >CR291M-180 x CR291M-64</td><td align="center" valign="middle" >102</td><td align="center" valign="middle" >13</td></tr><tr><td align="center" valign="middle" >CR291M-40 x HwiM-2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3</td></tr><tr><td align="center" valign="middle" >HwiM-2 x CR68M-107</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td></tr></tbody></table></table-wrap><p>*(05-80-14B): Introduction number.</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3"><xref ref-type="table" rid="table">Table </xref>3</xref></label><caption><title> Seed yield of each cross and cultivars by radish parents in intergeneric hybrids between Brassica and Raphanus</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Line code</th><th align="center" valign="middle"  colspan="3"  >The number of seeds by paternal radish</th></tr></thead><tr><td align="center" valign="middle" >KB-68 x WY-25</td><td align="center" valign="middle" >TBM-48 x BDM-7</td><td align="center" valign="middle" >Shogoin radish</td></tr><tr><td align="center" valign="middle" >CR291M-64 x C218M-13</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >no experiments</td></tr><tr><td align="center" valign="middle" >CR291M-64 x GreenM-2</td><td align="center" valign="middle" >no experiments</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >no experiments</td></tr><tr><td align="center" valign="middle" >(CR291M-96 x C218M-13)-2</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >no experiments</td><td align="center" valign="middle" >no experiments</td></tr><tr><td align="center" valign="middle" >CR291M-96 x CR291M-180</td><td align="center" valign="middle" >no experiments</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >no experiments</td></tr><tr><td align="center" valign="middle" >CR291M-2</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >no experiments</td><td align="center" valign="middle" >no experiments</td></tr><tr><td align="center" valign="middle" >CR291M-5</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >3</td></tr><tr><td align="center" valign="middle" >CR291M-10</td><td align="center" valign="middle" >13</td><td align="center" valign="middle" >no experiments</td><td align="center" valign="middle" >no experiments</td></tr><tr><td align="center" valign="middle" >CR291M-66</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >no experiments</td><td align="center" valign="middle" >no experiments</td></tr><tr><td align="center" valign="middle" >CR291M-96</td><td align="center" valign="middle" >no experiments</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >no experiments</td></tr><tr><td align="center" valign="middle" >Shogoin turnip</td><td align="center" valign="middle" >no experiments</td><td align="center" valign="middle" >no experiments</td><td align="center" valign="middle" >1</td></tr><tr><td align="center" valign="middle" >Kangwha turnip</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >8</td></tr></tbody></table></table-wrap><p>crossed between inbred CR291M-64 and a KB-68 x WY-25 radish cross. Therefore, every item mentioned so far has turned out to be false except that the inbred CR291M-64 produced an intergeneric hybrid seed with dominance. The hybrid is thought to have resulted from the two being in the same net cage with bees. Weak self-incompatibility may have been responsible. It was identified that another experiment carried out after the marker test (Supplementary TableS3). The 328 plants sown from non-dried seeds and 254 plants grown from dried seed were all purple and produced purplish flowers, a result not previously reported in cruciferous intergeneric hybrid crops (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Unusually, they did not produce seeds within more than about 100 days of pollination after blooming. Some of the 36 plants initially seeded produced microspore-derived embryos; the offspring of approximately 150 plants did not generate seeds in self- or cross-pollination involving more than 100 flowers each [<xref ref-type="bibr" rid="scirp.116285-ref27">27</xref>].</p></sec><sec id="s3_2"><title>3.2. Marker Test</title><p>Seoul National University prepared two CAPS markers of radish and tested 30 of 36 hybrids. Two markers of KB-68 were 562 and 786 base pairs long. In WY-25, markers were 414:148 and 261:525 base pairs long when cut with Hind III. The individual numbers of plants 1, 2, 6, and 8 of the two markers were KB (KB-68): WY (WY-25), WY: KB, KB: KB, and WY: WY, respectively (<xref ref-type="table" rid="table4"><xref ref-type="table" rid="table">Table </xref>4</xref>). These plants clearly all differed from each other. Seoul National University also investigated four CAPS markers prepared on chromosomes 4, 6, 8, and 10 in the maternal parent CR291M-64; these markers were analyzed in 25 green plants. The line of HwiM-2 was cut off at the marker of chromosome 6, and strain CR291M-64 was cut off at all other markers of three chromosomes (<xref ref-type="table" rid="table5"><xref ref-type="table" rid="table">Table </xref>5</xref>). Nine green and three purple plants had the same CR291M-64 genotype, including CR291M-64 and BF1 (CR291M-64 x HwiM-2) (<xref ref-type="fig" rid="fig4">Figure 4</xref>). However, HwiM-2 had different genotypes of the CR291M-64 x HwiM-2 hybrid. Two</p><table-wrap-group id="4"><label><xref ref-type="table" rid="table4"><xref ref-type="table" rid="table">Table </xref>4</xref></label><caption><title> Sequences of 2 CAPS markers and results applied the markers to 30 individuals in the mature seeds in intergeneric hybrids between Brassica and Raphanus</title></caption><table-wrap id="4_1"><table><tbody><thead><tr><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Sequence (5’ to 3’)</th><th align="center" valign="middle" >Tm</th><th align="center" valign="middle" >bp</th></tr></thead><tr><td align="center" valign="middle" >KB_WY_HindIII_1F KB_WY_HindIII_1R</td><td align="center" valign="middle" >GAGGCTTGCACATCAGTATGG CTTTTTGGGGATCTTTAGAGG</td><td align="center" valign="middle" >60.7 59.0</td><td align="center" valign="middle" >562 KB 148 WY 414</td></tr><tr><td align="center" valign="middle" >KB_WY_HindIII_5F KB_WY_HindIII_5R</td><td align="center" valign="middle" >ACCACATCCAGAACTCATTCAC GCTTCGGCGTAAAACTCAAC</td><td align="center" valign="middle" >58.9 59.9</td><td align="center" valign="middle" >786 KB 525 WY 261</td></tr></tbody></table></table-wrap><table-wrap id="4_2"><table><tbody><thead><tr><th align="center" valign="middle" >Sample</th><th align="center" valign="middle" >1</th><th align="center" valign="middle" >2</th><th align="center" valign="middle" >3</th><th align="center" valign="middle" >4</th><th align="center" valign="middle" >5</th><th align="center" valign="middle" >6</th><th align="center" valign="middle" >7</th><th align="center" valign="middle" >8</th><th align="center" valign="middle" >9</th><th align="center" valign="middle" >10</th><th align="center" valign="middle" >11</th><th align="center" valign="middle" >12</th><th align="center" valign="middle" >13</th><th align="center" valign="middle" >14</th><th align="center" valign="middle" >15</th></tr></thead><tr><td align="center" valign="middle" >Marker 1</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td></tr><tr><td align="center" valign="middle" >Marker 2</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td></tr><tr><td align="center" valign="middle" >Sample</td><td align="center" valign="middle" >16</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >21</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >26</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >29</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >32</td></tr><tr><td align="center" valign="middle" >Marker 1</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td></tr><tr><td align="center" valign="middle" >Marker 2</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >WY</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td><td align="center" valign="middle" >KB</td></tr></tbody></table></table-wrap></table-wrap-group><p>*KB: KB-68, WY: WY-25, 0ne and 5: number of chromosomes, F: forward, R: reverse. *Two markers of KB-68 were 562 and 786 base pairs long. In WY-25, markers were 414:148 and 261:525 base pairs long when cut with Hind III.</p><p>previously identified radish markers were not present in the nine green plants, although they were expressed in the three purple individuals containing RF1 (KB-68 x WY-25) without BF1 (CR291M-64 x HwiM-2) (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Mature seeds of an intergeneric hybrid between Brassica and Raphanus were first created by Terasawa in 1933 [<xref ref-type="bibr" rid="scirp.116285-ref19">19</xref>]. These first seeds were derived from ssp. chinensis, rather than ssp. pekinensis. Dolstra [<xref ref-type="bibr" rid="scirp.116285-ref20">20</xref>] also produced mature seed in</p><table-wrap id="table5" ><label><xref ref-type="table" rid="table5"><xref ref-type="table" rid="table">Table </xref>5</xref></label><caption><title> Sequences of 4 CAPS markers used for identification of purple and green plants of dried mature seeds in intergeneric hybrids between kimchi cabbage and radish</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Sequence (5’ to 3’)</th><th align="center" valign="middle" >Tm</th><th align="center" valign="middle"  colspan="2"  >bp</th></tr></thead><tr><td align="center" valign="middle" >CR-Hwi-HindIII-A04-F CR-Hwi-HindIII-A04-R</td><td align="center" valign="middle" >ACATCTCCCCTCGTGTTTCG TCGCTTGTCTGGACAGTGTC</td><td align="center" valign="middle" >59.8 60.0</td><td align="center" valign="middle" >1351</td><td align="center" valign="middle" >971, 380 CR291cut</td></tr><tr><td align="center" valign="middle" >CR-Hwi-HindIII-A06-F CR-Hwi-HindIII-A06-R</td><td align="center" valign="middle" >ACACATATTGGACCAGCCCC AGCTCAGACAACTAGTTAAGCC</td><td align="center" valign="middle" >60.0 57.8</td><td align="center" valign="middle" >902</td><td align="center" valign="middle" >617, 285 HwiM2cut</td></tr><tr><td align="center" valign="middle" >CR-Hwi-HindIII-A08-F CR-Hwi-HindIII-A08-R</td><td align="center" valign="middle" >ACTTTCTAGTGCCGGTCCTG GTACGTCAGATGTCCAATCGC</td><td align="center" valign="middle" >59.3 59.1</td><td align="center" valign="middle" >874</td><td align="center" valign="middle" >526, 348 CR291cut</td></tr><tr><td align="center" valign="middle" >CR-Hwi-HindIII-A10-F CR-Hwi-HindIII-A10-R</td><td align="center" valign="middle" >AGGTTGGCCAGACGTTATGG CTTCTGGTGAAACACGCAGC</td><td align="center" valign="middle" >60.0 60.0</td><td align="center" valign="middle" >692</td><td align="center" valign="middle" >533, 159 CR291cut</td></tr></tbody></table></table-wrap><p>*CR = CR291 = CR291M-64. Hwi = HwiM2 = Hwi-M2. A = chromosome numbers. F: forward, R: reverse. *The line of HwiM-2 was cut off at the marker of chromosome 6, 617:285 and strain CR291M-64 was cut off at all other markers of three chromosomes 971:380, 526:348 and 533:159 base pairs long when cut with Hind III.</p><p>ssp. chinensis and discovered it in ssp. rapifera (turnip). The genes associated with mature seed production have been traced because “Shogoin” turnip has produced seeds with radish varieties [<xref ref-type="bibr" rid="scirp.116285-ref38">38</xref>]. Recent publications have reported the cultivation of intergeneric hybrid seeds with turnip cultivars [<xref ref-type="bibr" rid="scirp.116285-ref39">39</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref40">40</xref>]. Mature seed has been obtained from ssp. pekinensis and Raphanus crosses, and successful seed production has been associated with the dominance of the CR291M-64 line. If a line has produced mature seed in the strain test, it can be used to generate seeds with every possible genotype. In other trials, strains of Chiifu and Gaeseong as shown in Supplementary TableS4 and TableS5 and five strains of the fraternal lines of CR291M-64 produced mature seed when crossed with radish. Pakchoi [<xref ref-type="bibr" rid="scirp.116285-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref20">20</xref>] and turnip strains [<xref ref-type="bibr" rid="scirp.116285-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref38">38</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref39">39</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref40">40</xref>] have produced mature seeds. Therefore, hybrids of dominant and recessive Brassica varieties can be prepared within and between subspecies. Large quantities of mature seeds can presumably be obtained from Brassica and Raphanus in subsequent studies. The microspore mutation technique could be applied to develop stable strains of intergeneric hybrids [<xref ref-type="bibr" rid="scirp.116285-ref28">28</xref>] [<xref ref-type="bibr" rid="scirp.116285-ref30">30</xref>].</p><p>Radish appears to have a minimal effect on the formation of mature seed in the intergeneric hybrid between ssp. pekinensis and Raphanus. Two distinct accessions, an F<sub>1</sub> hybrid KB-68 x WY-25 with red flesh and an open-pollinated cultivar cultivated in the northern part of Korea with white flesh (IT no. 05-80-14B-1-1) generated the same result in terms of mature seeds. Three radish varieties (KB-68 x WY-25, TBM-48 x BDM-7, and Shogoin radish) formed mature seed in hybridization with one, two or three of four crosses and five inbred lines of Chinese cabbages and two turnips. The 31 diverse radish varieties were hybridized with the line CR291M-64 and provided seeds without any rupture. This production of mature seed from intergeneric crosses with radish varieties was recorded for the first time in this study. Therefore, Raphanus has no effect on mature seed production in intergeneric hybrid between Chinese cabbage and radish.</p><p>The combination of Chinese cabbage with CR291M-64 x HwiM-2 produced mature seeds from the intergeneric cross with radish, KB-68 x WY-25. To our knowledge, this is the first report of mature seed generation following hybridization with Brassica. Mature seed produced from hybrids tends to raise questions. First, all 582 F<sub>1</sub> plants sown from non-dry seeds (328 plants) and dry seeds (254 plants) were purple individuals with similar early-stage morphologies, although the Brassica was a hybrid between two morphologically distinct inbred strains. Second, some of the cultivated plants produced F<sub>2</sub> seeds upon self-fertilization (e.g., BB#12) [<xref ref-type="bibr" rid="scirp.116285-ref28">28</xref>]. However, no seed was obtained from the F<sub>1 </sub>hybrid or from the microspore-derived progeny of the F<sub>1</sub> cross. Marker tests resolved these unclear aspects, indicating that the combination of CR291M-64 x HwiM-2 was an inbred strain of CR291M-64, rather than a true F<sub>1</sub> hybrid. The purple color of the intergeneric hybrid was affected by the radish in an inbred line of Brassica. The inbred Brassica line CR291M-64 did not produce F<sub>2</sub> seeds in the intergeneric hybrid [<xref ref-type="bibr" rid="scirp.116285-ref27">27</xref>]. The matroclinal (apomictic) plants that originated from CR291M-64 x (KB-68 x WY-25) have not been useful because they were produced from somatic tissue around the egg, rather than from egg cells [<xref ref-type="bibr" rid="scirp.116285-ref41">41</xref>].</p><p>Intergeneric hybrid plants germinated from non-dry seeds were fragile and required additional incubation in Petri dishes for several days prior to transplantation into soil. Hybrid plants from dry seeds were also weaker at the early stage, compared with simultaneously generated matromorphic individuals. Developmental turning points between weak and strong growth should be identified in the future because the hybrid grew more vigorously during later stages than did non-hybrid plants [<xref ref-type="bibr" rid="scirp.116285-ref42">42</xref>].</p><p>Mature seeds regardless of non-dry and dry ones bloomed reddish flowers. An experience on fixed yellow color flowers as an unstable line at BioBreeding Institute was carried out some years ago (no report). Different colors of flowers therefore could be developed using intergeneric hybrids [<xref ref-type="bibr" rid="scirp.116285-ref43">43</xref>]. As such the mature seed production technique in intergeneric hybrids between Brassica hybrid, dominant and elite recessive, and Raphanus can be used diversely in the future.</p></sec><sec id="s5"><title>Acknowledgements</title><p>We would also like to thank the personnel at BBI for their assistance in this work.</p></sec><sec id="s6"><title>Funding</title><p>This work was supported by the institute of planning and evaluation for technology (117045-3), Ministry of Food, Agriculture, Forestry, and Fisheries of Korea.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>We hereby declare that authors have no pecuniary or other personal interest, direct or indirect, in any matter that raises or may raise a conflict.</p></sec><sec id="s8"><title>Cite this paper</title><p>Lee, S.-S., Son, C.Y., Kim, E., Shin, H., Park, J.E., Yu, S.H. and Huh, J.H. (2022) Dominance of Brassica and No Effects of Raphanus in Mature Seed Production in Intergeneric Hybrid between Brassica rapa ssp. Pekinensis and Raphanus. American Journal of Plant Sciences, 13, 416-432. https://doi.org/10.4236/ajps.2022.133026</p></sec><sec id="s9"><title>Supplementary</title><table-wrap id="table6" ><label><xref ref-type="table" rid="table">Table </xref>S1</label><caption><title> Days for germination of non-dried mature seeds sowing on filter paper in Petri-dish of the hybrid of (CR291M-64 x HwiM-2) x (KB-68 x WY-25)</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Number of sown seeds</th><th align="center" valign="middle"  colspan="7"  >Number of seeds germinated by date</th><th align="center" valign="middle"  rowspan="2"  >Total germination</th></tr></thead><tr><td align="center" valign="middle" >9th</td><td align="center" valign="middle" >13th</td><td align="center" valign="middle" >14th</td><td align="center" valign="middle" >15th</td><td align="center" valign="middle" >16th</td><td align="center" valign="middle" >20th</td><td align="center" valign="middle" >33rd</td></tr><tr><td align="center" valign="middle" >64</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >29</td><td align="center" valign="middle" >36</td><td align="center" valign="middle" >40</td><td align="center" valign="middle" >47</td><td align="center" valign="middle" >51</td><td align="center" valign="middle" >51 (80%)</td></tr></tbody></table></table-wrap><table-wrap id="table7" ><label><xref ref-type="table" rid="table">Table </xref>S2</label><caption><title> The number of seeds obtained in inter-generic hybridization between one kimchi cabbage and 31 radish lines</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sowing No.</th><th align="center" valign="middle" >Line code</th><th align="center" valign="middle" >No. of seeds</th></tr></thead><tr><td align="center" valign="middle" >18MO-201x18R-8</td><td align="center" valign="middle" >CR291M-64xWY-28</td><td align="center" valign="middle" >7</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-10</td><td align="center" valign="middle" >CR291M-64xSanga W-97</td><td align="center" valign="middle" >12</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-13</td><td align="center" valign="middle" >CR291M-64x40 Days 8</td><td align="center" valign="middle" >4</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-15</td><td align="center" valign="middle" >CR291M-64x07-80-200</td><td align="center" valign="middle" >2</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-17</td><td align="center" valign="middle" >CR291M-64x07-80-202</td><td align="center" valign="middle" >9</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-29</td><td align="center" valign="middle" >CR291M-64x(KB68xWY-25)</td><td align="center" valign="middle" >214</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-1</td><td align="center" valign="middle" >CR291M-64x16-80-101</td><td align="center" valign="middle" >8</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-26</td><td align="center" valign="middle" >CR291M-64xTaebackM-35</td><td align="center" valign="middle" >11</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-27</td><td align="center" valign="middle" >CR291M-64x12-80-60</td><td align="center" valign="middle" >6</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-34</td><td align="center" valign="middle" >CR291M-64x16-80-102</td><td align="center" valign="middle" >14</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-36</td><td align="center" valign="middle" >CR291M-64x16-80-104</td><td align="center" valign="middle" >32</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-41</td><td align="center" valign="middle" >CR291M-64xKB-68</td><td align="center" valign="middle" >4</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-46</td><td align="center" valign="middle" >CR291M-64xKB68(S6)</td><td align="center" valign="middle" >7</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-49</td><td align="center" valign="middle" >CR291M-64xLocalKim-1</td><td align="center" valign="middle" >1</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-50</td><td align="center" valign="middle" >CR291M-64xLocalKim-2</td><td align="center" valign="middle" >3</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-51</td><td align="center" valign="middle" >CR291M-64x13-80-67-1</td><td align="center" valign="middle" >7</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-52</td><td align="center" valign="middle" >CR291M-64x13-80-67-2</td><td align="center" valign="middle" >17</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-62</td><td align="center" valign="middle" >CR291M-64xYuheon-5</td><td align="center" valign="middle" >4</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-65</td><td align="center" valign="middle" >CR291M-64xWY(25-2x-1)</td><td align="center" valign="middle" >20</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-77</td><td align="center" valign="middle" >CR291M-64x14-80-71</td><td align="center" valign="middle" >2</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-79</td><td align="center" valign="middle" >CR291M-64x11-80-27</td><td align="center" valign="middle" >3</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-81</td><td align="center" valign="middle" >CR291M-64x11-80-24</td><td align="center" valign="middle" >5</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-83</td><td align="center" valign="middle" >CR291M-64xWY 28</td><td align="center" valign="middle" >3</td></tr><tr><td align="center" valign="middle" >18MO-201x18R-92</td><td align="center" valign="middle" >CR291M-64xR-25</td><td align="center" valign="middle" >4</td></tr><tr><td align="center" valign="middle" >18MO-201x18MO-204</td><td align="center" valign="middle" >CR291M-64x07-80-209</td><td align="center" valign="middle" >299</td></tr><tr><td align="center" valign="middle" >18MO-34x18MO-31</td><td align="center" valign="middle" >CR291M-64xKB-68-5</td><td align="center" valign="middle" >11</td></tr><tr><td align="center" valign="middle" >18MO-34x18MO-32</td><td align="center" valign="middle" >CR291M-64xWY-25</td><td align="center" valign="middle" >27</td></tr><tr><td align="center" valign="middle" >18MO-34x18MO-66</td><td align="center" valign="middle" >CR291M-64xWG-39</td><td align="center" valign="middle" >5</td></tr><tr><td align="center" valign="middle" >18MO-34x18MO-67</td><td align="center" valign="middle" >CR291M-64xDD-2</td><td align="center" valign="middle" >86</td></tr><tr><td align="center" valign="middle" >18MO-34x18MO-69</td><td align="center" valign="middle" >CR291M-64xCHT-1</td><td align="center" valign="middle" >38</td></tr><tr><td align="center" valign="middle" >18MO-34x18MO-70</td><td align="center" valign="middle" >CR291M-64x06-80-62</td><td align="center" valign="middle" >7</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >Radish 31 lines</td><td align="center" valign="middle" >872</td></tr></tbody></table></table-wrap><table-wrap id="table8" ><label><xref ref-type="table" rid="table">Table </xref>S3</label><caption><title> Marker test results of 3 plants with remanded and differently produced seeds at the same year of 2016 (seeding in 2019.03.07)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Seeding number</th><th align="center" valign="middle" >Line number</th><th align="center" valign="middle" >Manufacture number</th><th align="center" valign="middle" >Marker test</th><th align="center" valign="middle" >Production amount</th><th align="center" valign="middle" >Seed production techniques</th></tr></thead><tr><td align="center" valign="middle" >19 projects −355</td><td align="center" valign="middle" >HwiM-2x CR291M-64</td><td align="center" valign="middle" >16NC-163</td><td align="center" valign="middle" >All self of HwiM-2</td><td align="center" valign="middle" >1ml</td><td align="center" valign="middle" >Net cage with bees</td></tr><tr><td align="center" valign="middle" >−358</td><td align="center" valign="middle" >CR291M-64x HwiM-2</td><td align="center" valign="middle" >16SP-164</td><td align="center" valign="middle" >Two hybrids and one CR291M-64</td><td align="center" valign="middle" >235ml</td><td align="center" valign="middle" >Net cage with bees</td></tr><tr><td align="center" valign="middle" >−356</td><td align="center" valign="middle" >CR291M-64x HwiM-2</td><td align="center" valign="middle" >16SP-473</td><td align="center" valign="middle" >Two hybrids and one CR291M-64</td><td align="center" valign="middle" >2ml</td><td align="center" valign="middle" >Flower cross without emasculation</td></tr><tr><td align="center" valign="middle" >−357</td><td align="center" valign="middle" >CR291M-64x HwiM-2</td><td align="center" valign="middle" >16SP-474</td><td align="center" valign="middle" >All hybrids</td><td align="center" valign="middle" >79</td><td align="center" valign="middle" >Flower cross with emasculation</td></tr><tr><td align="center" valign="middle" >−359</td><td align="center" valign="middle" >HwiM-2ⓧ</td><td align="center" valign="middle" >16SP-307</td><td align="center" valign="middle" >All HwiM-2</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >Bud-self</td></tr><tr><td align="center" valign="middle" >−360</td><td align="center" valign="middle" >CR291M-64ⓧ</td><td align="center" valign="middle" >1SPP-335</td><td align="center" valign="middle" >All CR291M-64</td><td align="center" valign="middle" >250</td><td align="center" valign="middle" >Bud-self</td></tr></tbody></table></table-wrap><table-wrap id="table9" ><label><xref ref-type="table" rid="table">Table </xref>S4</label><caption><title> Production and germination of the mature seed between B. rapa ssp. pekinensis cv. Chibu and R. sativus var. major cv. WK-39 in 2006 and 2007</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Pollination</th><th align="center" valign="middle"  rowspan="2"  >No. of pods</th><th align="center" valign="middle"  colspan="3"  >No. of seeds</th><th align="center" valign="middle"  rowspan="2"  >Germinated seeds</th><th align="center" valign="middle"  rowspan="2"  >Alive plants</th></tr></thead><tr><td align="center" valign="middle" >Normal</td><td align="center" valign="middle" >Blasted</td><td align="center" valign="middle" >Total</td></tr><tr><td align="center" valign="middle" >431 buds</td><td align="center" valign="middle" >331</td><td align="center" valign="middle" >37</td><td align="center" valign="middle" >284</td><td align="center" valign="middle" >321</td><td align="center" valign="middle" >116</td><td align="center" valign="middle" >82</td></tr></tbody></table></table-wrap><table-wrap id="table10" ><label><xref ref-type="table" rid="table">Table </xref>S5</label><caption><title> Seeds obtained in cross between B. rapa ssp. pekinensis cv. Gaeseong and R. sativus var. major cv. Twenty-day in 2006</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Variety</th><th align="center" valign="middle" >Species</th><th align="center" valign="middle" >Number of Branches</th><th align="center" valign="middle" >Pollination tech.</th><th align="center" valign="middle" >Number of seeds</th></tr></thead><tr><td align="center" valign="middle"  rowspan="4"  >Gaeseong x Twenty days</td><td align="center" valign="middle"  rowspan="4"  >Brassica x Raphanus</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >BC</td><td align="center" valign="middle" >4</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >BC</td><td align="center" valign="middle" >16</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >BC</td><td align="center" valign="middle" >15</td></tr><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BC</td><td align="center" valign="middle" >6 grains</td></tr></tbody></table></table-wrap><p>*Introduction number: Gaeseong (04-33-84) x Twenty day (02-80-2).</p></sec></body><back><ref-list><title>References</title><ref id="scirp.116285-ref1"><label>1</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Nagaharu</surname><given-names> U. </given-names></name>,<etal>et al</etal>. (<year>1935</year>)<article-title>Genome Analysis in Brassica with Special Reference to the Experimental Formation of B. napus and Peculiar Mode of Fertilization</article-title><source> Japanese Journal of Botany</source><volume> 7</volume>,<fpage> 389</fpage>-<lpage>452</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.116285-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Mason, A.S. and Batley, J. (2015) Creating New Interspecific Hybrid and Polyploid Crops. Trends Biotechnology, 33, 436-441.  
https://doi.org/10.1016/j.tibtech.2015.06.004</mixed-citation></ref><ref id="scirp.116285-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, X., Liu, T. and Li, X. (2016) Interspecific Hybridization, Polyploidization, and Backcross of Brassica oleracea var. alboglabra with B. rapa var. purpurea Morphologically Recapitulate the Evolution of Brassica Vegetables. Science Reports, 6, Article No. 18618. https://doi.org/10.1038/srep18618</mixed-citation></ref><ref id="scirp.116285-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Katche, E., Quezada-Martinez, D., Katche, E.I., Vasquez-Teuber, P. and Mason, A.S. (2019) Interspecific Hybridization for Brassica Crop Improvement. Crop Breeding, Genetics and Genome, 1, e190007.</mixed-citation></ref><ref id="scirp.116285-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Piotr, K., Agnieszka, M.-C., Ma&amp;#322;gorzata, P., Micha&amp;#322;, S., Elzbieta, S.-K. and Katarzyna, N. (2020) Development and Characteristics of Interspecific Hybrids between Brassica oleracea L. and B. napus L. Agronomy, 10, 1339.  
https://doi.org/10.3390/agronomy10091339</mixed-citation></ref><ref id="scirp.116285-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Bang, S.W., Sugihara, K., Jeong, B.H., Kaneko, R., Satake, E., Kaneko, Y. and Matsuzawa, Y. (2007) Production and Characterization of Intergeneric Hybrids between Brassica oleracea and a Wild Relative Moricandia arvensis. Plant Breeding, 126, 101-103. https://doi.org/10.1111/j.1439-0523.2007.01307.x</mixed-citation></ref><ref id="scirp.116285-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, L., He, J., He, H., Wu, J. and Li, M. (2021) Genome-Wide Unbalanced Expression Bias and Expression Level Dominance toward Brassica oleracea in Artificially Synthesized Intergeneric Hybrids of Raphanobrassica. Horticulture Research, 8, 246. https://doi.org/10.1038/s41438-021-00672-2</mixed-citation></ref><ref id="scirp.116285-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, L., Zhu, Z., Chen, F., Zhu, Y., Guo, X., Fu, M., Chen, J., Wu, J. and Zhu, Z. (2021) Production and Identification of ×Brassicoraphanus Distant Hybrids between Radish (Raphanus sativus L.) and Kohlrabi (Brassica oleracea L. var. Caulorapa DC.). New Zealand Journal of Crop and Horticultural Science.  
https://doi.org/10.1080/01140671.2021.1971267</mixed-citation></ref><ref id="scirp.116285-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">D&amp;#246;nmez, A.A., U&amp;#287;urluAyd&amp;#305;n, Z. and Wang, X. (2021) Wild Brassica and Its Close Relatives in Turkey, the Genetic Treasures. Horticultural Plant Journal, 7, 97-107.  
https://doi.org/10.1016/j.hpj.2020.11.003</mixed-citation></ref><ref id="scirp.116285-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Prakash, S., Bhat, S.R., Quiros, C.F., Kirti, P.B. and Chopra, V.L. (2009) Brassica and Its Close Allies: Cytogenetics and Evolution. Plant Breeding Review, 31, 21-187.  
https://doi.org/10.1002/9780470593783.ch2</mixed-citation></ref><ref id="scirp.116285-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Kaneko, Y. and Bang, S.W. (2014) Interspecific and Intergeneric Hybridization and Chromosomal Engineering of Brassicaceae Crops. Breeding Science, 64, 14-22.  
https://doi.org/10.1270/jsbbs.64.14</mixed-citation></ref><ref id="scirp.116285-ref12"><label>12</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Sageret</surname><given-names> A. </given-names></name>,<etal>et al</etal>. (<year>1826</year>)<article-title>Considérations sur la production des hybrides, des variantes et des variétés en général, et sur celles de la famille des Cucurbitacées en particulier</article-title><source> Annales des Sciences Naturelles</source><volume> 8</volume>,<fpage> 294</fpage>-<lpage>314</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.116285-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Karpechenko, G.D. (1927) The Production of Polyploid Gametes in Hybrids. Hereditas, 9, 349-368. https://doi.org/10.1111/j.1601-5223.1927.tb03536.x</mixed-citation></ref><ref id="scirp.116285-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">McNaughton, I.H. (1973) Synthesis and Sterility of Raphanobrassica. Euphytica, 22, 70-88. https://doi.org/10.1007/BF00021558</mixed-citation></ref><ref id="scirp.116285-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">McNaughton, I.H. (1979) The Current Position and Problems in the Breeding of Raphanobrassica (Radicole) as a Forage Crop. Proceeding 4th Eucarpia-Conference Breeding. Cruciferous Crops, Wageningen, 1-3 October 1979, 22-28.</mixed-citation></ref><ref id="scirp.116285-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Chen, H.G. and Wu, J.S. (2008) Characterization of Fertile Amphidiploids between Rapanus sativus and Brassica alboglabra and the Crossability with Brassica Species. Genetic Research Crop Evolution, 55, 143-150.  
https://doi.org/10.1007/s10722-007-9223-8</mixed-citation></ref><ref id="scirp.116285-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Zhan, Z., Nwafor, C.C., Hou, Z., Gong, J., Zhu, B., Jiang, Y., et al. (2017) Cytological and Morphological Analysis of Hybrids between Brassicoraphanus, and Brassica napus for Introgression of Clubroot Resistant Trait into Brassica napus L. PLoS ONE, 12, e0177470. https://doi.org/10.1371/journal.pone.0177470</mixed-citation></ref><ref id="scirp.116285-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Lee, J.M., et al. (2013) Vegetable Sciences Crop Details (Text Book for University). HyangMoonSa, Seoul, 287-296. (In Korean)</mixed-citation></ref><ref id="scirp.116285-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Terasawa, Y. (1933) Polyploide Bastarde von Brassica chinensis L. x Raphanus sativus. Japanese Journal of Genetics, 7, 312-314.  
https://doi.org/10.2183/pjab1912.8.312</mixed-citation></ref><ref id="scirp.116285-ref20"><label>20</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Dolstra</surname><given-names> O. </given-names></name>,<etal>et al</etal>. (<year>1982</year>)<article-title>Synthesis and Fertility of xBrassicoraphanus and Ways of Transferring Raphanus Characters to Brassica</article-title><source> Agricultural Research Reports</source><volume> 917</volume>,<fpage> 1</fpage>-<lpage>90</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.116285-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Lange, W., Toxopeus, H., Lubberts, J.H., Dolstra, O. and Harrewijn, J.L. (1989) The Development of Raparadish (xBrassicoraphanus, 2n = 38), a New Crop in Agriculture. Euphytica, 40, 1-14. https://doi.org/10.1007/BF00023291</mixed-citation></ref><ref id="scirp.116285-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Takeshita, M., Kato, N. and Tokumasu, S. (1980) Application of Ovule Culture to the Production of Intergeneric Hybrids in Brassica and Raphanus. Japanese Journal Genetics, 55, 373-387. https://doi.org/10.1266/jjg.55.373</mixed-citation></ref><ref id="scirp.116285-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Been, C.G. and Park, H.G. (1983) Application of Ovule Culture to Production of Intergeneric Hybrids between Brassica and Raphanus. Journal of Korean Society Horticultural Science, 25, 100-108. (In Korean)</mixed-citation></ref><ref id="scirp.116285-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Cho, Y.S. (1986) Studies on Overcoming the Postfertilization Failure in the Intergeneric Cross between Chinese Cabbage (Brassica campestris ssp. pekinensis) and Radish (Raphanus sativus L.). MS Thesis, Seoul National University, Seoul. (In Korean)</mixed-citation></ref><ref id="scirp.116285-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Lee, S.S., Woo, J.G. and Shin, H. (1989) Obtaining Intergeneric Hybrid Plant between Brassica campestris and Raphanus sativus through Young Ovule Culture. Korean Journal Breeding, 21, 52-57. (In Korean)</mixed-citation></ref><ref id="scirp.116285-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Lee, S.S., Choi, W.J. and Woo, J.G. (2002) Development of a New Vegetable Crop in xBrassicoraphanus by Hybridization of Brassica campestris and Raphanus sativus. Journal of Korean Society Horticulture Science, 43, 693-698. (In Korean)</mixed-citation></ref><ref id="scirp.116285-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Lee, S.-S., Son, C.Y., Kim, J., Park, J.E., Yu, S.H., Yi, G. and Huh, J.H. (2020) Properties of Self-Sterile but Cross-Fertile Allopolyploids Synthesized between Brassica rapa and Raphanus sativus. Horticulture, Environment, Biotechnology, 61, 163-171.  
https://doi.org/10.1007/s13580-019-00206-9</mixed-citation></ref><ref id="scirp.116285-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Lee, S.-S., Lee, S.A., Yang, J. and Kim, J. (2011) Developing Stable Progenies of Brassicoraphanus, an Intergeneric Allopolyploid between Brassica rapa and Raphanus sativus through Induced Mutation Using Microspore Culture. Theoretical Applied Genetics, 122, 885-892. https://doi.org/10.1007/s00122-010-1494-3</mixed-citation></ref><ref id="scirp.116285-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Belandres, H.R., Waminal, N.E., Hwang, Y.-J, Park, B.-S., Lee, S.-S., Huh, J.H. and Kim, H.H. (2015) FISH Karyotype and GISH Meiotic Pairing Analyses of a Stable Intergeneric Hybrid xBrassicoraphanus Line BB#5. Korean Journal of Horticultural Science Technology, 31, 83-92. https://doi.org/10.7235/hort.2015.14151</mixed-citation></ref><ref id="scirp.116285-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Lee, S.-S., Hwang, B.H., Kim, T.Y., Yang, J., Han, N., Kim, J., Kim, H.H. and Belandres, H.R. (2017) Developing Stable Cultivar through Microspore Mutagenesis in ×Brassicoraphanus Koranhort, Inter-Generic Allopolyploid between Brassica rapa and Raphanus sativus. American Journal of Plant Sciences, 8, 1345-1356.  
https://doi.org/10.4236/ajps.2017.86091</mixed-citation></ref><ref id="scirp.116285-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Bhandari, S.R., Jo, J.S. and Lee, J.G. (2015) Comparison of Glucosinolate Profiles in Different Tissues of Nine Brassica Crops. Molecules, 20, 15827-15841.  
https://doi.org/10.3390/molecules200915827</mixed-citation></ref><ref id="scirp.116285-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, L., Ma, C., Chao, H., Long, Y., Wu, J., Li, Z., Ge, X., Xia, H., Yin, Y., Batley, J. and Li, M. (2019) Integration of Metabolome and Transcriptome Reveals Flavonoid Accumulation in the Intergeneric Hybrid between Brassica rapa and Raphanus sativus. Science Reports, 9, Article No. 18368.  
https://doi.org/10.1038/s41598-019-54889-2</mixed-citation></ref><ref id="scirp.116285-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Nugroho, A.B.D., Han, N., Pervitasari, N.P., Kim, D. and Kim, J. (2020) Differential Expression of Major Genes Involved in the Biosynthesis of Aliphatic Glucosinolates in Intergeneric Baemoochae (Brassicaceae) and Its Parents during Development. Plant Molecular Biology, 102, 171-184. https://doi.org/10.1007/s11103-019-00939-2</mixed-citation></ref><ref id="scirp.116285-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Terasawa, Y. and Shimotomai, N. (1928) Bastadierungsversuche bei Brassica und Raphanus. Scientific Reports of the Tohoku Imperial University, Ser. 4 (Biology), 13, 827-841.</mixed-citation></ref><ref id="scirp.116285-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">McKenna, A., Hanna, M., Banks, E., Sivachenko, A., Cibulskis, K., Kernytsky, A. and DePristo, M.A. (2010) The Genome Analysis Toolkit: A MapReduce Framework for Analyzing Next-Generation DNA Sequencing Data. Genome Research, 20, 1297-1303. https://doi.org/10.1101/gr.107524.110</mixed-citation></ref><ref id="scirp.116285-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Jeong, Y.M., Kim, N., Ahn, B.O., Oh, M., Chung, W.H., Chung, H. and Mun, J.H. (2016) Elucidating the Triplicated Ancestral Genome Structure of Radish Based on Chromosome-Level Comparison with the Brassica Genomes. Theorical and Applied Genetics, 129, 1357-1372. https://doi.org/10.1007/s00122-016-2708-0</mixed-citation></ref><ref id="scirp.116285-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Wang, X., Wang, H., Wang, J., Sun, R., Wu, J., Liu, S. and Zhang, Z. (2011) The Genome of the Mesopolyploid Crop Species Brassica rapa. Nature Genetics, 43, 1035-1039. https://doi.org/10.1038/ng.919</mixed-citation></ref><ref id="scirp.116285-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Tonosaki, K., Michaba, K., Bang, A.W., Kitashib, H., Kaneko, Y. and Nishio, T. (2013) Genetic Analysis of Hybrid Seed Formation Ability of Brassica rapa in Intergeneric Crossings with Raphanus sativus. Theoretical and Applied Genetics, 126, 837-846. https://doi.org/10.1007/s00122-012-2021-5</mixed-citation></ref><ref id="scirp.116285-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Jin, P., Zhu, Z., Guo, X., Chen, F., Wu, Y., Chen, J., Wu, J. and Zhu, Z. (2020) Production and Characterization of Intergeneric Hybrids by Crossing Radish with Turnip and with Chinese Kale. Euphytica, 216, Article No. 90.  
https://doi.org/10.1007/s10681-020-02622-w</mixed-citation></ref><ref id="scirp.116285-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Lou, L., Lou, Q., Li, Z., Xu, Y., Liu, Z. and Su, X. (2017) Production and Characterization of Intergeneric Hybrids between Turnip (Brassica rapa L. em. Metzg. subsp. rapa) and Radish (Raphanus sativus L.). Scientia Horticulturae, 220, 57-65.  
https://doi.org/10.1016/j.scienta.2017.03.025</mixed-citation></ref><ref id="scirp.116285-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Opena, R.T. and Lo, S.H. (1978) Derivation of Matroclinal Diploids in Chinese Cabbage and Evaluation of Their Significance in Breeding. American Society of Horticultural Science, 103, 820-823.</mixed-citation></ref><ref id="scirp.116285-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Yi, G., Shin, H., Park, H.R., Park, J.E., Ahn, J.H., Lim, S., Lee, J.G., Lee, E.J. and Hur, J.H. (2020) Revealing Biomass Heterosis in the Allodiploid xBrassicoraphanus, a Hybrid between Brassica rapa and Raphanus sativus, through Integrated Transcriptome and Metabolites Analysis. BMC Plant Biology, 20, Article No. 252.  
https://doi.org/10.1186/s12870-020-02470-9</mixed-citation></ref><ref id="scirp.116285-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Kim, K.-S., Park, W., Lee, Y.-H., Lee, J.-E., Moon, Y.-H., Cha, Y.-L. and Song, Y.-S. (2018) Development of Flower Color Changed Landscape Plant through Interspecific and Intergeneric Crosses of Several Cruciferae Crops. Korean Journal of Plant Resources, 28, 77-85. (In Korean)</mixed-citation></ref></ref-list></back></article>