1. Introduction

OALibJ

Open Access Library Journal

2333-9705

Scientific Research Publishing

10.4236/oalib.1108504

OALibJ-116268

Articles

Biomedical&Life Sciences Business&Economics Chemistry&Materials Science Computer Science&Communications Earth&Environmental Sciences Engineering Medicine&Healthcare Physics&Mathematics Social Sciences&Humanities

Can Irrationality in Mathematics Be Explained by Genetic Sequences as in the Square Root of Ten?

Tahir

Ölmez

₁

Sel&ccedil;uk University, Social Sciences Department, Konya, Turkey

04032022

09031920, February 202227, March 2022 30, March 2022

2014

This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/

One of the irrational numbers is the square root of ten number. This article researches whether there is a link between the square root of ten number and the genetic sequences. At first, the square root digits of the number ten after the comma are summed one by one. Secondly, the result of the addition corresponds to the nucleotide bases. Thirdly the results thus obtained are expressed as nucleotide bases (A, T, C and G). (A) Adenine, (T) Thymine, (C) Cytosine and (G) Guanine. From this point of view, approximately when the first four hundred digits of the square root of the number ten after the comma are calculated, the resulting gene sequencing is as follows: [ATAAGTCATAAGTGTATTAGTTTAAAACTG]. Fourthly, at this time, some repetitions were detected exactly like this: as “AGT” and “ATA”. Fifthly, after searching this sequence in NCBI (National Biotechnology Information Center), the search result was similar to bony fish, especially Danio aesculapii. Lastly, Danio aesculapii species is closely related to Zebra fish. In summary, With these results, not only the square root of ten in mathematics, but also many other irrational numbers (as explained by the similar QUANTUM PERSPECTIVE MODEL in previous articles), adding a common perspective to these different sciences; the connection between genetic codes in biochemistry and irrational numbers in mathematics is meaningful and has revealed very valuable results. In other words, with this novel research, a new window has been opened that can lead to new interdisciplinary discoveries.

Quantum Perspective Model Danio Kyathit Danio aesculapii The Square Roots of Ten and NCBI (National Biotechnology Information Center)

1. Introduction

Prior to this study, Kevser Köklü had published articles on the Quantum Perspective Model, not only about the square of the speed of light numbers [1], but also with Pi numbers with nucleotide base coded [2]. In addition to these; Pi numbers once again extended version [3], golden ratio numbers [4], Euler numbers [5], square root of two numbers [6], square root of three numbers [7], square root of five numbers [8], square root of seven numbers [9] and Fibonacci numbers [10] were also published by Tahir ÖLMEZ. In summary, the codes of all these irrational numbers (mentioned above) explained by a genetic sequence can be found in this diagram. One of these codes is [ATAAGTCATAAGTGTATTAGTTTAAAACTG] for the square root of ten number. In sum, this paper attempts to explain whether there is a relationship between the square roots of ten and genetic codes or not? Let’s try to explain these similarities and relations of irrational numbers according to genetic sequences.

2. Methods and Discussion2.1. Methods

In this work, the chemical formulas of nucleotide bases are calculated with regards to atomic numbers of elements. The chemical structures of bases include Carbon (C), Nitrogen (N), Oxygen (O), and Hydrogen (H). Calculation of bases with chemical atoms (See also Table 1) (Ölmez T, 2020) [4].

The atomic numbers of them: Carbon (C): 6, Nitrogen (N): 7, Oxygen (O): 8, Hydrogen (H): 1 (Wieser E M et al., 2013) [11]. The chemical structures of bases (A, T, C and G) are shown at below (Ölmez T, 2020) [4].

(A) Adenine: C₅H₅N₅: 70; (T) Thymine: C₅H₆N₂O₂: 66, (C) Cytosine: C₄H₅N₃O₁: 64, (G) Guanine: C₅H₅N₅O₁: 78 (Lodish H et al., 2018) [12].

2.2. Discussion

First of all, a paper about Golden Ratio numbers was researched [4]. Then, according to the Quantum Perspective Model, the connection between the

Table 1 Representation of nucleotide bases (A, T, C, G) in chemical atoms

ATOMS/NUCLEOTIDE BASES	C = 6	H = 1	O = 8	N = 7	SUM
ADENINE: C₅H₅N₅	5	5	-	5	70
THYMINE: C₅H₆N₂O₂	5	6	2	2	66
CYTOSINE: C₄H₅N₃O₁	4	5	1	3	58
GUANINE: C₅H₅N₅O₁	5	5	1	5	78

square root of the two [6] /three [7] /five [8] /seven [9] numbers articles were published. Nextly, the relationships between the Pi numbers [3] and Euler’s Identitiy [13] and and genetic codes were published. Now, the square root of the number ten and its genetic codes are calculated by this paper.

Based on the square root of 10, it can also be obtained as follows: the square root of two [6] is multiplied by the square root of five [8]. The genetic sequence of the square root of the two number is [GGATGACTACGGGTTTAGAAA] [6]. The genetic sequence of the square root of the five numbers is [ATTTATTCAATACATAACCCCATTGA] [8]. But the genetic sequence of the square root of the ten number is [ATAAGTCATAAGTGTATTAGTTTAAAACTG]. The common feature of these sequences is “TTT”. Now, According to Standard Dna Codon Table, it is Phenylalanine amino acid [14].

3. Calculation of the Square Root of Ten Numbers and Genetic Codes

The first three hundred digits of the square root of ten after the comma are here: The square root of 10 = 3.16227766016837933199889354443271853371955513932521682685750485279259443863923822134424810837930029518734728415284005514854885603045388001469051959670015390334492165717925994065915015347411333948412408531692957709047157646104436925787906203780860994182837171154840632855299911859682456420332696160469131433612894979189026652954361267617878135006138818627858046368313495247803114376933467197381951318567840323124179540221830804587284461460025357757970282864402902440 [15].

At first, the first group of the square root numbers of ten after comma was taken. For example 1, 6, 2, 2, 7, 7, 6, 6, 0, 1, 6, 8, 3, 7, 9… and so on. Secondly, all decimal numbers are subjected to the addition process, respectively. (1+6+2+2+7+7+6+6+0+1+6+8+3+7+9 = 71). The sum of the first group of the root square numbers of ten after comma is “71”. Just like as in (A) Adenine: 70 (See also Table 1).

The first group of the root square numbers of ten after comma:

1+6+2+2+7+7+6+6+0+1+6+8+3+7+9 = 71 (A) Adenine: 70

The second group of the root square numbers of ten after comma:

3+3+1+9+9+8+8+9+3+5+4+4 = 66 (T) Thymine: 66

The third group of the root square numbers of ten after comma:

4+3+2+7+1+8+5+3+3+7+1+9+5+5+5+1 = 69 (A) Adenine: 70

The fourth group of the root square numbers of ten after comma:

3+9+3+2+5+2+1+6+8+2+6+8+5+7+5 = 72 (A) Adenine: 70

The fifth group of the root square numbers of ten after comma:

0+4+8+5+2+7+9+2+5+9+4+4+3+8+6 = 76 (G) Guanine: 78

The sixth group of the root square numbers of ten after comma:

3+9+2+3+8+2+2+1+3+4+4+2+4+8+1+0+8 = 65 (T) Thymine: 66

The seventh group of the root square numbers of ten after comma:

3+7+9+3+0+0+2+9+5+1+8+7+3 = 57 (C) Cytosine: 58

The eighth group of the root square numbers of ten after comma:

4+7+2+8+4+1+5+2+8+4+0+0+5+5+1+4+8 = 68 (A) Adenine: 70

The ninth group of the square numbers of ten after comma:

5+4+8+8+5+6+0+3+0+4+5+3+8+8+0+0 = 67 (T) Thymine: 66

The tenth group of the square numbers of ten after comma:

1+4+6+9+0+5+1+9+5+9+6+7+0+0+1+5+3 = 71 (A) Adenine: 70

The eleventh group of the root square numbers of ten after comma:

9+0+3+3+4+4+9+2+1+6+5+7+1+7+9 = 70 (A) Adenine: 70

The twelfth group of the root square numbers of ten after comma:

2+5+9+9+4+0+6+5+9+1+5+0+1+5+3+4+7+4 = 79 (G) Guanine: 78

The thirteenth group of the root square numbers of ten after comma:

1+1+3+3+3+9+4+8+4+1+2+4+0+8+5+3+1+6 = 66 (T) Thymine: 66

The fourteenth group of the root square numbers of ten after comma:

9+2+9+5+7+7+0+9+0+4+7+1+5+7+6 = 78 (G) Guanine: 78

The fifteenth group of the root square numbers of ten after comma:

4+6+1+0+4+4+3+6+9+2+5+7+8+7 = 66 (T) Thymine: 66

The sixteenth group of the root square numbers of ten after comma:

9+0+6+2+0+3+7+8+0+8+6+0+9+9+4 = 71 (A) Adenine: 70

The seventeenth group of the root square numbers of ten after comma:

1+8+2+8+3+7+1+7+1+1+5+4+8+4+0+6 = 66 (T) Thymine: 66

The eighteenth group of the root square numbers of ten after comma:

3+2+8+5+5+2+9+9+9+1+1+8+5 = 67 (T) Thymine: 66

The nineteenth group of the root square numbers of ten after comma:

9+6+8+2+4+5+6+4+2+0+3+3+2+6+9 = 69 (A) Adenine: 70

The twentieth group of the root square numbers of ten after comma:

6+1+6+0+4+6+9+1+3+1+4+3+3+6+1+2+8+9+4 = 77 (G) Guanine: 78

The twenty-first group of the root square numbers of ten after comma:

9+7+9+1+8+9+0+2+6+6+5+2 = 64 (T) Thymine: 66

The twenty-second group of the root square numbers of ten after comma:

9+5+4+3+6+1+2+6+7+6+1+7+8 = 65 (T) Thymine: 66

The twenty-third group of the root square numbers of ten after comma:

7+8+1+3+5+0+0+6+1+3+8+8+1+8+6+2 = 67 (T) Thymine: 66

The twenty-fourth group of the root square numbers of ten after comma:

7+8+5+8+0+4+6+3+6+8+3+1+3+4 = 69 (A) Adenine: 70

The twenty-fifth group of the root square numbers of ten after comma:

9+5+2+4+7+8+0+3+1+1+4+3+7+6+9 = 69 (A) Adenine: 70

The twenty-sixth group of the root square numbers of ten after comma:

3+3+4+6+7+1+9+7+3+8+1+9+5+1+3 = 70 (A) Adenine: 70

The twenty-seventh group of the root square numbers of ten after comma:

1+8+5+6+7+8+4+0+3+2+3+1+2+4+1+7+9 = 71 (A) Adenine: 70

The twenty-eighth group of the square numbers of ten after comma:

5+4+0+2+2+1+8+3+0+8+0+4+5+8+7+2 = 59 (C) Cytosine: 58

The twenty-ninth group of the square numbers of ten after comma:

8+4+4+6+1+4+6+0+0+2+5+3+5+7+7+5 = 67 (T) Thymine: 66

The thirtieth group of the square numbers of ten after comma:

7+9+7+0+2+8+2+8+6+4+4+0+2+9+0+2+4+4+0 = 78 (G) Guanine: 78

This sequence can be shown as [ATAAGTCATAAGTGTATTAGTTTAAAACTG]. Let me try to explain this sequence with the “Quantum Perspective Model”. For example, The first group of the square root of ten after comma equal to Adenine (A): 71 with the one more “1” Hydrogen bond (H: 1). (Remember, See Table 1; Adenine (A): 70) This result may mean the sequence of the square root of ten in groups [ATAAGTCATAAGTGTATTAGTTTAAAACTG]. The third group of the square root of ten after the comma is regarded as with the lack of one Hydrogen bond (H: 1) Adenine (A): 69; (Remember, See Table 1; Adenine (A): 70) (Because the deviations in the calculation of the square root of ten numbers can be derived from the Adenine (A)―Thymine (T) Hydrogen bonds because of Adenine (A) pairs with Thymine (T) by two hydrogen bonds. Cytosine (C)―Guanine (G) pairs with by three hydrogen bonds [16]. The reason for the lack of hydrogen bonds: Hydrogen bonding is a very versatile attraction. (Ölmez T, 2020) Hydrogen bonds are relatively weak and easily broken by increasing hardness (Farrell R E, 2010) [17]. Hydrogen Bonds are critical for the process of genetic identification and are quantum in nature (Penrose Sir Roger, 2008) [18].

4. Results

After searching the square root of the number ten with the National Biotechnology Information Center (NCBI) databases, several associations with bony fish may be found at the end of this search. What makes Danio kyathit [19] different from the others is that its strips are divided into rows of small brown spots. This fish species is closely related to zebrafish [20]. Danio aesculapii [21] is its distinguishing feature as the number of shared circular scales, which it has in common only with D. Kerri. Also Danio aesculapii, the number of dorsal fins with six branched rays, is the only example of its genus. Generally it differs from other Danio species in that it has six dorsal fins [21]. Especially, when sunlight touches the side of this fish species, it shows a variety of colors [22]. Types of bony fishes are based on Danio aesculapii (See Figure 1).

Types of bony fishes are Paramormyrops kingsleyae, Larimichthys crocea and Cyprinodon tularosa.

Types of other living creatures are birds, carnivores, rodents, eudicots, monocots, lizards, bivalves, gastropods, flatworms, beetles, moths, butterflies, walking sticks, bees, butterflies, caddisflies and flies [23] (See Figure 2).

5. Conclusion

At first, the summary of this research can be summarized as the expression of

the square root of the number ten, about the first four hundred digits after the decimal point, with bases in DNA. Secondly, these found bases in DNA are scanned in the NCBI database and meaningful results are tried to be obtained. A common feature of the NCBI blasts is the result of bony fish, particularly Danio rerio (Zebra fish) (Also, See Table 2).

Table 2 The NCBI (National Biotechnology Information Center) summary and genetic sequences of some irrational numbers

Irrational Numbers	NCBI Results	Genetic Sequence
√2 [6]	Danio rerio, Timema, Bony fish	GGATGTCTATTGAGTGACAA
√3 [7]	Denticle Herring, Bony fish, Bats	GGATGACTACGGGTTTAGAAA
√5 [8]	Danio rerio (Zebra fish), Bony fish	ATTTATTCAATACATAACCCCATTGA
√7 [9]	Danio rerio, Danio aesculapii, Bony fish	GATTUCCCAUTAGAGTTAUTAGTTTGATT
√10	Danio Kyathit, Danio aesculapii, Bony fish	ATAAGTCATAAGTGTATTAGTTTAAAACTG
Pi Numbers (as a 22/7) [2]	Danio rerio (Zebra fish), Bony fish	UTA
Pi Numbers (as an extended form) [3]	Danio rerio (Zebra fish), Bony fish, Timema, Danio Kyathit	TCGATTATACTGGTTGGTTGTTAACGGTAC
Euler’s Identity [13]	Danio Kyathit, Danio rerio (Zebra fish), Bony fish, Timema	AAAGGUCCGUUUAAUAAGUUAAAUUUAGGU
Euler’s Numbers [10]	Danio rerio (Zebra fish), Bony fish, bat coronavirus	AUGUUGAUAUTAAUCATC
Golden Ratio Numbers (only “618”) [4]	Bony fish, Denticle Herring	CAAT Box “GGCCAATCT”; TATA Box “TATAAAA”

Thirdly, Danio aesculapii has a similar appearance to Zebrafish [22] (See Figure 2). Fourthly, Since Zebra fish have the ability to regenerate heart and lateral hair cells in their larval stages; they can contribute to a replication crisis in biomedical research, providing a useful scientific model as an organism [20]. Fifthly, although there is no periodic sequence of irrational numbers, in this paper a periodic sequence has been obtained in terms of genetic sequences, just as in “AGT” and “ATA”. Remember, this sequence can be shown as [ATAAGTCATAAGTGTATTAGTTTAAAACTG]. Finally, this study may shed light on the genetic sequences to be obtained, in biochemistry not only to explain the square root of the number ten with genetic codes, but also to explain other irrational numbers with the same property.

Conflicts of Interest

The author declares no conflicts of interest.

Cite this paper

Ölmez, T. (2022) Can Irrationality in Mathematics Be Explained by Genetic Sequences as in the Square Root of Ten? Open Access Library Journal, 9: e8504. https://doi.org/10.4236/oalib.1108504

References1

Köklü, K. (2019) Is Relativity Theory Also Valid in Biogenetics and Mathematics? NeuroQuantology, 17, 53-58. https://doi.org/10.14704/nq.2019.17.3.1999

Köklü, K. (2019) A Quantum Perspective Model to Genetic Codes through Various Sciences. NeuroQuantology, 17, 15-18. https://doi.org/10.14704/nq.2019.17.3.1974

Ölmez, T. (2021) According to Quantum Perspective Model, Are the Numbers of Pi Also Meaningful in Biochemistry? International Journal of Natural Sciences: Current and Future Research Trends (IJNSCFRT), 11, 1-10.

Ölmez, T. (2020) Is There an Aesthetics in Golden Ratio as Regards to the Common Cis-Regulatory Elements versus to Atomic Numbers of Elements with Respect to Quantum Perspective Model? Neurology and Neuroscience Reports, 3, 1-4. https://doi.org/10.15761/NNR.1000119

Ölmez, T. (2020) With Respect to Quantum Perspective Model, Can Euler Numbers Be Related to Biochemistry? Global Journal of Science Frontier Research, 20, 7-14. https://doi.org/10.34257/GJSFRFVOL20IS9PG7

Ölmez, T. (2021) According to the Binary Number Base System, Are the Square Roots of Two Numbers also Significant in Biochemistry? Open Access Library Journal, 8, e7122. https://doi.org/10.4236/oalib.1107122

Ölmez, T. (2021) What Is the Meaning of the Square Root of the Number Three in Biochemistry? Open Access Library Journal, 8, e7123. https://doi.org/10.4236/oalib.1107123

Ölmez, T. (2021) Can Irrational Numbers (Such as Square Root of the Number Five) Be Reached by Analysis of Genetic Sequences? Open Access Library Journal, 8, e7104. https://doi.org/10.4236/oalib.1107104

Ölmez, T. (2022) Are Irrational Numbers (Like the Square Root of the Number Seven) Applicable to Genetic Sequences? Open Access Library Journal, 9, e8513. https://doi.org/10.4236/oalib.1108513

Ölmez, T. (2020) Is There a Similarity between Fibonacci Sequence and Euler’s Number with Respect to Quantum Perspective Model? Global Journal of Science Frontier Research, 20, 35-39. https://doi.org/10.34257/GJSFRFVOL20IS9PG35

Wieser, E.M., Holden, N., Coplen, B.T., Böhlke, J.K., Berglund, M., Brand, W.A., et al. (2013) Atomic Weights of the Elements 2011 (IUPAC Technical Report). Pure and Application Chemistry, 85, 1047-1078. https://doi.org/10.1351/PAC-REP-13-03-02

Lodish, H., Berk, A., Zipursky, S.L., Matsudaira, P., Baltimore, D. and Darnell, J. (2018) Molecular Cell Biology, 6th Edition, Translation: Gekil, H., Özmen, M. and Yesilada, Ö., Palme Publishing, New York, 294-302.

Ölmez, T. (2021) According to Quantum Perspective Model, Is Euler’s Identity also Meaningful in Biochemistry? International Journal of Natural Sciences: Current and Future Research Trends, 9, 23-28.

https://en.wikipedia.org/wiki/DNA_and_RNA_codon_tables#Standard_DNA_codon_table

https://apod.nasa.gov/htmltest/gifcity/sqrt10.1mil

Fuhrmann, A., Getfert, S., Fu, Q., Reimann, P., Lindsay, S. and Ros, R. (2012) Long Lifetime of Hydrogen-Bonded DNA Basepairs by Force Spectroscopy. Biophysical Journal, 102, 2381-2390. https://doi.org/10.1016/j.bpj.2012.04.006 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3353008/

Farrell, R.E. (2010) RNA Methodologies A Laboratory Guide for Isolation and Characterization. 4th Edition, Academic Press, Amsterdam, 704-710.

Penrose, S.R., Abbott, D., Davies, P.C.W. and Pati, A.K. (Eds.) (2008) Quantum Aspects of Life. Imperial College Press, London, 20-29.

https://en.wikipedia.org/wiki/Danio_kyathi

https://en.wikipedia.org/wiki/Zebrafish

Kullander, S.O. and Fang, F. (2009) Danio aesculapii, a New Species of Danio from South-Western Myanmar. Zootaxa, 2164, 41-48. https://doi.org/10.11646/zootaxa.2164.1.4

https://en.wikipedia.org/wiki/Panther_danio

https://blast.ncbi.nlm.nih.gov/Blast.cgi