<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AE</journal-id><journal-title-group><journal-title>Advances in Entomology</journal-title></journal-title-group><issn pub-type="epub">2331-1991</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ae.2022.101008</article-id><article-id pub-id-type="publisher-id">AE-114554</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  &lt;i&gt;Anopheles leesoni&lt;/i&gt; Evans 1931, a Member of the &lt;i&gt;Anopheles funestus&lt;/i&gt; Group, Is a Potential Malaria Vector in Cameroon
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Edmond</surname><given-names>Kopya</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Cyrille</surname><given-names>Ndo</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Landre</surname><given-names>Djamouko-Djonkam</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Leslie</surname><given-names>Nkahe</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Parfait</surname><given-names>Awono-Ambene</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Flobert</surname><given-names>Njiokou</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Charles</surname><given-names>Sinclair Wondji</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Christophe</surname><given-names>Antonio-Nkondjio</given-names></name><xref ref-type="aff" rid="aff6"><sup>6</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff6"><addr-line>Department of Vector Biology, Liverpool School of Tropical medicine, Liverpool L3 5QA, UK</addr-line></aff><aff id="aff5"><addr-line>Centre for Research in Infectious Diseases, Yaoundé, Cameroon</addr-line></aff><aff id="aff3"><addr-line>Vector Borne Infectious Disease Unit of the Laboratory of Applied Biology and Ecology (VBID-LABEA), Department of Animal Biology, Faculty of Science, University of Dschang, Dschang, Cameroon</addr-line></aff><aff id="aff4"><addr-line>Faculty of Sciences, University of Yaoundé I, Yaoundé, Cameroon</addr-line></aff><aff id="aff2"><addr-line>Faculty of Medicine and Pharmaceutical Sciences, University of Douala, Douala, Cameroon</addr-line></aff><aff id="aff1"><addr-line>Malaria ResearchLaboratory, Organisation de Coordination pour la lutte Contre les Endémies en Afrique Centrale (OCEAC), Yaoundé, Cameroun</addr-line></aff><pub-date pub-type="epub"><day>11</day><month>11</month><year>2021</year></pub-date><volume>10</volume><issue>01</issue><fpage>99</fpage><lpage>109</lpage><history><date date-type="received"><day>21,</day>	<month>October</month>	<year>2021</year></date><date date-type="rev-recd"><day>10,</day>	<month>January</month>	<year>2022</year>	</date><date date-type="accepted"><day>13,</day>	<month>January</month>	<year>2022</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  <b>Background:</b>
   Understanding the biology of Anopheles malaria vector species is essential to planning effective and sustainable malaria control strategies in endemic countries. This study reported the implication of Anopheles leesoni in malaria transmission in Cameroon, Central Africa. <b>Methods:</b> Mosquitoes were collected in three localities from May 2015 to March 2018 using electric aspirators and Centers for Disease Control light traps (CDC-LT). Anopheles funestus sensu lato (s.l.) mosquitoes were identified as species using polymerase chain reaction assay (PCR). Furthermore, Plasmodium falciparum infection status was determined using the enzyme-linked
   
  immunosorbent assay (ELISA) method. <b>Results: </b>A total of 12,744 Anopheles mosquitoes were collected by electric aspirator (N = 4844) and CDC-LT (N = 7900). Anopheles funestus s.l. (86.95%) was the major species and the main malaria vector in rural savannah and rural forest sites followed by A. gambiae s.l. (13.05%) whereas in urban areas, A. gambiae s.l. was by far the most abundant representing 91.45% of Anopheles mosquitoes collected. Two members of the A. funestus group were identified among 1389 analysed by PCR: 1307 A. funestus sensu stricto (s.s.) (94.10%) and 82 A. leesoni (5.9%). Plasmodium falciparum infection rate was 21.04% in A. funestus s.s. For the first time, A. leesoni was found positive for P. falciparum (infection rate: 10.98%) in Cameroon. <b>Conclusion: </b>A very high P. falciparum infection rate was observed in this study in A. funestus s.s., highlighting its high implication in malaria transmission in Cameroon. Furthermore, the detection of P. falciparum infection in A. leesoni calls for more attention towards this neglected vector species.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Anopheles funestus&lt;/i&gt; Group</kwd><kwd> &lt;i&gt;Anopheles leesoni&lt;/i&gt;</kwd><kwd> &lt;i&gt;Plasmodium falciparum&lt;/i&gt;</kwd><kwd>  Malaria</kwd><kwd> Transmission</kwd><kwd> Cameroon</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>In Africa, the most important and widespread vectors of malaria belong to the An. gambiae complex and the A. funestus group [<xref ref-type="bibr" rid="scirp.114554-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref3">3</xref>]. Adult members of these two complexes/groups are difficult to distinguish morphologically [<xref ref-type="bibr" rid="scirp.114554-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref5">5</xref>], necessitating molecular techniques for accurate identification [<xref ref-type="bibr" rid="scirp.114554-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref7">7</xref>].</p><p>Within the A. funestus group, A. funestus s.s. is the only member that plays a significant role in the transmission of human malaria throughout the African continent, but other species of A. funestus group have been naturally found infected with P.falciparum [<xref ref-type="bibr" rid="scirp.114554-ref8">8</xref>]. This mosquito is widely distributed throughout tropical Africa and its breeding site is permanent or semi-permanent. Its activity extends even during the dry season where other malaria mosquito vectors, such as A. gambiae s.l. are usually less abundant [<xref ref-type="bibr" rid="scirp.114554-ref9">9</xref>]. As for other members of the A. funestus group, some reports indicated that A. rivulorum may be involved in malaria transmission in some situations [<xref ref-type="bibr" rid="scirp.114554-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref10">10</xref>] and P. falciparum has been reported from A. parensis and A. leesoni [<xref ref-type="bibr" rid="scirp.114554-ref11">11</xref>]. A. vaneedeni has been experimentally infected with P. falciparum [<xref ref-type="bibr" rid="scirp.114554-ref12">12</xref>] which has recently been isolated in natural populations of this species in South Africa [<xref ref-type="bibr" rid="scirp.114554-ref13">13</xref>]. No reports of any involvement in malaria transmission for the remaining members of the A. funestus group were found. Despite their morphological similarity, the species of A.funestus group shows different vectorial capacities and then different malaria transmission capacities. Therefore, there is a necessity to determine the predilection place of action of each species in order to readapt malaria vector control decisions and operations, focusing on really affected areas and making vital commitments in all African countries where financial resources relating to related malaria control are limited.</p><p>Historical evidence suggests that in order to conduct an efficient vector control program, there is a necessity to identify and distinguish vector species from non-vector species. Control measures against A. funestus s.s., which is an anthropophilic and endophilic vector, favour exophilic members of the A. funestus group, increasing their density [<xref ref-type="bibr" rid="scirp.114554-ref14">14</xref>]. For example, in South Africa [<xref ref-type="bibr" rid="scirp.114554-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref15">15</xref>], Kenya [<xref ref-type="bibr" rid="scirp.114554-ref16">16</xref>], and Tanzania [<xref ref-type="bibr" rid="scirp.114554-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref17">17</xref>], indoor spraying used to eliminate A. funestus s.s. was followed by an upsurge of “funestus look-alike” specimens, contributing to the failure of the control program. However, further investigation revealed that these mosquitoes belong to A. vaneedeni, A. parensis, A. rivolurum, or A. leesoni. Each of them is occasionally or rarely implicated in the transmission of malaria to humans, and their zoophilic and exophilic habits probably reduce exposure to insecticides.</p><p>Reliable species identification is indeed important to assess the relative role played by each species in the transmission of Plasmodium and improve our ability to evaluate the efficacy of vector control measures implemented in areas where several species of the A. funestus group are present. In the past, species identification has mainly been performed using either morphological or cytogenetic methods. However, the development of PCR-based methods has greatly facilitated the identification of species in the group [<xref ref-type="bibr" rid="scirp.114554-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref18">18</xref>]. It is commonly asserted that malaria transmission in Africa is maintained by members of the A. gambiae complex [<xref ref-type="bibr" rid="scirp.114554-ref19">19</xref>]. However, in several parts of the continent, other mosquito species contribute to the transmission of the parasite, including A. funestus s.l. and A. nili. Previous studies in Cameroon defend that A. funestus s.s. is the main, if not the only vector of the A. funestus group responsible for transmission of malaria parasites [<xref ref-type="bibr" rid="scirp.114554-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref22">22</xref>]. Although A. leesoni [<xref ref-type="bibr" rid="scirp.114554-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref21">21</xref>] have been found in several malaria foci, their role in the transmission of malaria in Cameroon has not been further studied.</p><p>In this paper, we provide evidence incriminating A. leesoni in the transmission of malaria in Cameroon. Demonstrating at the same time the presence of two species of the A. funestus group in this country, where malaria transmission is a serious public health problem.</p></sec><sec id="s2"><title>2. Methods</title><sec id="s2_1"><title>2.1. Study Area</title><p>The study was carried out in three sites belonging to the forest and savannah domains of Cameroon (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><p>Mebelong (6˚46'N, 11˚70'E) is located in the Adamawa region, approximately 350 km from Yaound&#233;, the capital city of Cameroon. The village is situated at the vicinity of a lake that represents a potential breeding site for A.funestus s.s. mosquitoes throughout the year [<xref ref-type="bibr" rid="scirp.114554-ref23">23</xref>]. The climate is Sudano-Guinean characterized by an eight-months rainy season from March to October, and a dry season of four months extending from November to February [<xref ref-type="bibr" rid="scirp.114554-ref24">24</xref>].</p><p>Obout (12˚53'N, 35˚7'E) and Yaound&#233; (3˚52'N, 11˚27'E) are located about 30 km apart within the forest regions area of the Centre region. The climate is alike to that of Equatorial Guinea, characterized by two rainy seasons extending from August to October, and from April to June. There are also two dry seasons running from November to April and from June to July [<xref ref-type="bibr" rid="scirp.114554-ref24">24</xref>]. The village Obout is situated in rural zone and is surrounded by an evergreen forest. Within the village, there are several fish ponds bordered with emergent vegetation suitable for the development of Anopheles mosquito larvae, particularly those of A.funestus group.</p><p>The town Yaound&#233; is made up of wetlands and a degraded forest surrounding the city. There are also lakes and fish ponds suitable for the development of anopheline mosquitoes. Yaound&#233; features an equatorial climate with two rainy seasons extending from March to June and from September to November lasting 7 to 8 months [<xref ref-type="bibr" rid="scirp.114554-ref24">24</xref>].</p></sec><sec id="s2_2"><title>2.2. Ethical Consideration</title><p>The study was approved by the Cameroonian national ethical committee for research on human health (statement N˚ 2015/01/535/CE/CNRERSH/SP). Verbal informed consent was obtained from each head household before the team entered their houses for mosquito collection.</p></sec><sec id="s2_3"><title>2.3. Mosquito Collections and Identification</title><p>Mosquitoes were collected from May 2015 to December 2017 in Obout and Mebelong and from May 2017 to March 2018 in Yaound&#233;.</p><p>In Obout and Mebelong, indoor resting mosquitoes were collected in human dwellings in the morning 10 to 15 houses, between 7:00 and 10:00 AM using electric aspirators (Rule In-Line Blowers, Model 240) whereas in Yaound&#233; mosquitoes were collected from 6:00 PM to 6:00 AM using CDC light Traps placed indoors and outdoors in 10 to 15 houses. After species identification using morphological keys [<xref ref-type="bibr" rid="scirp.114554-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref5">5</xref>], only mosquitoes belonging to A. funestus group were included in the subsequent analysis.</p></sec><sec id="s2_4"><title>2.4. Molecular Identification of Anopheles funestus Members</title><p>Molecular identification of specimens of A. funestus group was performed following the species-specific protocols described by [<xref ref-type="bibr" rid="scirp.114554-ref21">21</xref>] and [<xref ref-type="bibr" rid="scirp.114554-ref7">7</xref>]. Abdomen, legs and wings were used for genomic DNA extraction as described previously [<xref ref-type="bibr" rid="scirp.114554-ref25">25</xref>]. The primers contained in <xref ref-type="table" rid="table1">Table 1</xref> were used. A final 25 μL reaction volume of PCR contained 2.5 μL of 10&#215; buffer including 15 mM MgCl<sub>2</sub>, 5 pmol of each primer, 200 μM of each dNTP, and 0.5 units of Taq polymerase unit. Amplification started with an initial denaturation step at 94˚C for two minutes, followed by 36 cycles of denaturation at 94˚C for 30 seconds, annealing at 45˚C for 30 seconds, and elongation at 72˚C for 40 seconds, with a final extension step at 72˚C for five minutes. The PCR products were loaded and visualized on regular 1.5% agarose gels stained with ethidium bromide.</p></sec><sec id="s2_5"><title>2.5. Detection of Plasmodium falciparum Infection</title><p>Head and thorax of each female mosquito were subjected to indirect enzyme-linked immunosorbent assay (ELISA) for the presence of P. falciparum circumsporozoite protein (CSP) using monoclonal antibodies 2A10 as described by Wirtz et al. [<xref ref-type="bibr" rid="scirp.114554-ref26">26</xref>]. One positive control and ten negative controls were added to each microtitre plate. Negative controls were head and thorax of unfed A. gambiae s.s. (Kisumu) from laboratory colonies maintained at OCEAC. Absorbance was measured at 405 nm using a microtitre plate reader (BioTek ELx800, Swindon, UK). The cut-off value for positive specimens was estimated at twice the mean value of the negative controls.</p></sec><sec id="s2_6"><title>2.6. Statistical Analysis</title><p>Infection rates were determined as the percentage of mosquito species samples found positive for P. falciparum over the total number of specimens tested.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Sequences of primers used for molecular identification of An.funestus species</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Sequences</th><th align="center" valign="middle" >Species</th><th align="center" valign="middle" >Band size (bp)</th></tr></thead><tr><td align="center" valign="middle" >UV</td><td align="center" valign="middle" >5'TGTGACTGCAGGACACAT3'</td><td align="center" valign="middle" >Universal</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >FUN</td><td align="center" valign="middle" >5'GCATCGTGAGGTTAATCATG3'</td><td align="center" valign="middle" >An. funestus</td><td align="center" valign="middle" >505</td></tr><tr><td align="center" valign="middle" >VAN</td><td align="center" valign="middle" >5'TGTCGACTTGGTAGCCGAAC3'</td><td align="center" valign="middle" >An. vaneedeni</td><td align="center" valign="middle" >587</td></tr><tr><td align="center" valign="middle" >RIV</td><td align="center" valign="middle" >5'CAAGCCGTTCGACCCTGATT3'</td><td align="center" valign="middle" >An. rivulorum</td><td align="center" valign="middle" >411</td></tr><tr><td align="center" valign="middle" >PAR</td><td align="center" valign="middle" >5'TGCGGTCCCAAGCTAGGTTC3'</td><td align="center" valign="middle" >An. parensis</td><td align="center" valign="middle" >252</td></tr><tr><td align="center" valign="middle" >LEE</td><td align="center" valign="middle" >5'TACACGGGCGCCTGATAGTT3'</td><td align="center" valign="middle" >An. leesoni</td><td align="center" valign="middle" >146</td></tr><tr><td align="center" valign="middle" >RIVLIKE</td><td align="center" valign="middle" >5'CCGCCTCCCGTGGAGTGGGGG3'</td><td align="center" valign="middle" >An. rivulorum-like</td><td align="center" valign="middle" >313</td></tr></tbody></table></table-wrap></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Anopheles Mosquito Population</title><p>A total of 12,744 resting Anopheles mosquitoes were collected during the study period including 7857 A.gambiae s.l. and 4887 A.funestus s.l. (<xref ref-type="table" rid="table2">Table 2</xref>). Anopheles funestus s.l. was by far the most abundant in Obout and Mebelong representing 74.42% and 97.12% of the total Anopheles mosquitoes caught respectively. By contrast, A.gambiae s.l. was the most frequent species in the city of Yaound&#233; (91.46%).</p></sec><sec id="s3_2"><title>3.2. Anopheles leesoni Abundance and Distribution</title><p>The Anopheles funestus group, as revealed by the molecular identification of 1389 individual mosquitoes, was composed of two species, including 1307 A.funestus s.s. (94.10%) and 82 A.leesoni (5.90%). Both species were found in all three localities (<xref ref-type="fig" rid="fig1">Figure 1</xref>). However, the proportion of A.leesoni was higher in Yaound&#233; (57/390: 14.62%) than in Obout (16/474: 3.38%) and in Mebelong (9/525: 1.71%).</p></sec><sec id="s3_3"><title>3.3. Plasmodium Infection Rates</title><p>Plasmodium falciparum infection rates are given in <xref ref-type="table" rid="table3">Table 3</xref>. Of a total of 1389 head and thorax analyses, 284 were positive, corresponding to a high global circumsporozoite rate of 20.45%. Among the mosquitoes tested, 21.04% (275/1307) were infected with A. funestus s.s. and 10.98% (9/82) for A. leesoni. Although the infection rate of A. funestus s.s. appeared higher in Obout and Mebelong compared to A. leesoni, this difference was not statistically significant (P &gt; 0.05). No difference in terms of infection was observed between both species in Yaound&#233; (P = 0.11).</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Number of A.funestus s.l. and A.gambiae s.l. mosquitoes collected in Obout, Mebelong and Yaound&#233;</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Species</th><th align="center" valign="middle" >Obout</th><th align="center" valign="middle" >Mebelong</th><th align="center" valign="middle"  colspan="2"  >Yaound&#233;</th><th align="center" valign="middle" >Total</th></tr></thead><tr><td align="center" valign="middle" >A. funestus s.l.</td><td align="center" valign="middle" >1615 (74.42%)</td><td align="center" valign="middle" >2597 (97.12%)</td><td align="center" valign="middle"  colspan="2"  >675 (8.54%)</td><td align="center" valign="middle" >4887 (38.35%)</td></tr><tr><td align="center" valign="middle" >A. gambiae s.l.</td><td align="center" valign="middle" >555 (25.58%)</td><td align="center" valign="middle"  colspan="2"  >77 (2.88%)</td><td align="center" valign="middle" >7225 (91.46%)</td><td align="center" valign="middle" >7857 (61.65%)</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >2170 (100%)</td><td align="center" valign="middle" >2674 (100%)</td><td align="center" valign="middle"  colspan="2"  >7900 (100%)</td><td align="center" valign="middle" >12,744 (100%)</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Circumsporozoite protein (CSP) rates of A.funestus s.s. and A.leesoni mosquitoes from the study locations</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Localities</th><th align="center" valign="middle"  colspan="3"  >A. funestus s.s.</th><th align="center" valign="middle" >A. leesoni</th><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th></tr></thead><tr><td align="center" valign="middle" >Tested</td><td align="center" valign="middle" >Positive</td><td align="center" valign="middle" >Infection rate (CI<sub>95%</sub>)</td><td align="center" valign="middle" >Tested</td><td align="center" valign="middle" >Positive</td><td align="center" valign="middle" >Infection rate (CI<sub>95%</sub>)</td></tr><tr><td align="center" valign="middle" >Obout</td><td align="center" valign="middle" >458</td><td align="center" valign="middle" >155</td><td align="center" valign="middle" >33.84% (28.72 - 39.61)</td><td align="center" valign="middle" >16</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >18.00% (3.87 - 54.8)</td></tr><tr><td align="center" valign="middle" >Mebelong</td><td align="center" valign="middle" >516</td><td align="center" valign="middle" >107</td><td align="center" valign="middle" >20.74% (16.99 - 25.06)</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >11.11% (0.28 - 61.91)</td></tr><tr><td align="center" valign="middle" >Yaound&#233;</td><td align="center" valign="middle" >333</td><td align="center" valign="middle" >13</td><td align="center" valign="middle" >3.90% (2.8 - 6.68)</td><td align="center" valign="middle" >57</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >8.77% (2.84 - 20.47)</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >1307</td><td align="center" valign="middle" >275</td><td align="center" valign="middle" >21.04% (18.63 - 23.68)</td><td align="center" valign="middle" >82</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >10.98% (5.02 - 20.84)</td></tr></tbody></table></table-wrap></sec></sec><sec id="s4"><title>4. Discussion</title><p>The control of Anopheles vector populations is the pillar of malaria elimination strategies. Identifying primary disease vectors and understanding their biology and geographic distribution is crucial to plan efficient control strategies. For several decades attention has been focused of mosquitoes from A. gambiae complex which have for a long time been considered as the most efficient malaria vector throughout Africa continent. However, the recent increase of interest in other Anopheles species, such as those from Anopheles funestus group led to the change of this paradigm. Similar to this study A. funestus s.s. was repeatedly reported to be widespread and highly infected with P. falciparum, thus playing a major role in malaria transmission in East, Central and West Africa.</p><p>If knowledge and control of major vector species using insecticide and insecticide-treated tools successfully contributed to malaria reduction over the past decade [<xref ref-type="bibr" rid="scirp.114554-ref27">27</xref>], the real challenge for malaria elimination and eradication could arise from secondary vectors that sustain residual malaria transmission in the absence of primary vectors. Unfortunately, little is known regarding the distribution and biology of such secondary vectors.</p><p>In this study, we have demonstrated that A. leesoni is sympatric with A. funestus s.s. in forest and humid savannah ecosystems in Cameroon and was infected with P.falciparum in all the study sites. Previous studies have already reported the presence of A. leesoni in Yaound&#233; but not in Obout and Mebelong. However, to our knowledge, this is the first time this species has been incriminated as a malaria vector in Cameroon [<xref ref-type="bibr" rid="scirp.114554-ref28">28</xref>]. In other regions of the continent, there are some reports [<xref ref-type="bibr" rid="scirp.114554-ref11">11</xref>] of the possible carriage of P. falciparum parasites by A. leesoni, but there is no or little evidence of its role as a secondary malaria vector. Other members of the A. funestus groups, such as A. rivulorum and A. vaneedeni, were also found infected by malaria parasites in laboratories and in nature. Anopheles rivulorum has been implicated in malaria transmission or found to harbour P. falciparum parasites in Kenya [<xref ref-type="bibr" rid="scirp.114554-ref10">10</xref>], Tanzania [<xref ref-type="bibr" rid="scirp.114554-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref11">11</xref>] and Zambia [<xref ref-type="bibr" rid="scirp.114554-ref29">29</xref>]. Anopheles vaneedeni has been experimentally infected with Plasmodium in the laboratory [<xref ref-type="bibr" rid="scirp.114554-ref12">12</xref>] and was recently found infected in nature [<xref ref-type="bibr" rid="scirp.114554-ref13">13</xref>].</p><p>Although we didn’t assess A. leesoni’s feeding behaviour by determining the origin of the blood meal in the abdomens of mosquitoes, the fact that blood-fed A. leesoni was found resting inside human dwellings suggests that this species is endophilic and anthropophilic. Previous research by Temu et al. [<xref ref-type="bibr" rid="scirp.114554-ref11">11</xref>] in Tanzania revealed a preference for humans (81.8%) over goats (0%), with the species also resting inside human dwellings in Kenya [<xref ref-type="bibr" rid="scirp.114554-ref29">29</xref>] and West Africa [<xref ref-type="bibr" rid="scirp.114554-ref30">30</xref>].</p><p>Relatively high rates of infections of P. falciparum were detected in A. funestus s.s. and A. leesoni collected in our study area. This is the first report on Plasmodium infection in A. leesoni in Cameroon. Although this vector has been reported from different sites in East Africa and has been shown to play a major role in malaria transmission in Africa, no information is so far available on its infection with malaria parasites in Central Africa (Cameroon). Such high infection rates in non-vectors should be interpreted with caution because none of the previous studies have reported any samples of A. leesoni infected with the Plasmodium parasite, either by salivary gland dissections or ELISA detection methods [<xref ref-type="bibr" rid="scirp.114554-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.114554-ref21">21</xref>]. While we cannot exclude the possibility that the ELISA is detecting sporozoites in the salivary glands alone, it is likely that the method is also picking up parasites in the thoracic hemocele. Therefore, unlike salivary gland dissections, ELISA does not guarantee that the mosquito is infectious unless it is carried out on the salivary glands themselves. Further studies are required involving detection of parasites by ELISA or PCR performed on salivary glands dissected from wild members of the A. funestus group.</p><p>Although it is in low abundance in this study, A. leesoni appears to transmit malaria as well as A. funestus s.s. in Cameroon. As reported in Tanzania [<xref ref-type="bibr" rid="scirp.114554-ref11">11</xref>], more than one species within the A. funestus group was found infected with P. falciparum, therefore sustaining the need to identify and adjust the list of malaria vectors that belong to species groups or complexes in order to establish areas of sympatric existence and to assess the role played by each species in malaria transmission. This information will improve our ability to evaluate the efficient and strategic planning of vector control measures.</p><p>In conclusion, since mosquito abundance displays temporal and spatial fluctuation and since more than one species within the A. funestus group was found infected with P. falciparum, it is important to characterize the spatial distribution of the A. funestus s.s., A. rivulorum, and A. leesoni according to the malaria endemicity rate. Among members of the A. funestus group, the species composition and species diversity are likely to differ locally, leading to significant impact on efficiency of malaria vector control management.</p></sec><sec id="s5"><title>Acknowledgements</title><p>This work was supported by a Wellcome Trust Training Fellowship in Public Health and Tropical Medicine (WT 102543/Z/13/Z) to CN and a Wellcome Trust Fellowship Senior in Public Health and Tropical Medicine (WT 202687/Z/16/Z) to CAN.</p></sec><sec id="s6"><title>Authors’ contributions</title><p>CAN and CN conceived and designed the study protocol; EK, LDD and LN participated in data collection and laboratory analyses; CAN, CN, PAA, FN and CSW critically revised the manuscript; EK, CN and CAN interpreted, analysed data, and wrote the manuscript. All authors read and approved the final manuscript.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>Kopya, E., Ndo, C., Djamouko-Djonkam, L., Nkahe, L., Awono-Ambene, P., Njiokou, F., Wondji, C.S. and Antonio-Nkondjio, C. (2022) Anopheles leesoni Evans 1931, a Member of the Anopheles funestus Group, Is a Potential Malaria Vector in Cameroon. Advances in Entomology, 10, 99-109. https://doi.org/10.4236/ae.2022.101008</p></sec><sec id="s9"><title>Abbreviations</title><p>CDC: Centre for Disease Control and Prevention; ELISA: Enzyme Linked Immunosorbent Assay; PCR: Polymerase Chain Reaction; s.l.: sensu lato; s.s.: sensu stricto; A.: Anopheles</p></sec></body><back><ref-list><title>References</title><ref id="scirp.114554-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Coetzee, M., Hunt, R.H., Wilkerson, R., Della Torre, A., Coulibaly, M.B. and Besansky, N.J. (2013) Anopheles coluzzii and Anopheles amharicus, New Members of the Anopheles gambiae Complex. Zootaxa, 3619, 246-274.https://doi.org/10.11646/zootaxa.3619.3.2</mixed-citation></ref><ref id="scirp.114554-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Harbach, R.E. (2004) The Classification of Genus Anopheles (Diptera: Culicidae): A Working Hypothesis of Phylogenetic Relationships. Bulletin of Entomological Research, 94, 537-553. https://doi.org/10.1079/BER2004321</mixed-citation></ref><ref id="scirp.114554-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Coetzee, M. and Koekemoer, L.L. (2013) Molecular Systematics and Insecticide Resistance in the Major African Malaria Vector, Anopheles funestus. Annual Review of Entomology, 58, 393-412. https://doi.org/10.1146/annurev-ento-120811-153628</mixed-citation></ref><ref id="scirp.114554-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Gillies, M.T. and De Meillon, B. (1968) The Anophelinae of Africa South of the Sahara. Publications of the South African Institute for Medical Research, Johannesburg.</mixed-citation></ref><ref id="scirp.114554-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Spillings, B.L., Brooke, B.D., Koekemoer, L.L., Chiphwanya, J., Coetzee, M. and Hunt, R. (2009) A New Species Concealed by Anopheles funestus Giles, a Major Malaria Vector in Africa. American Journal of Tropical Medicine and Hygiene, 81, 510-515. https://doi.org/10.4269/ajtmh.2009.81.510</mixed-citation></ref><ref id="scirp.114554-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Scott, J.A., Brogdon, W.G. and Collins, F.H. (1993) Identification of Single Specimens of the Anopheles gambiae Complex by the Polymerase Chain Reaction. American Journal of Tropical Medicine and Hygiene, 49, 520-529.https://doi.org/10.4269/ajtmh.1993.49.520</mixed-citation></ref><ref id="scirp.114554-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Cohuet, A., Simard, F., Toto, J.C., Kengne, P., Coetzee, M. and Fontenille, D. (2003) Species Identification within the Anopheles funestus Group of Malaria Vectors in Cameroon and Evidence for a New Species. American Journal of Tropical Medicine and Hygiene, 69, 200-205. https://doi.org/10.4269/ajtmh.2003.69.200</mixed-citation></ref><ref id="scirp.114554-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Wilkes, T.J., Matola, Y.G. and Charlwood, J.D. (1996) Anopheles rivulorum, a Vector of Human Malaria in Africa. Medical and Veterinary Entomology, 10, 108-110.https://doi.org/10.1111/j.1365-2915.1996.tb00092.x</mixed-citation></ref><ref id="scirp.114554-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Fontenille, D., Lochouarn, L., Diagne, N., Sokhna, C., Lemasson, J.J., Diatta, M., et al. (1997) High Annual and Seasonal Variations in Malaria Transmission by Anophelines and Vector Species Composition in Dielmo, a Holoendemic Area in Senegal. American Journal of Tropical Medicine and Hygiene, 56, 247-253.https://doi.org/10.4269/ajtmh.1997.56.247</mixed-citation></ref><ref id="scirp.114554-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Kawada, H., Dida, G.O., Sonye, G., Njenga, S.M. and Mwandawiro, C. (2012) Reconsideration of Anopheles rivulorum as a Vector of Plasmodium falciparum in Western Kenya: Some Evidence from Biting Time, Blood Preference, Sporozoite Positive Rate, and Pyrethroid Resistance. Parasites &amp; Vectors, 5, Article No. 230.https://doi.org/10.1186/1756-3305-5-230</mixed-citation></ref><ref id="scirp.114554-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Temu, E.A., Minjas, J.N., Tuno, N., Kawada, H. and Takagi, M. (2007) Identification of Four Members of the Anopheles funestus (Diptera: Culicidae) Group and Their Role in Plasmodium falciparum Transmission in Bagamoyo Coastal Tanzania. Acta Tropica, 102, 119-125. https://doi.org/10.1016/j.actatropica.2007.04.009</mixed-citation></ref><ref id="scirp.114554-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">De Meillon, B., Van Eeden, G.J., Coetzee, L., Coetzee, M., Meiswinkel, R., Du Toit, C.L.N., et al. (1977) Observations on a Species of the Anopheles funestus Subgroup, a Suspected Exophilic Vector of Malaria Parasites in Northeastern Transvaal, South Africa. Mosquito News, 37, 657-661.</mixed-citation></ref><ref id="scirp.114554-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Burke, A., Dandalo, L., Munhenga, G., Dahan, Y, Mbokazi, F., Coetzee, M., et al. (2017) A New Malaria Vector Mosquito in South Africa. Scientific Reports, 7, Article No. 43779. https://doi.org/10.1038/srep43779</mixed-citation></ref><ref id="scirp.114554-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Gillies, M.T. and Smith, A. (1960) The Effect of a Residual House Spraying Campaign in East Africa on Species Balance in the Anopheles funestus Group: The Replacement of Anopheles funestus by Anopheles rivulorum. Bulletin of Entomological Research, 51, 243-253. https://doi.org/10.1017/S0007485300057953</mixed-citation></ref><ref id="scirp.114554-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Hargreaves, K., Koekemoer, L.L., Brooke, B.D., Hunt, R.H., Mthembu, J. and Coetzee, M. (2000) Anopheles funestus Resistant to Pyrethroid Insecticides in South Africa. Medical and Veterinary Entomology, 14, 181-189.https://doi.org/10.1046/j.1365-2915.2000.00234.x</mixed-citation></ref><ref id="scirp.114554-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Gillies M.T. and Furlong, M. (1964) An Investigation into the Behaviour of Anopheles parensis on the Kenya Coast. Bulletin of Entomological Research, 55, 1-16. https://doi.org/10.1017/S0007485300049221</mixed-citation></ref><ref id="scirp.114554-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Matola, Y.G., Ijumba, J.N., Magayuka, S.A. and Kopakopa, S.B. (1990) Epidemiological Assessment of the Impact of Lambdacyhalothrin (OMS-3021) on the Transmission of Malaria in a Rural Area in Tanzania. Bulletin de la Société Franaise de Parasitologie, 8, 1201-1202.</mixed-citation></ref><ref id="scirp.114554-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Koekemoer, L.L., Kamau, L., Hun,t R.H. and Coetzee, M. (2002) A Cocktail Polymerase Chain Reaction Assay to Identify Members of the Anopheles funestus (Diptera: Culicidae) Group. American Journal of Tropical Medicine and Hygiene, 66, 804-811. https://doi.org/10.4269/ajtmh.2002.66.804</mixed-citation></ref><ref id="scirp.114554-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">White, G.B. (1974) Anopheles gambiae Complex and Disease Transmission in Africa. Transactions of the Royal Society of Tropical Medicine and Hygiene, 68, 278-298. https://doi.org/10.1016/0035-9203(74)90035-2</mixed-citation></ref><ref id="scirp.114554-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Ndo, C., Kopya, E., Donbou, M.A., Njiokou, F., Awono-Ambene, P. and Wondji, C.S. (2018) Elevated Plasmodium Infection Rates and High Pyrethroid Resistance in Major Malaria Vectors in a Forested Area of Cameroon Highlight Challenges of Malaria Control. Parasites &amp; Vectors, 11, Article No. 157.https://doi.org/10.1186/s13071-018-2759-y</mixed-citation></ref><ref id="scirp.114554-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Antonio-Nkondjio, C., Kerah Hinzoumbe, C., Simard, F., Awono-Ambene, P., Tchuinkam, T. and Fontenille, D. (2006) Complexity of the Malaria Vectorial System in Cameroon: Contribution of Secondary Vectors to Malaria Transmission. Journal of Medical Entomology, 43, 1215-1221.https://doi.org/10.1093/jmedent/43.6.1215</mixed-citation></ref><ref id="scirp.114554-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Ndo, C., Kopya, E., Menze-Djantio, B., Toto, J.C., Awono-Ambene, P., Gareth, L. and Wondji, C.S. (2016) High Susceptibility of Wild Anopheles funestus to Infection with Natural Plasmodium falciparum Gametocytes Using Membrane Feeding Assays. Parasites &amp; Vectors, 9, Article No. 341. https://doi.org/10.1186/s13071-016-1626-y</mixed-citation></ref><ref id="scirp.114554-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Menze, B.D., Wondji, M.J., Tchapga, W., Tchoupo, M., Riveron, J.M. and Wondji C.S. (2018) Bionomics and Insecticides Resistance Profiling of Malaria Vectors at a Selected Site for Experimental Hut Trials in Central Cameroon. Malaria Journal, 17, Article No. 317. https://doi.org/10.1186/s12936-018-2467-2</mixed-citation></ref><ref id="scirp.114554-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Olivry, J.C. (1986) Fleuves et rivières du Cameroun. Collection Monographie Hydrologiques No.9, ORSTOM, Paris.</mixed-citation></ref><ref id="scirp.114554-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Morlais, I., Poncon, N., Simard, F., Cohuet, A. and Fontenille, D. (2004) Intraspecific Nucleotide Variation in Anopheles gambiae: New Insights into the Biology of Malaria Vectors. American Journal of Tropical Medicine and Hygiene, 71, 795-802.https://doi.org/10.4269/ajtmh.2004.71.795</mixed-citation></ref><ref id="scirp.114554-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Wirtz, R.A., Zavala, F., Charoenvit, Y., Campbell, G.H., Burkot, T.R., Schneider, I., et al. (1987) Comparative Testing of Monoclonal Antibodies against Plasmodium falciparum Sporozoites for ELISA Development. Bulletin of the World Health Organization, 65, 39-45.</mixed-citation></ref><ref id="scirp.114554-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">WHO (2016) World Malaria Report 2016. World Health Organization, Geneva.</mixed-citation></ref><ref id="scirp.114554-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Doumbe, B.P., Ngadjeu, C.S., Sonhafouo-Chiana, N., Talipouo, A., Djamouko-Djonkam, L., Kopya, E., Bamou, R., Toto, J.C., Mounchili, S., Tabue, R., Awono-Ambene, P., Wondji C.S., Njiokou, F. and Antonio-Nkondjio, C. (2018) High Malaria Transmission Sustained by Anopheles gambiae s.l. Occurring Both Indoors and Outdoors in the City of Yaoundé, Cameroon. Wellcome Open Research, 3, Article No. 164. https://doi.org/10.12688/wellcomeopenres.14963.1</mixed-citation></ref><ref id="scirp.114554-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Lobo, N.F., Laurent, B.S., Sikaala, C.H., Hamainza, B., Chanda, J., Chinula, D., et al. (2015) Unexpected Diversity of Anopheles species in Eastern Zambia: Implications for Evaluating Vector Behaviour and Interventions Using Molecular Tools. Scientific Reports, 5, Article No. 17952. https://doi.org/10.1038/srep17952</mixed-citation></ref><ref id="scirp.114554-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Kamau, L., Munyekenye, G.O., Koekemoer, L.L., Hunt, R.H. and Coetzee, M. (2003) A Survey of the Anopheles funestus (Diptera: Culicidae) Group of Mosquitoes from 10 Sites in Kenya with Special Emphasis on Population Genetic Structure Based on Chromosomal Inversion Karyotypes. Journal of Medical Entomology, 40, 664-671.https://doi.org/10.1603/0022-2585-40.5.664</mixed-citation></ref></ref-list></back></article>