<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2021.1212125</article-id><article-id pub-id-type="publisher-id">AJPS-114059</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Investigation on Viral Pathogens in &lt;i&gt;Vitis vinifera&lt;/i&gt; from Four Production Bases in Hangzhou Vicinity of China by sRNAseq and Molecular Validation
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hongmei</surname><given-names>Li</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lingzhu</surname><given-names>Wei</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jiang</surname><given-names>Wu</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Nongnong</surname><given-names>Shi</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Research Centre for Plant RNA Signaling, College of Life and Environmental Sciences, Hangzhou Normal University, Hang-zhou, China</addr-line></aff><aff id="aff3"><addr-line>Research Centre for Plant RNA Signaling, College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, China</addr-line></aff><aff id="aff2"><addr-line>Institute of Horticulture, Zhejiang Academy of Agricultural Sciences, Hangzhou, China</addr-line></aff><pub-date pub-type="epub"><day>30</day><month>11</month><year>2021</year></pub-date><volume>12</volume><issue>12</issue><fpage>1791</fpage><lpage>1799</lpage><history><date date-type="received"><day>4,</day>	<month>November</month>	<year>2021</year></date><date date-type="rev-recd"><day>19,</day>	<month>December</month>	<year>2021</year>	</date><date date-type="accepted"><day>22,</day>	<month>December</month>	<year>2021</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  This is the first systematic investigation of viral pathogens in 
  Vitis 
  vinifera from Hangzhou vicinity of China. About 7 viruses and 5 viroids were annotated from four production bases “Dushicun”, “Wangjiayuan”, “Xiajiangcun”, and “Yangducun” covering 15 cultivars through sRNAseq technique. At least 3 viruses
  —grapevine leaf roll-associated virus 3 (GLRaV-3), grapevine fleck 
  virus (GFkV) and grapevine geminivirus A (GGVA), and 4 viroids—hop stunt viroid (HSVd), citrus viroid II (CVd-II), grapevine yellow speckle viroid 1 (GYSVd-1) and grapevine yellow speckle viroid 2 (GYSVd-2) infected all four bases. “Yangducun” base showed 11, the most infected pathogens. GYSVd-1 showed the highest accumulation in host of Wangjiayuan base. The main in
  fected pathogens were verified by reverse-transcription polymerase chain reaction (RT-PCR) technique, the detected rate reached to 85% - 100%. The results provide an important basis for effective and precise detection of viral diseases in the area and for the virus-free cultivation in future.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Vitis vinifera&lt;/i&gt;</kwd><kwd> Viral Disease</kwd><kwd> Small RNA Deep Sequencing</kwd><kwd> RT-PCR</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The Hangzhou vicinity of Zhejiang Province is one of the main table grape-producing areas in southern China, which is distributed mainly in “Wangjiayuan”, “Xiajiangcun”, “Dushicun”, and “Yangducun” four production bases covering about 15 cultivars including “Summer Black”, “Shine-Muscat” and stock “Beta” with a total cultivation area of 2000 acres approximately. Nevertheless, viral diseases commonly infect in these bases with the field symptoms of yellowing, mottled, chlorotic, or shrunken leaves, malformed fruit size, and even whole plant death because of the spreading of scion, rootstock, seedlings and agronomic operations. Systematic investigation of viral pathogens in local district has not been performed yet, except characteristics of biology and genome for certain virus such as grapevine fan leaf virus (GFLV) which was once spread widely near two decades ago [<xref ref-type="bibr" rid="scirp.114059-ref1">1</xref>] and viral infections in certain cultivar [<xref ref-type="bibr" rid="scirp.114059-ref2">2</xref>].</p><p>Even if more than 80 grapevine viruses have been reported worldwide up to now [<xref ref-type="bibr" rid="scirp.114059-ref3">3</xref>], many of them have mixed infection to the host [<xref ref-type="bibr" rid="scirp.114059-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.114059-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.114059-ref5">5</xref>]. Small RNA deep sequencing (sRNA-seq) that has upended the classical detection approaches of plant viruses makes analysis of the whole pathogens in affected host possible [<xref ref-type="bibr" rid="scirp.114059-ref5">5</xref>]. It was applied in virus diagnostic field of various grapevine cultivars and rootstock worldwide recent decade. Besides, the prevalent viral agents, grapevine vein clearing virus [<xref ref-type="bibr" rid="scirp.114059-ref6">6</xref>], grapevine gray norovirus [<xref ref-type="bibr" rid="scirp.114059-ref7">7</xref>], grapevine red leaf-associated virus, grapevine red blotch virus and citrus exocortis viroid [<xref ref-type="bibr" rid="scirp.114059-ref8">8</xref>], grapevine geminivirus A [<xref ref-type="bibr" rid="scirp.114059-ref9">9</xref>], grapevine berry inner necrosis virus and grapevine leaf-roll associated virus 13 [<xref ref-type="bibr" rid="scirp.114059-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.114059-ref11">11</xref>], grapevine hammerhead viroid [<xref ref-type="bibr" rid="scirp.114059-ref12">12</xref>], citrus cachexia viroid new strains [<xref ref-type="bibr" rid="scirp.114059-ref2">2</xref>], grapevine virus H [<xref ref-type="bibr" rid="scirp.114059-ref13">13</xref>], grapevine asteroid mosaic-associated virus [<xref ref-type="bibr" rid="scirp.114059-ref14">14</xref>], grapevine rupestris vein feathering virus [<xref ref-type="bibr" rid="scirp.114059-ref15">15</xref>], grapevine red globe virus [<xref ref-type="bibr" rid="scirp.114059-ref16">16</xref>], grapevine Kizil Sapak virus [<xref ref-type="bibr" rid="scirp.114059-ref17">17</xref>] and grapevine associated Jivivirus 1 [<xref ref-type="bibr" rid="scirp.114059-ref18">18</xref>] were detected in different grapevine cultivars and vicinities worldwide in succession by sRNA-seq.</p><p>In this research, small RNA deep sequencing and molecular validation were applied to systematically study the distribution and types of viral disease in the four grapevine bases above in order to offer valuable information and effective approach of diagnostic and further control for local institution of inspection and quarantine, researchers and farmers.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Sample Collection</title><p>Chlorosis, yellowing, mottling or shrinking leaves were collected from four grapevine basses separately. Leaf samples from same base were mixed together and ground into a powder in liquid nitrogen, and stored in a freezer at −80˚C for further use.</p></sec><sec id="s2_2"><title>2.2. sRNA-seq</title><p>Small RNA extraction, cDNA library construction and deep sequencing were performed on BGISEQ-500 sequencing platform in Huada Gene Co., Ltd. (Shenzhen, China). The quality of sequencing was evaluated using Q20 (the ratio of the number of nucleotides with a quality value greater than 20 to the total number of nucleotides in the sample). Scalable Vector Graphics (SVG) drawing tool was applied to remove 5' and 3' adapter-linked, polyA-containing reads, less than 18 nt-tags, and the Vitis vinifera genome-related sRNAs.</p></sec><sec id="s2_3"><title>2.3. Data Analysis</title><p>The remaining sRNA sequences were compared with the viral genome database (https://www.ncbi.nlm.nih.gov/genome/viruses) using Bowtie2 software. All viral genome related sRNA and their antisense reading counts were analyzed using SVG drawing tool. The major virus pathogens were found from the high coverage of that, and TPM (transcripts per million RNA tags) showed the viral proliferation in the infected host.</p></sec><sec id="s2_4"><title>2.4. Validation by RT-PCR</title><p>Primers were designed from genomic information of NCBI, which partially resembled our former designation [<xref ref-type="bibr" rid="scirp.114059-ref2">2</xref>] (<xref ref-type="table" rid="table1">Table 1</xref>). Total RNA from symptomatic frozen leave power of four bases was extracted respectively using OmniPlant RNA Kit (Kangwe1i Century Bio-Tech. Co., Ltd.). cDNA was synthesized using M-MLV reverse transcriptase (200 U/&#181;l) (Promega). PCR was amplified using PrimeSTAR HS DNA Polymerase (2.5 U/&#181;l) with the reaction condition of initial denaturation at 95˚C for 5 min, followed by 40 cycles of 95˚C for 30 s, 58˚C for 30 s, and 72˚C for 30 s, and then final extension at 72˚C for 10 min. 3 &#181;L PCR product with 6&#215; loading buffer was loaded in agarose gel electrophoresis at 150 volts and detected under UV light.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Designed primer pairs for amplifying main viral pathogens</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Viruses/Viroids</th><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequence (5' - 3')</th><th align="center" valign="middle" >Tm (˚C)</th><th align="center" valign="middle" >Position in genome and Size (bp)</th><th align="center" valign="middle" >Referenced from</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >grapevine fleck virus</td><td align="center" valign="middle" >GFkV-CP-F</td><td align="center" valign="middle" >TGCCGCCTCTCCGTCTGCTGA</td><td align="center" valign="middle"  rowspan="2"  >58</td><td align="center" valign="middle"  rowspan="2"  >6435 - 6729 (295)</td><td align="center" valign="middle"  rowspan="2"  >NC003347.1</td></tr><tr><td align="center" valign="middle" >GFkV-CP-R</td><td align="center" valign="middle" >GGCGGAGGAGGCAGTGGGTTG</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >grapevine leave roll-associated virus 3</td><td align="center" valign="middle" >GLRaV3-CP-F</td><td align="center" valign="middle" >CGGCACAAGGAAAATTTAGT</td><td align="center" valign="middle"  rowspan="2"  >58</td><td align="center" valign="middle"  rowspan="2"  >13,345 - 13624 (280)</td><td align="center" valign="middle"  rowspan="2"  >NC004667.1</td></tr><tr><td align="center" valign="middle" >GLRaV3-CP-R</td><td align="center" valign="middle" >ATTCCCTTGCCCATAGTCTTC</td></tr><tr><td align="center" valign="middle"  rowspan="4"  >grapevine geminivirus A</td><td align="center" valign="middle" >GGVA-AC-F</td><td align="center" valign="middle" >CAGTATCTTCTGAGGCACGA</td><td align="center" valign="middle"  rowspan="2"  >58</td><td align="center" valign="middle"  rowspan="2"  >1715 - 2417 (703)</td><td align="center" valign="middle"  rowspan="2"  >NC031340.1</td></tr><tr><td align="center" valign="middle" >GGVA-AC-R</td><td align="center" valign="middle" >GCTAACGACGCTTATGCTGA</td></tr><tr><td align="center" valign="middle" >GGVA-AV-F</td><td align="center" valign="middle" >AAGAGGAAATCTTTCGCACC</td><td align="center" valign="middle"  rowspan="2"  >58</td><td align="center" valign="middle"  rowspan="2"  >464 - 1031 (568)</td><td align="center" valign="middle"  rowspan="2"  >NC031340.1</td></tr><tr><td align="center" valign="middle" >GGVA-AV-R</td><td align="center" valign="middle" >AATTGACTCGATTACGACCAG</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >hop stunt viroid</td><td align="center" valign="middle" >HSVd-F</td><td align="center" valign="middle" >CGAGAGGCGTAGGAGAGAGG</td><td align="center" valign="middle"  rowspan="2"  >58</td><td align="center" valign="middle"  rowspan="2"  >105 - 282 (178)</td><td align="center" valign="middle"  rowspan="2"  >NC001351.1</td></tr><tr><td align="center" valign="middle" >HSVd-R</td><td align="center" valign="middle" >GCGGCAGAGGCTTAGATAGAC</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >grapevine yellow speckle viroid 1</td><td align="center" valign="middle" >GYSVd1-F</td><td align="center" valign="middle" >CTCCGGATCTTCTTGCTTGTG</td><td align="center" valign="middle"  rowspan="2"  >58</td><td align="center" valign="middle"  rowspan="2"  >2 - 284 (283)</td><td align="center" valign="middle"  rowspan="2"  >GU170805.1</td></tr><tr><td align="center" valign="middle" >GYSVd1-R</td><td align="center" valign="middle" >GAGACCAAGTCCGCTCGAC</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >grapevine yellow speckle viroid 2</td><td align="center" valign="middle" >GYSVd2-F</td><td align="center" valign="middle" >AGATGCCTCCGCTAGTCGAG</td><td align="center" valign="middle"  rowspan="2"  >58</td><td align="center" valign="middle"  rowspan="2"  >242 - 130 (250)</td><td align="center" valign="middle"  rowspan="2"  >NC003612.1</td></tr><tr><td align="center" valign="middle" >GYSVd2-R</td><td align="center" valign="middle" >GCCAGCTCTTCGGAATGCACC</td></tr></tbody></table></table-wrap></sec></sec><sec id="s3"><title>3. Results</title><p>A total of 28,670,274 to 29,695,410 small RNAs and 25,945,095 to 27,251,686 clean reads were obtained by small RNA sequencing. The results showed that the Q20 ratio was 98.30%, indicating that the data quality was reliable and the sequencing accuracy was high. It was found that small RNAs detected from 4 bases were mainly between 18 and 32 nt in length. The most abundant category was those 25 nt in length, accounting for 30% - 40% of the total (<xref ref-type="fig" rid="fig1">Figure 1</xref>). The proportion of GC in small RNA was 51% in average.</p><p>After the genome sequences from Vitis vinifera were excluded from clean reads, the left ones were compared to that of viral pathogens in the NCBI database. The copy number of small RNAs matching to that of viral genome was between 680,968 to 1,141,358, accounting for 2.70% to 4.37%, and Wangjiayuan appeared the most. Furthermore, the number of variant small RNAs matching to the viral genome was between 51,041 to 73,939 accounting for 1.08% - 1.85% of the total variant number respectively, while Yangducun showed the most (<xref ref-type="table" rid="table2">Table 2</xref>).</p><p>These sense and antisense small RNAs were mainly related to 12 viral pathogens (including 5 viroids), which share more than 85% genome coverage rate. Among them, GFkV, GLRaV-3, GFV, HSVd, GYSVd-1, GYSVd-2 and CVd-II infected all 4 production bases. Yangdu base has at least 11, the most viral pathogen infection (<xref ref-type="table" rid="table3">Table 3</xref>). GYSVd-1 appeared the most pathogen accumulation in the host of all 4 bases, and in Wangjiayuan base it showed 17,485.19, the highest TPM (<xref ref-type="table" rid="table4">Table 4</xref>).</p><p>RT-PCR clearly confirmed and verified the co-infection of these viruses and viroids which have high coverage rate with sRNA tags and high pathogen accumulation in their grapevine host from 4 production bases (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="fig" rid="fig3">Figure 3</xref>). The detection rate covers from 85% - 100%.</p></sec><sec id="s4"><title>4. Discussion</title><p>China is one of the largest countries for table grapevine production and consumption with the planting area of more than 1.65 million acres. Hangzhou city of Zhejiang province is one of the most important production district in southern China. With the continuous expansion of crop trade, the introduction and</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Data analysis on mapped sRNAs to that of viral pathogens</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sample name</th><th align="center" valign="middle" >Total sRNAs excluding vitis vinifera</th><th align="center" valign="middle" >Total sRNAs mapping to that of viral genome</th><th align="center" valign="middle" >Percentage of total sRNAs mapping to virus genome (%)</th><th align="center" valign="middle" >Unique sRNAs excluding vitis vinifera</th><th align="center" valign="middle" >Unique sRNAs mapping to virus genome</th><th align="center" valign="middle" >Percentage of unique sRNAs mapping to virus genome (%)</th></tr></thead><tr><td align="center" valign="middle" >dushicun</td><td align="center" valign="middle" >26,213,378</td><td align="center" valign="middle" >723,601</td><td align="center" valign="middle" >2.76</td><td align="center" valign="middle" >3,670,165</td><td align="center" valign="middle" >57,776</td><td align="center" valign="middle" >1.57</td></tr><tr><td align="center" valign="middle" >wangjiayuan</td><td align="center" valign="middle" >26,088,883</td><td align="center" valign="middle" >1,141,358</td><td align="center" valign="middle" >4.37</td><td align="center" valign="middle" >4,523,954</td><td align="center" valign="middle" >64,724</td><td align="center" valign="middle" >1.43</td></tr><tr><td align="center" valign="middle" >xiajiangcun</td><td align="center" valign="middle" >25,221,072</td><td align="center" valign="middle" >680,968</td><td align="center" valign="middle" >2.70</td><td align="center" valign="middle" >4,713,028</td><td align="center" valign="middle" >51,041</td><td align="center" valign="middle" >1.08</td></tr><tr><td align="center" valign="middle" >yangducun</td><td align="center" valign="middle" >25,551,606</td><td align="center" valign="middle" >711,270</td><td align="center" valign="middle" >2.78</td><td align="center" valign="middle" >3,999,810</td><td align="center" valign="middle" >73,939</td><td align="center" valign="middle" >1.85</td></tr></tbody></table></table-wrap><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> 12 Viral pathogens with more than 85% coverage rate of sRNAs through RNAseq from 4 production bases</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >NCBI code</th><th align="center" valign="middle" >Viral pathogens</th><th align="center" valign="middle" >Coverage rate with sRNA tags (%)</th><th align="center" valign="middle" >Dushicun</th><th align="center" valign="middle" >WangJiayuan</th><th align="center" valign="middle" >XiaJiangcun</th><th align="center" valign="middle" >Yangducun</th></tr></thead><tr><td align="center" valign="middle" >NC_003347.1</td><td align="center" valign="middle" >Grapevine fleck virus</td><td align="center" valign="middle" >86.6 - 90.2</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >NC_031340.1</td><td align="center" valign="middle" >Grapevine geminivirus A</td><td align="center" valign="middle" >98.2 - 99.6</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >NC_004667.1</td><td align="center" valign="middle" >Grapevine leafroll-associated virus 3</td><td align="center" valign="middle" >91.6 - 98.2</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >NC_039072.1</td><td align="center" valign="middle" >Grapevine fabavirus</td><td align="center" valign="middle" >94.2 - 96.7</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >NC_011106.1</td><td align="center" valign="middle" >Grapevine virus E</td><td align="center" valign="middle" >90.5</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >NC_001948.1</td><td align="center" valign="middle" >Rupestris stem pitting associated virus</td><td align="center" valign="middle" >93.2</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >NC_015782.1</td><td align="center" valign="middle" >Grapevine pinot gris virus</td><td align="center" valign="middle" >90.2</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >NC_001351.1</td><td align="center" valign="middle" >Hop stunt viroid</td><td align="center" valign="middle" >95.7 - 97.0</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >NC_001920.1</td><td align="center" valign="middle" >Grapevine yellow speckle viroid 1</td><td align="center" valign="middle" >99.5 - 99.7</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >AF_434679.1</td><td align="center" valign="middle" >Citrus viroid II</td><td align="center" valign="middle" >93.0 - 95.0</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >NC_003612.1</td><td align="center" valign="middle" >Grapevine yellow speckle viroid-2</td><td align="center" valign="middle" >99.5 - 99.7</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >AY513267.1</td><td align="center" valign="middle" >Citrus cachexia viroid</td><td align="center" valign="middle" >85.3 - 94.3</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td></tr></tbody></table></table-wrap><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Viral pathogens with more than 4500 TPM accumulation in 4 bases</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Viruses/Viroids</th><th align="center" valign="middle" >Dushicun</th><th align="center" valign="middle" >Wangjiayuan</th><th align="center" valign="middle" >Xiajiangcun</th><th align="center" valign="middle" >Yangducun</th></tr></thead><tr><td align="center" valign="middle" >Grapevine fleck Virus</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >4720.94</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Grapevine geminivirus A</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >4546.37</td></tr><tr><td align="center" valign="middle" >Grapevine yellow speckle viroid 1</td><td align="center" valign="middle" >9480.47</td><td align="center" valign="middle" >17485.19</td><td align="center" valign="middle" >13567.54</td><td align="center" valign="middle" >9442.97</td></tr><tr><td align="center" valign="middle" >Grapevine yellow speckle viroid-2</td><td align="center" valign="middle" >5975.08</td><td align="center" valign="middle" >13375.85</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >5945.81</td></tr></tbody></table></table-wrap><p>-: TPM (transcripts per million RNA tags) &lt; 4500.</p><p>transportation of grapevine seedlings, scions and rootstocks required for grafting cultivation, and cultivation approaches have made possible for the transmission and mixed infection of grapevine viral diseases. These detected viral pathogens are also conventional and infect frequently in other grapevine yards worldwide [<xref ref-type="bibr" rid="scirp.114059-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.114059-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.114059-ref20">20</xref>].</p><p>Yangducun base is one of the regional test stations for grapevine cultivars in national grape production system, where more than 200 idioplasmatic resources from home and abroad are conserved, and more than 10 local new-bred cultivars in “TIANGONG” series are obtained. Frequent and certain scale of breeding and cultivar introduction have increased the risk of infection and transmission of viral pathogens, which also explains the relative largest number of co-infected virus diseases in this base. Therefore, it is particularly important to strengthen the precise detection, isolate affected plants and prevent the spreading of diseases.</p><p>GYSVd-1 is one of the most common viroids infecting grapevine worldwide, and often mixed-infect with GYSVd-2 and other viral pathogens. This viroid shows higher activity and proliferation in host of all 4 local bases, especially in Wangjiayuan base, which needs to be paid greater attention to.</p></sec><sec id="s5"><title>5. Conclusion</title><p>The research is the first systematic investigation in molecular level for grapevine viral pathogens in local bases. At least 7 viruses and 5 viroids were annotated in four production bases, among them, 3 viruses (GFkV, GGVA, GLRaV-3) and 4 viroids (HSVd, GYSVd-1, GYSVd-2, CVd-II) are the main co-infected viral pathogens distributed evenly in 4 local vicinities at present. The results not only will lay an important foundation for the precise detection of important viral diseases in future seedling exchange process and virus-free tissue culture, and provide preliminary valuable data support for promoting the standardized cultivation technology and grape fruit high-quality production.</p></sec><sec id="s6"><title>Acknowledgements</title><p>We thank the National Key R&amp;D Program of China (2017YFE0110900) and the Free-Application Program on Agricultural Sciences from Hangzhou Sci-Tech Bureau (20180432B01) for financial support of this work.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>Li, H.M., Wei, L.Z., Wu, J. and Shi, N.N. (2021) Investigation on Viral Pathogens in Vitis vinifera from Four Production Bases in Hangzhou Vicinity of China by sRNAseq and Molecular Validation. American Journal of Plant Sciences, 12, 1791-1799. https://doi.org/10.4236/ajps.2021.1212125</p></sec><sec id="s9"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.114059-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Li, H.Y., Zhou, X.P., Hong, J. and Chen, L.G. (2002) Accumulation Dynamics and Immune-Gold Location of Movement Protein of GFLV-H in Vivo of Chenopodium amaranticolar and C. quinoa. Acta Microbiologica Sinica, 42, 550-554. (in Chinese)</mixed-citation></ref><ref id="scirp.114059-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Li, H.M., Wei, L.Z., Qin, C., Cheng, J.H., Zhang, X., Chen, W.W., Lai, T.F., Yu, Z.M., Zhang, P.C., Wu, J., Hong, Y.G. and Shi, N.N. (2021) Characterization of Viruses and Viroids in Vitis vinifera “Kyoho” in Hangzhou China by Small RNA Deep Sequencing and Molecular Detection. Journal of Horticultural Science &amp; Biotechnology, 96, 400-406. https://doi.org/10.1080/14620316.2020.1845985</mixed-citation></ref><ref id="scirp.114059-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Demian, E., Jaksa-Czotter, N., Molnar, J., Tusnady, G.E., Kocsis, L. and Varallyay, E. (2020) Grapevine Rootstocks Can Be a Source of Infection with On-Regulated Viruses. European Journal of Plant Pathology, 156, 897-912.  
https://doi.org/10.1007/s10658-020-01942-w</mixed-citation></ref><ref id="scirp.114059-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Fan, X.D. (2016) Identification and Molecular Characteristics of Viruses from Grapevines Caused Leafroll and Ringspot. PhD Thesis, Huazhong Agricultural University, Wuhan. (in Chinese)</mixed-citation></ref><ref id="scirp.114059-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Fan, X.D., Dong, Y.F., Zhang, Z.P., Zhang, M.Y., Ren, F. and Hu, G.J. (2019) Small RNA Sequencing and RT-PCR Detection of Viruses Infecting “Shine Muscat” Grapevines. Acta Phytopathologica Sinica, 49, 749-755. (in Chinese)</mixed-citation></ref><ref id="scirp.114059-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, Y., Singh, K., Kaur, R. and Qiu, W.P. (2011) Association of a Novel DNA virus with the Grapevine Vein-Clearing and Vine Decline Syndrome. Phytopathology, 101, 1081-1090. https://doi.org/10.1094/PHYTO-02-11-0034</mixed-citation></ref><ref id="scirp.114059-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Giampetruzzi, A., Roumi, V., Roberto, R., Malossini, U., Yoshikawa, N., La Notte, P., Terlizzi, F., Credi, R. and Saldarelli, P. (2012) A New Grapevine Virus Discovered by Deep Sequencing of Virus- and Viroid-Derived Small RNAs in Cv. Pinot gris. Virus Research, 163, 262-268. https://doi.org/10.1016/j.virusres.2011.10.010</mixed-citation></ref><ref id="scirp.114059-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Poojari, S., Alabi, O.J., Fofanov, V.Y., Naidu, R.A. and Martin, D.P. (2013) A leafhopper Transmissible DNA Virus with Novel Evolutionary Lineage in the Family Geminiviridae Implicated in Grapevine Redleaf Disease by Next-Generation Sequencing. PLoS ONE, 8, Article ID: e64194.  
https://doi.org/10.1371/journal.pone.0064194</mixed-citation></ref><ref id="scirp.114059-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Ma, Y.X. and Li, S.F. (2016) Application of Next-Generation Sequencing Technology in Identification of Geminiviruses from Woody Plants. Plant Protection, 42, 1-10.</mixed-citation></ref><ref id="scirp.114059-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Fan, X.D., Zhang, Z.P., Ren, F., Hu, G.J., Li, Z.N., Zhang, S.N. and Dong, Y.F. (2018) Complete Genome Sequence Analysis of Grapevine Berry Inner Necrosis Virus Type 1 Isolate. Acta Phytopathologica Sinica, 48, 423-427. (in Chinese)</mixed-citation></ref><ref id="scirp.114059-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Fan, X.D., Zhang, Z.P., Ren, F., Hu, G.J. and Done, Y.F. (2019) First Report of Grapevine Leafroll-Associated Virus 13 in Grapevines in China. Acta Phytopathologica Sinica, 49, 141-144.(in Chinese)</mixed-citation></ref><ref id="scirp.114059-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Pappi, P.G., Efthimiou, K., Lotos, L., Katis, N.I. and Maliogka, V.I. (2020) First Report of Grapevine Hammerhead Viroid-Like RNA (GHVd) in Grapevine in Greece. Journal of Plant Pathology, 102, 257. https://doi.org/10.1007/s42161-019-00393-5</mixed-citation></ref><ref id="scirp.114059-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Hu, R.B., Dias, N.P., NourolahV.A., Jose, A.H., Darrell, P., Keith, L.D., Leslie, L.H. and Hajimorad, M.R. (2021) Cultivated and Wild Grapevines in Tennessee Possess Overlapping but Distinct Virus Populations. Plant Disease.  
https://doi.org/10.1094/PDIS-11-20-2483-SC</mixed-citation></ref><ref id="scirp.114059-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Thompson, J.R., Gomez, A.L., Younas, A., Gonzalez-Tobon, J., Cha, A., Perry, K.L., et al. (2021) Grapevine Asteroid Mosaic-Associated Virus Is Resident and Prevalent in Wild, Noncultivated Grapevine of New York State. Plant Disease, 105, 758-763.  
https://doi.org/10.1094/PDIS-10-20-2191-SC</mixed-citation></ref><ref id="scirp.114059-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Wu, Q., Kehoe, M.A., Kinoti, W.M., Wang, C.P., Rinaldo, A., Tyerman, S., Habili, N. and Constable, F.E. (2021) First Report of Grapevine Rupestris Vein Feathering Virus in Grapevine in Australia. Plant Disease, 105, 515.  
https://doi.org/10.1094/PDIS-06-20-1240-PDN</mixed-citation></ref><ref id="scirp.114059-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Jarugula, S., Chingandu, N., Adiputra, J., Bagewadi, B., Adegbola, R., Thammina, C. and Naidu, R. (2021) First Report of Grapevine Red Globe Virus in Grapevines in Washington State. Plant Disease, 105, 717.  
https://doi.org/10.1094/PDIS-07-20-1609-PDN</mixed-citation></ref><ref id="scirp.114059-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Ren, F., Zhang, Z.P., Fan, X.D., Hu, G.J. and Dong, Y.F. (2021) First Report of Grapevine Kizil Sapak Virus in Grapevine in China. Plant Disease, 105, 1-3.  
https://doi.org/10.1094/PDIS-02-21-0340-PDN</mixed-citation></ref><ref id="scirp.114059-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Silva, J.M.F., Fajardo, T.V.M., Al Rwahnih, M. and Nagata, T. (2021) First Report of Grapevine Associated Jivivirus 1 Infecting Grapevines in Brazil. Plant Disease, 105, 514. https://doi.org/10.1094/PDIS-08-20-1689-PDN</mixed-citation></ref><ref id="scirp.114059-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Alan, J.C. (2011) Subviral Agents: Genomes without Viruses, Viruses without Genomes—Principles of Molecular Virology. 5th Edition, Elsevier, Oxford, UK, 256-258, 303.</mixed-citation></ref><ref id="scirp.114059-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Martelli, G.P., Abou, G.S.N., Agranovsky, A.A., Al, R.M., Dolja, V.V., Dovas, C., Fuchs, M., Gugerli, P., Hu, J.S., Jelkmann, W., Katis, N.I., Maliogka, V.I., Melzer, M.J., Menzel, W., Minafra, A., Rott, M.E., Rowhani, A., Sabanadzovic, S. and Saldarelli, P. (2012) Taxonomic Revision of the Family Closteroviridae with Special Reference to the Grapevine Leafroll-Associated Members of the Genus Ampelovirus and the Putative Species Unassigned to the Family. Journal of Plant Pathology, 94, 7-19.</mixed-citation></ref></ref-list></back></article>