<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AS</journal-id><journal-title-group><journal-title>Agricultural Sciences</journal-title></journal-title-group><issn pub-type="epub">2156-8553</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/as.2021.128054</article-id><article-id pub-id-type="publisher-id">AS-111203</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Isolation and Functional Characterization of a B3 Transcription Factor Gene &lt;i&gt;FUSCA3&lt;/i&gt; Involved in Pre-Harvest Sprouting Resistance in Wheat
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xinguo</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lili</surname><given-names>Liu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yanli</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xiaodan</surname><given-names>Meng</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yumei</surname><given-names>Jiang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yongchun</surname><given-names>Li</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lei</surname><given-names>Li</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jiangping</surname><given-names>Ren</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>National Engineering Research Center for Wheat, Zhengzhou, China</addr-line></aff><aff id="aff1"><addr-line>College of Agronomy, Agricultural University of Henan, Zhengzhou, China</addr-line></aff><pub-date pub-type="epub"><day>03</day><month>08</month><year>2021</year></pub-date><volume>12</volume><issue>08</issue><fpage>844</fpage><lpage>862</lpage><history><date date-type="received"><day>12,</day>	<month>July</month>	<year>2021</year></date><date date-type="rev-recd"><day>8,</day>	<month>August</month>	<year>2021</year>	</date><date date-type="accepted"><day>11,</day>	<month>August</month>	<year>2021</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Pre-harvest sprouting (PHS) reduces yields and grain quality, resulting in seriously economic losses in wheat. It has been showed that PHS is significantly correlated to seed dormancy levels. 
  <em>FUSCA3</em> (
  <em>FUS3</em>) gene is considered to be the key regulator of seed dormancy. However, little information is available about the function of 
  <em>FUS3</em> gene (
  <em>TaFUS3</em>) in wheat. In this study, three homologous genes were identified in wheat grain, and their functions were investigated by gene silencing. Three full-length DNA (3477, 3534 and 3501 bp) and cDNA (1015, 1012 and 1015 bp) sequences encoding a B3 transcription factor, designated 
  <em>TaFUS3-3A</em>, 
  <em>TaFUS3-3B</em> and 
  <em>TaFUS3-3D</em>, were first isolated from common wheat. The transcription of three 
  <em>TaFUS3</em> genes in seed development and germination process was detected.
  <em> TaFUS3-3B</em> and
  <em> TaFUS3-3D</em> had similar expression profiles, and high levels of gene transcripts were detected in seeds at 25 DAP (days after pollination) and after 24 h of imbibition. However, the transcription of 
  <em>TaFUS3-3A </em>was not detected. Silencing of 
  <em>TaFUS3</em> in common wheat spikes resulted in increased seed germination and PHS. Compared with wild-type, the 
  <em>TaFUS3</em>-silenced plants showed increased expression of genes related to GA biosynthesis and ABA metabolism, and decreased expression of genes associated with ABA biosynthesis. Moreover, silencing of 
  <em>TaFUS3</em> in wheat plants led to a decrease in embryo sensitivity to ABA and changed the expression of genes involved in ABA signal transduction. The results of gene silencing indicated that
  <em> TaFUS3</em> plays a positive role in wheat seed dormancy and PHS-resistance, which might be associated with ABA, GA level and signal transduction.
 
</p></abstract><kwd-group><kwd>Wheat (&lt;i&gt;Triticum aestivum&lt;/i&gt; L.)</kwd><kwd> &lt;i&gt;FUSCA3&lt;/i&gt;</kwd><kwd> Molecular Cloning</kwd><kwd> Virus-Induced Gene Silencing (VIGS)</kwd><kwd> Pre-Harvest Sprouting</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Pre-harvest sprouting (PHS) denotes grains germinating on the mother plants when they are subjected to the rainy and humid environment prior to harvest [<xref ref-type="bibr" rid="scirp.111203-ref1">1</xref>]. PHS of wheat grains not only causes the decline in grain yield, but also affects the end-use quality of the grain, resulting in severe economic losses [<xref ref-type="bibr" rid="scirp.111203-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref3">3</xref>]. PHS is a worldwide problem. In some wheat-growing countries, such as the United States, Canada, Australia, and Japan, the problems associated with PHS occur frequently [<xref ref-type="bibr" rid="scirp.111203-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref7">7</xref>]. In China, heavy PHS sometimes occurs on &gt;83% of the wheat acreage [<xref ref-type="bibr" rid="scirp.111203-ref8">8</xref>]. Therefore, increasing resistance to PHS is an important current objective in improving wheat varieties.</p><p>Wheat PHS is a complex quantitative trait regulated by multiple genes [<xref ref-type="bibr" rid="scirp.111203-ref9">9</xref>]. Many studies have shown that seed dormancy level is one of the main factors determining the resistance to PHS in wheat [<xref ref-type="bibr" rid="scirp.111203-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref10">10</xref>]. Seed dormancy is finely controlled by the seed maturation program, and ABA plays a key role in regulating seed dormancy [<xref ref-type="bibr" rid="scirp.111203-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref12">12</xref>]. Genetic and molecular studies have shown that many of the genes participating in seed dormancy are known to be involved in ABA synthesis and signal transduction [<xref ref-type="bibr" rid="scirp.111203-ref10">10</xref>]. Studies in Arabidopsis showed that seed dormancy and germination were controlled by at least four major regulators, namely ABA INSENSITIVE3 (ABI3), FUSCA3 (FUS3), LEAFY COTYLEDON2 (LEC2), and LEAFY COTYLEDON 1 (LEC1) [<xref ref-type="bibr" rid="scirp.111203-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref15">15</xref>]. ABI3, FUS3 and LEC2 are plant-specific genes, encoding transcription factor of the B3 domain family, whereas LEC1 encodes a HAP3 subunit of the CCAAT binding factor [<xref ref-type="bibr" rid="scirp.111203-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref19">19</xref>]. The loss-of-function mutants of these genes showed reduced accumulation of seed storage proteins and enhanced precocious germination of immature embryos [<xref ref-type="bibr" rid="scirp.111203-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref22">22</xref>]. Although these genes have similar functions, their expression patterns differ during seed development [<xref ref-type="bibr" rid="scirp.111203-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref24">24</xref>]. LEC1 and LEC2 are expressed during the first period of embryonic development, followed by FUS3 and finally by ABI3; all genes are active in the embryo, and LEC2 and FUS3 are active also in the endosperm [<xref ref-type="bibr" rid="scirp.111203-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref19">19</xref>]. Moreover, the spatio-temporal expressions of LEC2/ABI3/FUS3/LEC1 are transcriptionally cross-regulated and act together to control seed maturation and dormancy [<xref ref-type="bibr" rid="scirp.111203-ref25">25</xref>].</p><p>Recently, it has been demonstrated that FUS3 is a crucial molecular switch in regulating a transition from seed dormancy to germination [<xref ref-type="bibr" rid="scirp.111203-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref27">27</xref>]. FUS3 usually acts as both activator and repressor of seed germination and dormancy by interacting with hormone signaling and synthesis pathways [<xref ref-type="bibr" rid="scirp.111203-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref28">28</xref>]. It has been reported that FUS3 accumulates preferentially in the epidermis, vasculature and radicle tips of embryos. FUS3 expression is regulated by auxin [<xref ref-type="bibr" rid="scirp.111203-ref26">26</xref>]. The C-terminal domain (CTD) of FUS3 is responsible for instability of the FUS3 protein and is involved in hormone sensitivity [<xref ref-type="bibr" rid="scirp.111203-ref29">29</xref>]. During late seed maturation, FUS3 can promote dormancy and inhibit precocious germination of immature seeds by increasing ABA concentration and repressing GA biosynthesis genes. In addition, FUS3 protein is regulated by ABA and GA. The stability and concentration of the FUS3 are regulated negatively by ABA and positively by GA [<xref ref-type="bibr" rid="scirp.111203-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref30">30</xref>]. Similarly, during seed imbibition, FUS3 protein acts as a seed germination repressor through regulating ABA/GA ratio [<xref ref-type="bibr" rid="scirp.111203-ref31">31</xref>]. Furthermore, over-expression of Arabidopsis FUS3 increases the sensitivity to high temperature and delays seed germination due to a high ABA level [<xref ref-type="bibr" rid="scirp.111203-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref33">33</xref>]. These results indicated that FUS3 plays a critical role in inducing dormancy and inhibiting germination of seed by regulating ABA and GA levels.</p><p>Wheat is a globally important crop, accounting for 20% of the calories consumed by humans. Research that focuses on mechanisms of seed dormancy regulation at the molecular level is very important for accelerating the process of improving wheat varieties. Although the functions of FUS3 gene have been studied extensively in Arabidopsis, and putative orthologs have been described in several monocot species [<xref ref-type="bibr" rid="scirp.111203-ref34">34</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref35">35</xref>], FUS3 gene has not experimentally been proven to have a role in PHS tolerance in wheat, and wheat homologues for FUS3 have not been identified. Therefore, in this study, we isolated the sequences of TaFUS3 homoeologs in hexaploid wheat, analyzed the effect of silencing the FUS3 gene using the barley stripe mosaic virus (BSMV)-mediated virus-induced gene silencing (VIGS) technique. These research data will provide fundamental insight for future studies regarding the functions of FUS3 gene in seed dormancy and PHS.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Plant Materials and Growth Conditions</title><p>Wheat cultivar (Triticum aestivum L.) Huaimai 0360 (highly PHS-resistant cultivar), was used for this study. For gene cloning and expression experiments, 100 surface-sterilized seeds were germinated on moist filter paper in growth chambers at 25˚C under 12-h light/12-h dark conditions and transplanted into pots in a naturally lit glasshouse with standard irrigation and fertilization until mature. During this period, developing seeds were collected at 15, 20, 25, and 30 days after pollination (DAP). For germination, mature seeds were surface-sterilized and then imbibed on water moistened filter paper in Petri dishes in a temperature-controlled cultivation chamber (darkness at 25˚C). 3 - 5 seeds were collected at 0, 6, 12, 24, 36, and 48 h after imbibition commenced. All the collected plant samples were snap-frozen in liquid nitrogen immediately after harvesting and stored at −80˚C until use. Each treatment was repeated thrice.</p><p>For VIGS experiments, wheat cultivar Huaimai 0360 was grown in the agricultural and experimental field of Henan Agricultural University (Zhengzhou, China) during the wheat-growing season. The plot area was 15 m<sup>2</sup> (length 5.0 m &#215; width 3.0 m) and was watered and fertilized as needed throughout the growth period.</p><p>At anthesis, an arch shed (length 5.0 m &#215; width 3.0 m &#215; height 1.5 m) was built directly above the wheat plants according to the method described by Liu et al. [<xref ref-type="bibr" rid="scirp.111203-ref36">36</xref>]. One hundred wheat spikes in the same heading stage and of similar size were labeled. During 1 day before and after BSMV inoculation, the PVC plastic film was covered with soil to prevent water loss from affecting the spread of the virus. Developing grains in the middle of BSMV-infected spikes were collected at 21, 28, 35, and 45 days post inoculation (dpi) at 10:00 a.m., snap-frozen in liquid nitrogen and then stored at −80˚C for transcription analysis. At maturity, spikes of BSMV-infected wheat plants were harvested and stored at room temperature until use. Uniform spikes at the anthesis stage were used for BSMV-VIGS inoculation.</p></sec><sec id="s2_2"><title>2.2. Isolation of the Wheat FUS3 Homologues</title><p>Genomic DNA was isolated from seed at 15~30 DAP using the CTAB method. Gene specific primers TaFUS3-F (5’-TCC TCC GCC TTG ACC TCC T-3’) and TaFUS3-R (5’-CAA GGC TGG TGA CTC TGA ACT-3’) were designed based on the sequence of TaFUS3 [<xref ref-type="bibr" rid="scirp.111203-ref37">37</xref>] using Primer 5.0 software. The PCR was performed in an Applied Biosystems-2720 thermal cycler in total volumes of 50 μL, including 5 μL of 10 &#215; PCR buffer, 100 mM dNTP, 0.4 μM of each primer, 2.5 unit of Taq DNA polymerase (TIANGEN, Beijing), and 100 ng of template DNA. The PCR cycling conditions comprised an initial cycle at 95˚C for 3 min followed by 35 cycles of 94˚C for 30 s, annealing at 58˚C for 1 min and 72˚C for 2 min, with a final extension at 72˚C for 10 min. PCR products were separated by electrophoresis in 1.0% agarose gels. Targeted fragments of expected size were recovered and cloned into the pMD18-T vector. Selected 20 positive clones were sequenced by Henan Shangya Technology Co., Ltd. Sequence alignment was performed by using DNAMAN software. Chromosome locations of cloned sequences were identified at urgi (https://urgi.versailles.inra.fr/blast/blast.php).</p></sec><sec id="s2_3"><title>2.3. Functional Analysis by BSMV-VIGS</title><p>For VIGS experiments, a γRNA-based BSMV vector was utilized to silence FUS3 gene in wheat as described previously [<xref ref-type="bibr" rid="scirp.111203-ref38">38</xref>]. Since wheat is hexaploid, there are usually three copies of genes. To make TaFUS3 gene silenced completely, a 247 bp cDNA fragment from the wheat FUS3 gene that contains Nhe I sites was amplified with specific primers designed in the conserved regions of the three copies by Primer 5.0 software. The forward and reverse primers were 5’-GCG GGA GAT GAT CTA GTT GC-3’ and 5’-AAT CAC TGA ATG GGT CGA AGA-3’, respectively. Then, the amplified PCR products and the BSMV-γ empty vector were individually digested with restriction enzyme Nhe I. The digestion results were verified by agarose gel electrophoresis. The correct target fragments were ligated into the BSMV-γ empty vector and sequenced. The inserted clone in reverse was selected as the recombinant vector BSMV: TaFUS3 and subsequently used for gene silencing. For identifying wheat plants with the VIGS response, the BSMV: GFP was used as an infection control.</p><p>In vitro transcription of viral RNAs was carried out as described by Feng et al. [<xref ref-type="bibr" rid="scirp.111203-ref38">38</xref>]. The plasmids of BSMV-α, BSMV-β, BSMV-γ-derivative clones (BSMV-TaFUS3 and BSMV-GFP) were digested with restriction enzymes Mlu I and Spe I. Then, the linearized products were examined by electrophoresis. The correct linearized products were purified, and transcription was performed using a RiboMAX<sup>TM</sup> Large Scale RNA Production Systems-T7 kit (Promega, USA) following the manufacturer’s protocol. Transcripts of each of the BSMV plasmids were mixed in a 1:1:1 ratio and 22.5 volumes of FES buffer [<xref ref-type="bibr" rid="scirp.111203-ref39">39</xref>] were added to the transcript mixture. This mixture was then applied to the young wheat spikes by rub inoculation. 15 &#181;L of BSMV: TaFUS3 or BSMV: GFP transcript mixture was used for each spike. The details of the BSMV inoculation and wheat plant growth conditions were described by Liu et al. [<xref ref-type="bibr" rid="scirp.111203-ref36">36</xref>].</p></sec><sec id="s2_4"><title>2.4. Seed Germination and Spike Sprouting Test</title><p>180 wheat seeds from both the BSMV-TaFUS3 and BSMV-GFP plants (40 dpi) with uniform size and plumpness were surface sterilized in 70% alcohol for 1 min, and then in 0.1% HgCl<sub>2</sub> for 5 - 10 min and washed four times with sterile distilled water. Six groups (30 grains/group) were distributed on two layers of filter paper in a 9-cm Petri dish containing 10 mL of sterilized water, and germinated at 25˚C under continuous dark for 7 days. Three of them were used to investigate the germination rate and the other three groups were used for the expression analysis of ABA/GA synthetic and metabolic genes. The number of germinated seeds (radicle protruding through the seed coat) was recorded daily. Germination ratio refers to the number of germinated seed as a proportion of the total number of seeds. For the gene expression analysis, germinated seeds were harvested at 24, 48, 72, and 96 h snap-frozen in liquid nitrogen and stored at −80˚C for further analysis.</p><p>Spike sprouting tests were performed with intact spikes (40 and 45 dpi). Twelve spikes each from the BSMV-TaFUS3 and BSMV-GFP plant groups were surface sterilized in 0.1% HgCl<sub>2</sub> for 10 min, and washed four times with sterilized water, vertically inserted into a foam board (length 20 cm &#215; width 20 cm &#215; height 3 cm), and covered by a plastic film to prevent water loss. Water was sprayed once every 6 h. After 7 days, the test spikes were taken out and immediately threshed manually to record seed germination. The calculation method of germination rate was the same as for the seed germination test. In addition, the plumule and radicle length was measured on germinated seeds. All tests were performed in a climate chamber at 25˚C (24 h darkness).</p></sec><sec id="s2_5"><title>2.5. ABA Treatment</title><p>Seeds from BSMV-TaFUS3 and BSMV-GFP plants (40 dpi) were soaked in sterilized water for 4 h, and then the embryos were isolated with dissecting needles under aseptic conditions and were placed on two layers of filter paper in a 9 cm Petri dish containing 10 mL of sterilized water with 50 &#181;M ABA at 25˚C in darkness for 48 h. RNA was extracted from embryos after 0 and 48 h of treatment. The experiments were performed in triplicate.</p></sec><sec id="s2_6"><title>2.6. Quantitative Real-Time PCR (qRT-PCR)</title><p>The RNA extraction and the first strand cDNA synthesis were described in our previous study [<xref ref-type="bibr" rid="scirp.111203-ref40">40</xref>]. Based on the sequences of the genes, including TaFUS3-3A, TaFUS3-3B, TaFUS3-3D, TaNCED1, TaNCED2, TaCYP707A2, TaGA20ox-D4, TaGA20ox1d, TaABI3, TaABI4, TaABI5, TaPKABA1, and β-actin, specific primers were designed using Primer 5.0 software. The primer sequences and amplified product are provided in <xref ref-type="table" rid="table1">Table 1</xref>. The qRT-PCR analysis was performed with a SYBR Green quantitative RT-PCR kit (TaKaRa, Dalian, China) on a CFX connect real-time system (Bio-RAD, USA) following the manufacturer’s instructions. The expression level of each gene was determined using the comparative Ct method. Relative quantification for each gene was calculated by the 2<sup>−ΔΔCt</sup> method using wheat β-actin gene as an internal control [<xref ref-type="bibr" rid="scirp.111203-ref41">41</xref>].</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Isolation and Characterization of TaFUS3 Homologues in Wheat</title><p>Based on the known cDNA sequence of TaFUS3 gene, a pair of specific primers</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primer sequences for gene expression assay</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Gene</th><th align="center" valign="middle"  rowspan="2"  >GenBank No.</th><th align="center" valign="middle"  colspan="2"  >Primer sequence (5’ - 3’)</th><th align="center" valign="middle"  rowspan="2"  >Amplicon length (bp)</th></tr></thead><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >Reverse</td></tr><tr><td align="center" valign="middle" >TaFUS3-3A</td><td align="center" valign="middle" >MZ408248</td><td align="center" valign="middle" >GTGGCTGGGTTGCGAGTT</td><td align="center" valign="middle" >TGTTCGGCCAGTATCTGTTCC</td><td align="center" valign="middle" >196</td></tr><tr><td align="center" valign="middle" >TaFUS3-3B</td><td align="center" valign="middle" >MZ408249</td><td align="center" valign="middle" >GCCGAACAACAAGAGCAGG</td><td align="center" valign="middle" >GTGGTGGGATTAGAGACACATACTT</td><td align="center" valign="middle" >239</td></tr><tr><td align="center" valign="middle" >TaFUS3-3D</td><td align="center" valign="middle" >MZ408250</td><td align="center" valign="middle" >GTGGCTGGGTTGCGAGTTA</td><td align="center" valign="middle" >GTGCATTTAGCAAATCATGCGTA</td><td align="center" valign="middle" >160</td></tr><tr><td align="center" valign="middle" >TaFUS3-VIGS</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >CGAGATGTTTGATGGGATTTT</td><td align="center" valign="middle" >GGTTGGGAAACAAAGAAAGC</td><td align="center" valign="middle" >188</td></tr><tr><td align="center" valign="middle" >TaNCED1</td><td align="center" valign="middle" >JQ772528</td><td align="center" valign="middle" >GTCGGAGATGATGTGGGTG</td><td align="center" valign="middle" >CCGTGTCGTTGAAGATGGA</td><td align="center" valign="middle" >137</td></tr><tr><td align="center" valign="middle" >TaNCED2</td><td align="center" valign="middle" >LC077862</td><td align="center" valign="middle" >GTCGGAGATGGTGTGGGT</td><td align="center" valign="middle" >TCGTTGAAGATGGAGTCGG</td><td align="center" valign="middle" >132</td></tr><tr><td align="center" valign="middle" >TaCYP707A2</td><td align="center" valign="middle" >AB849504</td><td align="center" valign="middle" >CTGCCCCCTGGCTCCAT</td><td align="center" valign="middle" >GCCGTACCGCTTCTGCTT</td><td align="center" valign="middle" >102</td></tr><tr><td align="center" valign="middle" >TaGA20ox-D4</td><td align="center" valign="middle" >LN828669</td><td align="center" valign="middle" >GCGGCAGCAAAAACAAAT</td><td align="center" valign="middle" >GTCGACCACAGGCACGTC</td><td align="center" valign="middle" >94</td></tr><tr><td align="center" valign="middle" >TaGA20ox1d</td><td align="center" valign="middle" >FR716527</td><td align="center" valign="middle" >TCGCTGGAGATCATGGAG</td><td align="center" valign="middle" >GCACGGCGGGTAGTAGTT</td><td align="center" valign="middle" >114</td></tr><tr><td align="center" valign="middle" >TaABI3</td><td align="center" valign="middle" >DQ517494</td><td align="center" valign="middle" >CTGGTGACTTTGTTCGGTCC</td><td align="center" valign="middle" >TGGCATTCTTGTGCTTGG</td><td align="center" valign="middle" >138</td></tr><tr><td align="center" valign="middle" >TaABI4</td><td align="center" valign="middle" >AY781355</td><td align="center" valign="middle" >GGATGCTGCCCGTGCTTAT</td><td align="center" valign="middle" >TGAGTGGTTGGCTGATGTTGTAG</td><td align="center" valign="middle" >178</td></tr><tr><td align="center" valign="middle" >TaABI5</td><td align="center" valign="middle" >KX002276</td><td align="center" valign="middle" >TCCTGTGGTGGGTGCTGG</td><td align="center" valign="middle" >GCTGCTGTGAGGGTTGTGC</td><td align="center" valign="middle" >188</td></tr><tr><td align="center" valign="middle" >TaPKABA1</td><td align="center" valign="middle" >DQ343302</td><td align="center" valign="middle" >CCCTGATGAGCCAAGGAACT</td><td align="center" valign="middle" >CGGGACAGTAGATGTACGCAGT</td><td align="center" valign="middle" >111</td></tr><tr><td align="center" valign="middle" >β-actin</td><td align="center" valign="middle" >AB181991</td><td align="center" valign="middle" >TTTGAAGAGTCGGTGAAGGG</td><td align="center" valign="middle" >TTTCATACAGCAGGCAAGCA</td><td align="center" valign="middle" >196</td></tr></tbody></table></table-wrap><p>TaFUS3-F and TaFUS3-R were designed in the 5’ and 3’ non-coding regions, respectively, to amplify the complete gene DNA sequence from wheat cultivar “Huaimai 0360”. An amplicon of about 3500 bp was obtained. After sequencing, three genes, containing seven exons and six introns, and with sequence lengths of 3477, 3534 and, 3501 bp was obtained (<xref ref-type="fig" rid="fig1">Figure 1</xref>). The URGI BLAST analysis showed that the three sequences were highly similar to the, respectively, 3A, 3B and 3D sequences from the long arm of chromosome 3 in Chinese spring. So, the three TaFUS3 homologues were named TaFUS3-3A (GenBank accession MZ408248), TaFUS3-3B (GenBank accession MZ408249) and TaFUS3-3D (GenBank accession MZ408250), respectively. The corresponding cDNA sequences of TaFUS3-3A, TaFUS3-3B and TaFUS3-3D were 1015, 1012 and 1015 bp in length, and contained 906, 909 and 906 bp open reading frames (ORF), respectively. TaFUS3-3A, TaFUS3-3B and TaFUS3-3D were predicted to encode proteins containing 301, 302 and 301 amino acid, respectively, and shared 98.57% similarity.</p></sec><sec id="s3_2"><title>3.2. Transcription Profiling of the TaFUS3 Homoeologs during Seed Development and Germination in Wheat</title><p>The expression profiles of three TaFUS3 genes in seed development and germination stages were investigated by qRT-PCR using gene-specific primer pairs TaFUS3-3A-F/R, TaFUS3-3B-F/R and TaFUS3-3D-F/R (<xref ref-type="table" rid="table1">Table 1</xref>). Expression analysis indicated that the significant differences in transcription were observed among the three homoeologous genes. TaFUS3-3B and TaFUS3-3D had similar expression patterns (<xref ref-type="fig" rid="fig2">Figure 2</xref>), whereas the expression of TaFUS3-3A was almost undetectable in all samples (data not shown). During grain filling stage, the transcription of TaFUS3-3B and TaFUS3-3D showed a gradual upward trend at 15 - 25 DAP, and then declined quickly at 30 DAP (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)). During seed imbibition, the expression of TaFUS3-3B and TaFUS3-3D showed an up-regulation trend in the 0 - 24 h period. Afterwards (36 - 48 h), the transcripts of the two genes showed gradual declined (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)). Additionally, the two TaFUS3 genes also shared different transcript abundances during seed development and germination process. For instance, TaFUS3-3D had higher expression level than</p><p>that of TaFUS3-3B. These results indicated that the two TaFUS3 homoeologs might play an important role in wheat seed development and germination.</p></sec><sec id="s3_3"><title>3.3. Molecular Identification of the Barley Stripe Mosaic Virus-Wheat FUSCA3 (BSMV-TaFUS3) Infected Wheat Plants</title><p>To functionally test the role of TaFUS3 gene, we used a virus-induced gene silencing (VIGS) approach in the cultivar “Huaimai 0360”. This cultivar has a relatively high seed dormancy level. A 247-bp cDNA fragment of the TaFUS3 gene was isolated. Then, a recombinant viral vector BSMV: TaFUS3 was constructed and used to inoculate the wheat spikes during the heading stage under field conditions. We collected developing seeds at 21, 28, 35, and 45 dpi and then mature seeds (45 dpi) were imbibed for 24, 48, 72, and 96 h. The qRT-PCR analysis showed that the transcript level of TaFUS3 in the BSMV: TaFUS3-silenced plants was significantly decreased (by 61%, 41%, 55%, and 25% at 21, 28, 35, and 45 dpi, respectively) compared with the control plants (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a)). During seed germination, the transcript abundance of TaFUS3 declined by 18% - 24% in mature seeds (45 dpi) imbibed for 48 - 96 h (<xref ref-type="fig" rid="fig3">Figure 3</xref>(b)). These findings indicated the target gene was successfully repressed in BSMV: TaFUS3-silenced plants.</p></sec><sec id="s3_4"><title>3.4. Silencing of TaFUS3 Increased Seed Germination and Spike Sprouting Capacities</title><p>The effect of TaFUS3 knockdown on the seed germination was characterized at 40 dpi. The seed germination capacity of BSMV-TaFUS3-silenced plants was always higher than that of control plants (BSMV: GFP infected) for 7 days of imbibition (<xref ref-type="fig" rid="fig4">Figure 4</xref>(a)). Moreover, the germination speed was faster in BSMV:TaFUS3 than BSMV:GFP infected plants following the addition of water. As shown in <xref ref-type="fig" rid="fig4">Figure 4</xref>(b), the seed germination rate in TaFUS3-silenced plants reached 16.7%, 24.5%, and 27.8% on the first, second and third day of germination, which were 5 times, 3.7 times and 2.8 times of the control, respectively.</p><p>Similar results in PHS experiment were observed at 40 and 45 dpi. The data showed that the sprouting capacity was obviously higher in spikes of BSMV:TaFUS3 than BSMV:GFP plants (<xref ref-type="fig" rid="fig4">Figure 4</xref>(c)). Compared with the control, the germination rates in seed of BSMV-TaFUS3 wheat spike increased on average 50% (40 dpi) and 24.1% (45 dpi) (<xref ref-type="fig" rid="fig4">Figure 4</xref>(d)). In addition, the plumule and radicle lengths in grains of BSMV: TaFUS3 wheat spike were increased by, respectively, 60.4% and 55.8% at 40 dpi (<xref ref-type="fig" rid="fig4">Figure 4</xref>(e)) and 14.3% and 32.5% at 45 dpi (<xref ref-type="fig" rid="fig4">Figure 4</xref>(f)). These findings indicated that the sprouting speed was significantly faster in spikes of BSMV: TaFUS3 than BSMV-GFP wheat. Above results suggested that TaFUS3 silencing resulted in enhanced seed germination and PHS in wheat grains; thus, TaFUS3 may act as a negative regulator of wheat seed germination.</p></sec><sec id="s3_5"><title>3.5. Silencing of TaFUS3 Changed the Transcript Levels of Genes Related to GA/ABA Biosynthesis and ABA Metabolism during Seed Germination</title><p>To define the role of TaFUS3 in regulating seed germination and PHS, qRT-PCR analyses were carried out to detect the expression levels of ABA biosynthesis genes TaNCED1, TaNCED2, GA biosynthesis genes TaGA20ox-D4, TaGA20ox1d and ABA metabolism gene TaCYP707A2 (<xref ref-type="table" rid="table1">Table 1</xref>). The result revealed that the transcription of one GA synthesis genes (TaGA20ox1d) and one ABA metabolism gene (TaCYP707A2) was evidently induced and their transcript levels in TaFUS3-silenced plants were up-regulated on average by 1.9 and 2.0 times, respectively, in the seeds imbibed for 48 hours (<xref ref-type="fig" rid="fig5">Figure 5</xref>). However, the expression of ABA biosynthesis genes TaNCED1 and TaNCED2 was obviously inhibited and the transcription levels of TaNCED2 in TaFUS3-silenced plants decreased by 32.86% (<xref ref-type="fig" rid="fig5">Figure 5</xref>), indicating that TaFUS3 might control seed dormancy and PHS -resistance by positively regulating ABA synthesis genes and negatively regulating ABA metabolism and GA synthesis genes.</p></sec><sec id="s3_6"><title>3.6. Decreased Expression of TaFUS3 Gene in Wheat Granted Reduced ABA Sensitivity through Negatively or Positively Regulating Different Genes Involved in the ABA Signaling Pathway</title><p>The expression levels of TaFUS3 and endogenous ABI3, ABI4, ABI5, and PKABA1 (<xref ref-type="table" rid="table1">Table 1</xref>) were analyzed in embryos of the BSMV-infected plants upon ABA treatment. As shown in <xref ref-type="fig" rid="fig6">Figure 6</xref>, after ABA treatment, the expression of these genes was induced. Compared with the control, the relative transcript level of TaFUS3 in BSMV:TaFUS3 plants was significantly lower. In addition, the expression of TaFUS3 in TaFUS3-silenced plants significantly up-regulated the expression of PKABA1 and markedly down-regulated the expression of ABI5</p><p>(<xref ref-type="fig" rid="fig6">Figure 6</xref>). Although the expression of ABI3 was also up-regulated, the difference was not significant. These findings suggested that repressed expression of TaFUS3 gene reduced ABA sensitivity through negatively regulating ABI4 and PKABA1 genes and positively regulating ABI5 gene involved in the ABA signaling pathway.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>FUS3 is a key regulator in inducing dormancy and inhibiting seed germination in Arabidopsis thaliana. In the present study, in order to clarify the functions of FUS3 orthologs in wheat seed germination and PHS resistance, the cDNA and genomic DNA sequences of TaFUS3 homoeologs from wheat were isolated and characterized for the first time. Sequence analysis revealed that the TaFUS3 homoeologs had the similar structures and numbers of amino acids, and all encode a protein with a conserved B3 domain (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Although the three TaFUS3 genes had high homology with barley HvFUS3 (GenBank No.CAL91173) at amino acid level, there were great differences in gene structure among them. Wheat TaFUS3 homoeologs had seven exons and six introns, whereas barley HvFUS3 gene had same six exons and five introns as AtFUS3, implying TaFUS3 gene might have different function from HvFUS3 and AtFUS3.</p><p>The qRT-PCR analysis demonstrated that only two copies of the TaFUS3 genes were constitutively transcribed at different developmental and germinating stages. Moreover, transcript levels of both TaFUS3-3B and TaFUS3-3D also varied with the developmental and germinating process. During grain filling stage, the relatively high expression of TaFUS3-3B and TaFUS3-3D was recorded at 25 DAP (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)). Similar results were obtained by Luer&#223;en et al. [<xref ref-type="bibr" rid="scirp.111203-ref17">17</xref>], who showed that the expression level of AtFUS3 was higher in the prophase and near metaphase of seed development, but decreased before seed maturity. The two TaFUS3 genes were induced after seed imbibition, and relatively high expression was noted 24 h after imbibition commenced (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)); these findings were in agreement with the results observed by Chiu et al. at high temperatures [<xref ref-type="bibr" rid="scirp.111203-ref31">31</xref>]. Hence, the expression of the three TaFUS3 genes in wheat seed was differentially regulated, which might reflect a difference in functions of the three homoeologs in the development and germination.</p><p>Earlier experiments with the transgenic Arabidopsis revealed that AtFUS3 over-expression delayed seed germination during imbibition [<xref ref-type="bibr" rid="scirp.111203-ref31">31</xref>]. Based on this finding, it might be expected that under-expression of TaFUS3 would have an opposite effect, that is accelerating germination. As shown in <xref ref-type="fig" rid="fig4">Figure 4</xref>, this hypothesis was supported; germination of seeds in TaFUS3-silenced plants was hindered for at least 7 d following the addition of water. Spike sprouting test further revealed that grains in the TaFUS3-silenced plants showed copious germination in the spike 7 d after being subjected to sprouting conditions, whereas the grain in the plants with normal expression of TaFUS3 barely germinated at 40 dpi. However, germination rate in TaFUS3-silenced plants was significantly lower than those in the control (GFP infected) plants at 45 dpi, suggesting the difference narrowed. So, we speculated that this might be related to the decrease in dormancy level of grains because the expression levels in grains of TaFUS3 silenced spikes were lower than those in the control plants. These results suggested that TaFUS3 had an important role in regulating seed dormancy and PHS tolerance. Interestingly, the inhibition of germination occurred at the appropriate seed germination temperature (25˚C) of wheat instead of the supra-optimal temperature in case of Arabidopsis reported by Chiu et al. [<xref ref-type="bibr" rid="scirp.111203-ref31">31</xref>]. The reason might be related to the characteristics of different species.</p><p>It has long been known that endogenous hormones abscisic acid (ABA) and gibberellin (GA) played a key role in controlling seed dormancy and germination [<xref ref-type="bibr" rid="scirp.111203-ref12">12</xref>]. GAs breaks seed dormancy and promote germination. However, ABA is considered to induce and maintain seed dormancy. Seed dormancy or germination depends on the levels of ABA/GA, which are controlled by the precise balance between biosynthesis and catabolism rates of these hormones [<xref ref-type="bibr" rid="scirp.111203-ref12">12</xref>]. Recently, the major enzymes involved in ABA and GA metabolism pathways have been identified, such as ABA biosynthetic gene NCED that encodes 9-cis-epoxycarotenoid dioxygenase, ABA catabolic gene CYP707A that encodes ABA 8’-hydroxylase, GA biosynthetic gene GA20ox that encodes GA 20-oxidase, GA3ox that encodes GA 3-hydroxy-lase, and GA catabolic gene GA2ox that encodes GA 2-oxidase [<xref ref-type="bibr" rid="scirp.111203-ref42">42</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref43">43</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref45">45</xref>]. Gubler et al. [<xref ref-type="bibr" rid="scirp.111203-ref46">46</xref>] reported that suppressing expression of HvCYP707A in transgenic barley grains resulted in a higher ABA content and increased dormancy. The over-expression of AtFUS3 delayed seed germination by regulating ABA/GA ratio at high temperatures [<xref ref-type="bibr" rid="scirp.111203-ref31">31</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref33">33</xref>]. In the present study, seed germination and PHS were significantly enhanced when TaFUS3 gene was down-regulated. Therefore, we hypothesized that the TaFUS3 gene may be involved in the regulation of ABA/GA synthesis and metabolism during seed germination. To test the hypothesis, we investigated the expression patterns of the ABA biosynthesis-related genes TaNCED1 and TaNCED2, the GA biosynthesis-related genes TaGA20ox-D4 and TaGA20ox1d and the ABA metabolism-related gene TaCYP707A2. The transcription levels of TaGA20ox-D4, TaGA20ox1d and TaCYP707A2 in grains of BSMV:TaFUS3-silenced plants were significantly up-regulated (<xref ref-type="fig" rid="fig5">Figure 5</xref>), whereas the expression levels of TaNCED1 and TaNCED2 in BSMV:TaFUS3-silenced plants were significantly down-regulated in imbibed seed (<xref ref-type="fig" rid="fig5">Figure 5</xref>). This pattern is in accordance with the increase in seed germination and PHS capacity observed in BSMV: TaFUS3 silenced plants after 7 d of incubation (<xref ref-type="fig" rid="fig4">Figure 4</xref>). These results suggested that down-regulating expression of TaFUS3 might lead to increased GA transcription level and decreased ABA transcription level, indicating TaFUS3 may regulate seed dormancy and PHS-resistance by regulating the expression levels of genes in the ABA and GA metabolism pathways.</p><p>In addition to ABA levels, the ABA signal and sensitivity of embryos to ABA also play important roles in seed dormancy and PHS. Cultivars with strong dormancy have strong sensitivity to ABA [<xref ref-type="bibr" rid="scirp.111203-ref47">47</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref48">48</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref49">49</xref>]. The ABA signal regulators, such as the ABI (for ABA-insensitive) transcription factors, include ABI3, ABI4 and ABI5. The ABI3 belongs to the B3 type transcription factors and plays an important regulatory role in seed dormancy and ABA inhibition of seed germination [<xref ref-type="bibr" rid="scirp.111203-ref50">50</xref>]. The ABI5 encodes a bZIP transcription factor whose accumulation inhibits seed germination and early seedling growth [<xref ref-type="bibr" rid="scirp.111203-ref51">51</xref>] [<xref ref-type="bibr" rid="scirp.111203-ref52">52</xref>]. Another important component of the pathway is the ABA-induced Ser/Thr protein kinase PKABA1 [<xref ref-type="bibr" rid="scirp.111203-ref53">53</xref>]. The PKABA1 mRNA levels in both seeds and leaves of wheat increase rapidly in response to dehydration and ABA [<xref ref-type="bibr" rid="scirp.111203-ref54">54</xref>]. In the present work, we examined the response of TaFUS3 and the ABA signaling pathway-related genes ABI3, ABI4, ABI5, and PKABA1 to ABA treatment. The results revealed that the expression of TaFUS3 and ABI5 was significantly down-regulated and the expression of ABI3, ABI4 and PKABA1 was up-regulated in the TaFUS3-silenced plants in the ABA treatment (<xref ref-type="fig" rid="fig6">Figure 6</xref>). We speculate that the mechanism underpinning reduced ABA sensitivity of TaFUS3-silenced plants is based on TaFUS3 regulating the expression of genes susceptible as PKABA1and ABI5.</p></sec><sec id="s5"><title>5. Conclusions</title><p>In this study, three TaFUS3 homoeologous genes, encoding B3-domin proteins, were isolated and their role in seed germination and PHS were investigated using the BSMV-VIGS method under field conditions. In TaFUS3-silenced wheat plants, seed germination and PHS capacities were significantly increased, and the seed dormancy level was significantly decreased in mature grains. The transcription levels of two GA synthesis-related genes and one ABA catabolism-related gene were significantly up-regulated, and two ABA synthesis-related genes were significantly down-regulated. In addition, three signal genes involved in ABA response were markedly up-regulated, and one signal gene was markedly down-regulated in embryos of TaFUS3-silenced plants under ABA treatment. These results indicated that TaFUS3 acts as a positive regulator in inhibiting seed germination and PHS, and temporally regulates the expression of some ABA, GA metabolic-related genes and ABA signal genes in imbibed wheat seed.</p></sec><sec id="s6"><title>Acknowledgements</title><p>This work was financially supported by National Key Research and Development Program in China (2017YFD0301101) and Key Scientific and Technological Projects in Henan Province (212102110057).</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>Wang, X.G., Liu, L.L., Wang, Y.L., Meng, X.D., Jiang, Y.M., Li, Y.C., Li, L. and Ren, J.P. (2021) Isolation and Functional Characterization of a B3 Transcription Factor Gene FUSCA3 Involved in Pre-Harvest Sprouting Resistance in Wheat. Agricultural Sciences, 12, 844-862. https://doi.org/10.4236/as.2021.128054</p></sec><sec id="s9"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.111203-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Bewley, J.D. (1997) Seed Germination and Dormancy. Plant Cell, 9, 1055-1066. https://doi.org/10.1105/tpc.9.7.1055</mixed-citation></ref><ref id="scirp.111203-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Gale, M.D. and Lenton, J.R. (1987) Preharvest Sprouting in Wheat: A Complex Genetic and Physiological Problem Affecting Bread Making Quality in UK Wheat. Aspects of Applied Biology, 15, 115-124.</mixed-citation></ref><ref id="scirp.111203-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Groos, C., Gay, G., Perretant, M.R., Gervais, L., Bernard, M., Dedryver, F., et al. (2002) Study of the Relationship between Pre-Harvest Sprouting and Grain Color by Quantitative Trait Loci Analysis in a White X Red Grain Bread-Wheat Cross. Theoretical and Applied Genetics, 104, 39-47. https://doi.org/10.1007/s001220200004</mixed-citation></ref><ref id="scirp.111203-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Barnard, A. (2001) Genetic Diversity of South African Winter Wheat Cultivars in Relation to Preharvest Sprouting and Falling Number. Euphytica, 119, 109-112. https://doi.org/10.1023/A:1017571212607</mixed-citation></ref><ref id="scirp.111203-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Amano, Y. and Torada, A. (2002) Breeding of White-Grained Wheats for Japan. Euphytica, 126, 83-88. https://doi.org/10.1023/A:1019615504609</mixed-citation></ref><ref id="scirp.111203-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Kulwal, P., Kumar, N., Gaur, A., Khurana, P., Khurana, J., Tyagi, A., et al. (2005) Mapping of a Major QTL for Pre-Harvest Sprouting Tolerance on Chromosome 3A in Bread Wheat. Theoretical and Applied Genetics, 111, 1052-1059. https://doi.org/10.1007/s00122-005-0021-4</mixed-citation></ref><ref id="scirp.111203-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Ogbonnaya, F.C., Imtiaz, M., Ye, G., Hearnden, P.R., Hernandez, E., Eastwood, R.F., et al. (2008) Genetic and QTL Analyses of Seed Dormancy and Preharvest Sprouting Resistance in the Wheat Germplasm CN10955. Theoretical and Applied Genetics, 116, 891-902. https://doi.org/10.1007/s00122-008-0712-8</mixed-citation></ref><ref id="scirp.111203-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Xiao, S.H., Zhang, X.Y., Yan, C.S. and Lin, H. (2002) Germplasm Improvement for Preharvest Sprouting Resistance in Chinese White-Grained Wheat: An Overview of the Current Strategy. Euphytica, 126, 35-38. https://doi.org/10.1023/A:1019679924173</mixed-citation></ref><ref id="scirp.111203-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Nonogaki, H., Barrero, J.M. and Li, C. (2018) Seed Dormancy, Germination and Pre-Harvest Sprouting. Frontiers in Plant Science, 9, Article No. 1783. https://doi.org/10.3389/fpls.2018.01783</mixed-citation></ref><ref id="scirp.111203-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Gubler, F., Millar, A.A. and Jacobsen, J.V. (2005) Dormancy Release, ABA and Pre-Harvest Sprouting. Current Opinion in Plant Biology, 8, 183-187. https://doi.org/10.1016/j.pbi.2005.01.011</mixed-citation></ref><ref id="scirp.111203-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">McCarty, D.R. (1995) Genetic Control and Integration of Maturation and Germination Pathways in Seed Development. Annual Review of Plant Physiology and Plant Molecular Biology, 46, 71-93. https://doi.org/10.1146/annurev.pp.46.060195.000443</mixed-citation></ref><ref id="scirp.111203-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Tuan, P.A., Kumar, R., Rehal, P.K., Toora, P.K. and Ayele, B.T. (2018) Molecular Mechanisms Underlying Abscisic Acid/Gibberellin Balance in the Control of Seed Dormancy and Germination in Cereals. Frontiers in Plant Science, 9, Article No. 668. https://doi.org/10.3389/fpls.2018.00668</mixed-citation></ref><ref id="scirp.111203-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Finkelstein, R.R., Gampala, S.S.L. and Rock, C.D. (2002) Abscisic Acid Signaling in Seeds and Seedlings. Plant Cell, 14, S15-S45. https://doi.org/10.1105/tpc.010441</mixed-citation></ref><ref id="scirp.111203-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Finkelstein, R., Reeves, W., Ariizumi, T. and Steber, C. (2008) Molecular Aspects of Seed Dormancy. Annual Review of Plant Biology, 59, 387-415. https://doi.org/10.1146/annurev.arplant.59.032607.092740</mixed-citation></ref><ref id="scirp.111203-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Suzuki, M. and McCarty, D.R. (2008) Functional Symmetry of the B3 Network Controlling Seed Development. Current Opinion in Plant Biology, 11, 548-553. https://doi.org/10.1016/j.pbi.2008.06.015</mixed-citation></ref><ref id="scirp.111203-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Giraudat, J., Hauge, B.M., Valon, C., Smalle, J., Parcy, F. and Goodman, H.M. (1992) Isolation of the Arabidopsis ABI3 Gene by Positional Cloning. Plant Cell, 4, 1251-1261. https://doi.org/10.1105/tpc.4.10.1251</mixed-citation></ref><ref id="scirp.111203-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Luer&amp;#223;en, H., Kirik, V., Herrmann, P. and Miséra, S. (1998) FUSCA3 encodes a Protein with a Conserved VP1/ABI3-Loke B3 Domain Which Is of Functional Importance for the Regulation of Seed Maturation in Arabidopsis thaliana. Plant Journal, 15, 755-764. https://doi.org/10.1046/j.1365-313X.1998.00259.x</mixed-citation></ref><ref id="scirp.111203-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Lotan, T., Ohto, M., Yee, K.M., West, M.A.L., Lo, R., Kwong, R.W., et al. (1998) Arabidopsis LEAFY COTYLEDON1 Is Sufficient to Induce Embryo Development in Vegetative Cells. Cell, 93, 1195-1205. https://doi.org/10.1016/S0092-8674(00)81463-4</mixed-citation></ref><ref id="scirp.111203-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Stone, S.L., Kwong, L.W., Yee, K.M., Pelletier, J., Lepiniec, L., Fischer, R.L., et al. (2001) LEAFY COTYLEDONE2 Encodes a B3 Domain Transcription Factor That Induces Embryo Development. Proceedings of the National Academy of Sciences of the United States of America, 98, 11806-11811. https://doi.org/10.1073/pnas.201413498</mixed-citation></ref><ref id="scirp.111203-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Jia, H., McCarty, D.R. and Suzuki, M. (2013) Distinct Roles of LAFL Network Genes in Promoting the Embryonic Seedling Fate in the Absence of VAL Repression. Plant Physiology, 163, 1293-1305. https://doi.org/10.1104/pp.113.220988</mixed-citation></ref><ref id="scirp.111203-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Nonogaki, H. (2014) Seed Dormancy and Germination-Emerging Mechanisms and New Hypotheses. Frontiers in Plant Science, 5, Article No. 233. https://doi.org/10.3389/fpls.2014.00233</mixed-citation></ref><ref id="scirp.111203-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Fatihi, A., Boulard, C., Bouyer, D., Baud, S.S., Dubreucq, B. and Lepiniec, L. (2016) Deciphering and Modifying LAFL Transcriptional Regulatory Network in Seed for Improving Yield and Quality of Storage Compounds. Plant Science, 250, 198-204. https://doi.org/10.1016/j.plantsci.2016.06.013</mixed-citation></ref><ref id="scirp.111203-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">To, A., Valon, C., Savino, G., Guilleminot, J., Devic, M., Giraudat, J., et al. (2006) A Network of Local and Redundant Gene Regulation Governs Arabidopsis Seed Maturation. Plant Cell, 18, 1642-1651. https://doi.org/10.1105/tpc.105.039925</mixed-citation></ref><ref id="scirp.111203-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Sreenivasulu, N. and Wobus, U. (2013) Seed-Development Programs: A Systems Biology-Based Comparison between Dicots and Monocots. Annual Review of Plant Biology, 64, 189-217. https://doi.org/10.1146/annurev-arplant-050312-120215</mixed-citation></ref><ref id="scirp.111203-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Boulard, C., Fatihi, A., Lepiniec, L. and Dubreucq, B. (2017) Regulation and Evolution of the Interaction of the Seed B3 Transcription Factors with NF-Y Subunits. BBA-Gene Regulatory Mechanisms, 1860, 1069-1078. https://doi.org/10.1016/j.bbagrm.2017.08.008</mixed-citation></ref><ref id="scirp.111203-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Gazzarrini, S., Tsuchiya, Y., Lumba, S., Okamoto, M. and McCourt, P. (2004) The Transcription Factor FUSCA3 Controls Developmental Timing in Arabidopsis through the Hormones Gibberellin and Abscisic Acid. Developmental Cell, 7, 373-385. https://doi.org/10.1016/j.devcel.2004.06.017</mixed-citation></ref><ref id="scirp.111203-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Tsai, A.Y.L. and Gazzarrini, S. (2012) AKIN10 and FUSCA3 Interact to Control Lateral Organ Development and Phase Transitions in Arabidopsis. Plant Journal, 69, 809-821. https://doi.org/10.1111/j.1365-313X.2011.04832.x</mixed-citation></ref><ref id="scirp.111203-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Carbonero, P., Iglesias-Fernandez, R. and Vicente-Carbajosa, J. (2016) The AFL Subfamily of B3 Transcription Factors: Evolution and Function in Angiosperm Seeds. Journal of Experimental Botany, 68, 871-880. https://doi.org/10.1093/jxb/erw458</mixed-citation></ref><ref id="scirp.111203-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Lu, Q.S., Dela-Paz, J., Pathmanathan, A., Chiu, R.S., Tsai, A.Y. and Gazzarrini, S. (2010) The C-Terminal Domain of FUSCA3 Negatively Regulates mRNA and Protein Levels and Mediates Sensitivity to the Hormones Abscisic Acid and Gibberellic acid in Arabidopsis. Plant Journal, 64, 100-113. https://doi.org/10.1111/j.1365-313X.2010.04307.x</mixed-citation></ref><ref id="scirp.111203-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Curaba, J., Moritz, T., Blervaque, R., Parcy, F., Raz, V., Herzog, M., et al. (2004) AtGA3ox2, a Key Gene Responsible for Bioactive Gibberellin Biosynthesis, Is Regulated during Embryogenesis by LEAFY COTYLEDON2 and FUSCA3 in Arabidopsis. Plant Physiology, 136, 3660-3669. https://doi.org/10.1104/pp.104.047266</mixed-citation></ref><ref id="scirp.111203-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Chiu, R.S., Nahal, H., Provart, N.J. and Gazzarrini, S. (2012) The Role of the Arabidopsis FUSCA3 Transcription Factor during Inhibition of Seed Germination at High Temperature. BMC Plant Biology, 12, Article No. 15. https://doi.org/10.1186/1471-2229-12-15</mixed-citation></ref><ref id="scirp.111203-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Chiu, R.S., Pan, S., Zhao, R. and Gazzarrini, S. (2016) ABA-Dependent Inhibition of the Ubiquitin Proteasome System during Germination at High Temperature in Arabidopsis. Plant Journal, 88, 749-761. https://doi.org/10.1111/tpj.13293</mixed-citation></ref><ref id="scirp.111203-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Chiu, R.S., Saleh, Y. and Gazzarrini, S. (2016) Inhibition of FUSCA3 Degradation at High Temperature Is Dependent on ABA Signaling and Is Regulated by the ABA/GA Ratio. Plant Signaling and Behavior, 11, Article No. e1247137. https://doi.org/10.1080/15592324.2016.1247137</mixed-citation></ref><ref id="scirp.111203-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Moreno-Risueno, M.A., Gonzalez, N., Diaz, I., Parcy, F., Carbonero, P. and Vicente-Carbajosa, J. (2008) FUSCA3 from Barley Unveils a Common Transcriptional Regulation of Seed-Specific Genes between Cereals and Arabidopsis. Plant Journal, 53, 882-894. https://doi.org/10.1111/j.1365-313X.2007.03382.x</mixed-citation></ref><ref id="scirp.111203-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Sun, F., Liu, X., Wei, Q., Liu, J., Yang, T., Jia, L., et al. (2017) Functional Characterization of TaFUSCA3, a B3-Superfamily Transcription Factor Gene in the Wheat. Frontiers in Plant Science, 8, Article No. 1133. https://doi.org/10.3389/fpls.2017.01133</mixed-citation></ref><ref id="scirp.111203-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Liu, G.Y., Wu, Y.F., Xu, M.J., Gao, T., Wang, P.F., Wang, L.N., et al. (2016) Virus-Induced Gene Silencing Identifies an Important Role of the TaRSR1 Transcription Factor in Starch Synthesis in Bread Wheat. International Journal of Molecular Sciences, 17, Article No. 1557. https://doi.org/10.3390/ijms17101557</mixed-citation></ref><ref id="scirp.111203-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Ren, J.P., Wang, X.G. and Meng, X.D. (2019) Wheat Gene TaFUS3 and Its Application. China Patent No. ZL201510970510.6.</mixed-citation></ref><ref id="scirp.111203-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Feng, Y.L., Wang, K.T., Ma, C., Zhao, Y.Y. and Yin, J. (2015) Virus-Induced Gene Silencing-Based Functional Verification of Six Genes Associated with Vernalization in Wheat. Biochemical and Biophysical Research Communications, 458, 928-933. https://doi.org/10.1016/j.bbrc.2015.02.064</mixed-citation></ref><ref id="scirp.111203-ref39"><label>39</label><mixed-citation publication-type="book" xlink:type="simple">Pogue, G.P., Lindbo, J.A., Dawson, W.O. and Turpen, T.H. (1998) Tobamovirus Transient Expression Vectors: Tools for Plant Biology and High Level Expression of Foreign Proteins in Plants. In: Gelvin, S.B. and Schilperoot, R.A., Eds., Plant Molecular Biology Manual, Kluwer Academic Publishers, Dordrecht, 67-93. https://doi.org/10.1007/978-94-011-5242-6_5</mixed-citation></ref><ref id="scirp.111203-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Wang, X.G., Wang, Y.L., Xiao, R.X., Chen, X. and Ren, J.P. (2016) Molecular Characterization and Expression Analysis of Three Homoeologous Ta14S Genes Encoding 14-3-3 Proteins in Wheat (Triticum aestivum L.). The Crop Journal, 4, 188-198. https://doi.org/10.1016/j.cj.2016.03.002</mixed-citation></ref><ref id="scirp.111203-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Livak, K.J. and Schmittgen, T.D. (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2&lt;sup&gt;&amp;#8722;ΔΔCt&lt;/sup&gt; Method. Methods, 25, 402-408. https://doi.org/10.1006/meth.2001.1262</mixed-citation></ref><ref id="scirp.111203-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Seo, M. and Koshiba, T. (2002) Complex Regulation of ABA Biosynthesis in Plants. Trends in Plant Science, 7, 41-48. https://doi.org/10.1016/S1360-1385(01)02187-2</mixed-citation></ref><ref id="scirp.111203-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Okamoto, M., Kuwahara, A., Seo, M., Kushiro, T., Asami, T., Hirai, N., et al. (2006) CYP707A1 and CYP707A2, Which Encode Abscisic acid 8’-Hydroxylases, Are Indispensable for Proper Control of Seed Dormancy and Germination in Arabidopsis. Plant Physiology, 141, 97-107. https://doi.org/10.1104/pp.106.079475</mixed-citation></ref><ref id="scirp.111203-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Yamauchi, Y., Ogawa, M., Kuwahara, A., Hanada, A., Kamiya, Y. and Yamaguchi, S. (2004) Activation of Gibberellin Biosynthesis and Response Pathways by Low Temperature during Imbibition of Arabidopsis Thaliana Seeds. Plant Cell, 16, 367-378. https://doi.org/10.1105/tpc.018143</mixed-citation></ref><ref id="scirp.111203-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Finch-Savage, W.E., Cadman, C.S., Toorop, P.E., Lynn, J.R. and Hilhorst, H.W. (2007) Seed Dormancy Release in Arabidopsis Cvi by dry After-Ripening, Low Temperature, Nitrate and Light Shows Common Quantitative Patterns of Gene Expression Directed by Environmentally Specific Sensing. Plant Journal, 51, 60-78. https://doi.org/10.1111/j.1365-313X.2007.03118.x</mixed-citation></ref><ref id="scirp.111203-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Gubler, F., Hughes, T., Waterhouse, P. and Jacobsen, J. (2008) Regulation of Dormancy in Barley by Blue Light and After-Ripening: Effects on Abscisic Acid and Gibberellins Metabolism. Plant Physiology, 147, 886-896. https://doi.org/10.1104/pp.107.115469</mixed-citation></ref><ref id="scirp.111203-ref47"><label>47</label><mixed-citation publication-type="other" xlink:type="simple">Walker-Simmons, M. (1987) ABA Levels and Sensitivity in Developing Wheat Embryos of Sprouting Resistant and Susceptible Cultivars. Plant Physiology, 84, 61-66. https://doi.org/10.1104/pp.84.1.61</mixed-citation></ref><ref id="scirp.111203-ref48"><label>48</label><mixed-citation publication-type="other" xlink:type="simple">Morris, C.F., Moffatt, J.M., Sears, R.G. and Paulsen, G.M. (1989) Seed Dormancy and Responses of Caryopses, Embryos, and Calli to Abscisic Acid in Wheat. Plant Physiology, 90, 643-647. https://doi.org/10.1104/pp.90.2.643</mixed-citation></ref><ref id="scirp.111203-ref49"><label>49</label><mixed-citation publication-type="other" xlink:type="simple">Corbineau, F., Abdelilah, B. and C&amp;#244;me, D. (2000) Changes in Sensitivity to Abscisic Acid of the Developing and Maturing Embryo of Two Wheat Cultivars with Different Sprouting Susceptibility. Israel Journal of Plant Sciences, 48, 189-197.</mixed-citation></ref><ref id="scirp.111203-ref50"><label>50</label><mixed-citation publication-type="other" xlink:type="simple">Yang, Y., Ma, Y.Z., Xu, Z.S., Chen, X.M., He, Z.H., Wilkinson, M., et al. (2007) Isolation and Characterization of Viviparous 1 Genes in Wheat Cultivars with Distinct ABA Sensitivity and Pre-Harvest Sprouting Tolerance. Journal of Experimental Botany, 58, 2863-2871. https://doi.org/10.1093/jxb/erm073</mixed-citation></ref><ref id="scirp.111203-ref51"><label>51</label><mixed-citation publication-type="other" xlink:type="simple">Finkelstein, R.R. and Lynch, T.J. (2000) The Arabidopsis Abscisic Acid Response Gene ABI5 Encodes a Basic Leucine Zipper Transcription Factor. Plant Cell, 12, 599-609. https://doi.org/10.1105/tpc.12.4.599</mixed-citation></ref><ref id="scirp.111203-ref52"><label>52</label><mixed-citation publication-type="other" xlink:type="simple">Lopez-Molina, L., Mongrand, S. and Chua, N.H. (2001) A Post Germination Developmental Arrest Checkpoint Is Mediated by Abscisic Acid and Requires the ABI5 Transcription Factor in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America, 98, 4782-4787. https://doi.org/10.1073/pnas.081594298</mixed-citation></ref><ref id="scirp.111203-ref53"><label>53</label><mixed-citation publication-type="other" xlink:type="simple">Anderberg, R.J. and Walker-Simmons, D.M.K. (1992) Isolation of a Wheat cDNA Clone for an Abscisic Acid-Inducible Transcript with Homology to Protein Kinases. Proceedings of the National Academy of Sciences of the United States of America, 89, 10183-10187. https://doi.org/10.1073/pnas.89.21.10183</mixed-citation></ref><ref id="scirp.111203-ref54"><label>54</label><mixed-citation publication-type="other" xlink:type="simple">Holappa, L.D. and Walker-Simmons, D.M.K. (1995) The Wheat Abscisic Acid-Responsive Protein Kinase mRNA, PKABA1, Is Up-Regulated by Dehydration, Cold Temperature, and Osmotic Stress. Plant Physiology, 108, 1203-1210. https://doi.org/10.1104/pp.108.3.1203</mixed-citation></ref></ref-list></back></article>