<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">APE</journal-id><journal-title-group><journal-title>Advances in Physical Education</journal-title></journal-title-group><issn pub-type="epub">2164-0386</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ape.2021.112022</article-id><article-id pub-id-type="publisher-id">APE-109179</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Medicine&amp;Healthcare</subject><subject> Social Sciences&amp;Humanities</subject></subj-group></article-categories><title-group><article-title>
 
 
  Is ACTN3 R577X Genotype Associated with a Preference in Type of Exercise Such as Sprint or Endurance?
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Toshiyuki</surname><given-names>Kawamura</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Akihiro</surname><given-names>Azuma</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kazuhiro</surname><given-names>Matsui</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Chemistry and Biology, National Institute of Technology, Fukui College, Sabae, Fukui, Japan</addr-line></aff><aff id="aff2"><addr-line>Couse of General Education (Natural Science), National Institute of Technology, Fukui College, Sabae, Fukui, Japan</addr-line></aff><pub-date pub-type="epub"><day>18</day><month>03</month><year>2021</year></pub-date><volume>11</volume><issue>02</issue><fpage>268</fpage><lpage>275</lpage><history><date date-type="received"><day>29,</day>	<month>March</month>	<year>2021</year></date><date date-type="rev-recd"><day>16,</day>	<month>May</month>	<year>2021</year>	</date><date date-type="accepted"><day>19,</day>	<month>May</month>	<year>2021</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  The purpose of this study was to determine whether genotypes in the α-actinin-3 gene are associated with preferences in the type of exercise (sprint vs. endurance) in male college students. The study enrolled 64 healthy male students aged 18
  -
  21 years old, excluding elite athletes. DNA was extracted from the subjects’ hair samples to determine the genotypes of the α-actinin-3 gene, whereas a simple questionnaire was used to investigate preference in the type of exercise. In summary, 35.5% of subjects with the RR and RX types (R-allele group) preferred sprint, whereas 47.3% of subjects with the XX type preferred endurance. Furthermore, 53.3% of the R-allele group and 31.6% of the XX group preferred endurance and sprint, respectively. This implies that the inconsistency (or mismatch) between muscle functional properties, which are characterized by genotypes and preference in type of exercise, tends to be greater in the R-allele group than in the XX type. In conclusion, the genotypes of α-actinin-3 did not play a significant role in deciding the preference in type of exercise. It can also be suspected that the mismatch between muscle functional properties and exercise preference is influenced by the daily life of students who are not exposed to high-intensity exercise stimuli.
 
</p></abstract><kwd-group><kwd>α-Actinin-3</kwd><kwd> Genotype</kwd><kwd> Preference</kwd><kwd> Type of Exercise</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Four types of actinin, α-actinin-1 (ACTN1) to α-actinin-4 (ACTN4), exist in vertebrates. These types were considered to have diversified from only one type of actinin through evolution (Virel &amp; Backman, 2004). Both ACTN1 and ACTN4 are ubiquitously expressed in every possible cell, whereas α-actinin-2 (ACTN2) and α-actinin-3 (ACTN3) are specifically expressed in skeletal muscle (North et al., 1999; Vincent et al., 2007). In ACTN3, genotypes are distinguished between the R-allele type (RR and RX) with the 577th amino acid of the arginine (R) and the XX type with deficient ACTN3 due to a nonsense mutation. The RR type is known to appear in some countries such as Africa (Yang et al., 2007) and is especially present in elite sprint/power athletes (Yang et al., 2003; Yang et al., 2017; Garatachea et al., 2014; Orysiak et al., 2014). ACTN3 is expressed in the Z zone of fast-twitch muscle fibers (Masaki et al., 1967) and is associated with the development of these fibers through physical training (RR and RX types). However, the XX type, wherein ACTN3 is deficient, exists in approximately 1.5 billion people all over the world, which is more than the number of people with the RR type (Head et al., 2015; Houweling et al., 2018; Wyckelsma et al., 2021).</p><p>It is also known that ACTN2 and the calcineurin activity are increased in ACTN3-deficient organisms (Papadimitriou et al., 2019; Garton et al., 2014). Moreover, the activity of calcineurin reduces testosterone levels and suppresses fast-twitch muscle fiber development (Ahmetov et al., 2014). This has been regarded as an alternative effect to increase the dependence of the myoglobin metabolizing system in slow muscle fibers as well as energy efficiency (Ahmetov et al., 2014). Therefore, the XX type is considered to be reprogrammed for aerobic metabolism by slow muscle fibers rather than anaerobic metabolism in fast muscle fibers (Seto et al., 2013; Garton et al., 2014). Moreover, the XX type is reportedly more resistant to coldness and nutritional starvation and less susceptible to fatigue-induced cramps. This is also advantageous in sports that require aerobic endurance. In fact, the relationship between the XX type and endurance has been reported in some literatures (MacArthur et al., 2007; MacArthur et al., 2008; Berman &amp; North, 2010).</p><p>Elite athletes were the focus of most studies that examined the association between sprint/power or endurance and ACTN3 genotypes. However, elite athletes capable of high-level performance are aware of their physical abilities through their athletic experiences and thus already have their preferred events. Furthermore, it remains unknown which factors induced the awareness of excellent abilities in athletes. Costill et al. (1976) reported that the track athlete’s preference for strength, speed, and/or endurance events would be in part a matter of genetic endowment. Thus, determining whether the ACTN3 genotype plays a role in this awareness would be useful for contextualizing the choice of sports events for children, adolescents, and the general public. It can also provide fundamental knowledge for suitable physical activities in individuals. Therefore, the purpose of this study was to investigate the association between the ACTN3 gene polymorphism and the experience-based preferences for the type of exercise in general college students.</p></sec><sec id="s2"><title>2. Methods</title><sec id="s2_1"><title>2.1. Subjects</title><p>This study included 64 healthy college male students aged 18 - 21 years old (mean &#177; SD in age: 19.1 &#177; 1.0 years old, stature: 170.6 &#177; 5.8 cm, body weight: 61.6 &#177; 9.3 kg) without any orthopedic history of the lower limbs that may have interfered with the measurements. They all were students at the National College of Technology in Japan, but elite athletes such as those who participate in national or international competitions were excluded. Informed written consent was collected from the subjects, who were briefed about the aim and procedure of the study and its potential for publication.</p><p>This study was approved by the Ethics Committee at the National Institute of Technology, Fukui College (reference number: R2-7), and was conducted in accordance with the Ethical Guidelines for Human Genome and Genetic Analysis Research issued by the Ministry of Education, Culture, Sports, Science and Technology, the Ministry of Health, Labor and Welfare, and the Ministry of Economy, Trade, and Industry in Japan.</p></sec><sec id="s2_2"><title>2.2. Analysis of ACTN3 Genotypes</title><p>Samples of 2 - 3 strands of hair, approximately 1 cm in length including the hair bulb, from the subjects were collected, and genomic DNAs were extracted from the samples using a DNA extraction kit (ISOHAIR, Nippon Gene Co., Ltd.). Then, the ACNT3 primer set was followed on the basis of the report of Mills et al. (2001) with regard to the forward (5’CTGTTGCCTGTGGTAAGTGGG3’) and reverse (5’TGGTCACAGTATGCAGGAGGG3’) primers. Afterwards, PCR reaction was carried out using DNA polymerase (EX Taq, TaKaRa Bio Inc.) in three steps (at 94˚C for 30 s, 60˚C for 30 s, and then 72˚C for 40 s).</p><p>The PCR products were separated via electrophoresis with 3% agarose gel, and the amplified product only for 280 base pairs was cut out from the gel. Then the PCR products were purified from the gel using a DNA purification kit (NucleoSpin Gel and PCR Clean-up, MACHEREY-NAGEL GmbH &amp; Co. KG). The PCR product was sequenced via the Sanger method using the forward primer in the ACTN3 primer set (Mills et al. 2001). The ACTN3 genotypes (RR, RX, and XX) were determined by analyzing whether the 577th codon encodes arginine (R) or is a stop codon (X). The RR and XX types are defined as the 577th codon being CGA and TGA, respectively. However, when both CGA and TGA codons are seen at the 577th codon, the genotype is determined as RX, as demonstrated in <xref ref-type="fig" rid="fig1">Figure 1</xref>.</p></sec><sec id="s2_3"><title>2.3. Investigation of Preference in Type of Exercise</title><p>A simple questionnaire was adopted to investigate the subjects’ preferences in type of exercise. Using a paper-based questionnaire sheet, subjects were asked to select one of the following three options: “I prefer sprint rather than distance running” (hereinafter referred to as “sprint”); “I prefer distance running rather than sprint” (hereinafter referred to as “endurance”); or “Neither.”</p></sec><sec id="s2_4"><title>2.4. Analysis</title><p>The percentages of each genotype for the subjects were first examined. Then, after aggregating the answers of questionnaire, the percentages of each answer were also calculated for each genotype. The answers of the RR and RX type subjects were combined under the R-allele group. The percentages were compared in each genotype.</p></sec></sec><sec id="s3"><title>3. Results</title><p>The aggregated results in this study are shown in <xref ref-type="table" rid="table1">Table 1</xref>. Regarding the classification of ACTN3 genotype, 18.8% (n = 12) were RR type, 51.6% (n = 33) were RX type, and 29.7% (n = 19) were XX type. Stature and body weight in the group of RR, RX, and XX genotypes were 170.4 &#177; 5, 170.4 &#177; 6.2, and 171.1 &#177; 5.7 cm for stature, 64.3 &#177; 11.3, 62.1 &#177; 7.5, and 59.0 &#177; 10.5 kg for body weight, respectively. One-way ANOVA revealed that the differences between groups for those physical characteristics were not statistically significant (stature: F = 0.085, body weight: F = 1.364; Both P &gt; 0.05). For RR and RX type subjects, 41.7% and 33.3% of respondents answered “sprint,” respectively. In contrast, more than half these subjects answered “endurance,” specifically 58.3% and 51.5% for the RR and RX type, respectively. When calculated together as the R-allele group, 35.6% and</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Aggregation of the questionnaire in each genotype</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  colspan="2"   rowspan="2"  >Variable</th><th align="center" valign="middle"  colspan="4"  >ACTN3 Genotype</th></tr></thead><tr><td align="center" valign="middle" >RR</td><td align="center" valign="middle" >RX</td><td align="center" valign="middle" >R allele total</td><td align="center" valign="middle" >XX</td></tr><tr><td align="center" valign="middle"  colspan="2"  >Number</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >33</td><td align="center" valign="middle" >45</td><td align="center" valign="middle" >19</td></tr><tr><td align="center" valign="middle"  colspan="2"  >Preference</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Sprint</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >16</td><td align="center" valign="middle" >6</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Endurance</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >9</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Neither</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >4</td></tr><tr><td align="center" valign="middle"  colspan="2"  >%</td><td align="center" valign="middle" >18.8</td><td align="center" valign="middle" >51.6</td><td align="center" valign="middle" >70.3</td><td align="center" valign="middle" >29.7</td></tr><tr><td align="center" valign="middle"  colspan="2"  >Preference</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Sprint</td><td align="center" valign="middle" >41.7</td><td align="center" valign="middle" >33.3</td><td align="center" valign="middle" >35.6</td><td align="center" valign="middle" >31.6</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Endurance</td><td align="center" valign="middle" >58.3</td><td align="center" valign="middle" >51.5</td><td align="center" valign="middle" >53.3</td><td align="center" valign="middle" >47.4</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Neither</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >41.7</td><td align="center" valign="middle" >41.7</td><td align="center" valign="middle" >33.3</td></tr></tbody></table></table-wrap><p>Total number = 64.</p><p>53.3% of subjects answered “sprint” and “endurance,” respectively. On the other hand, for the XX type, 31.6% and 47.4% of subjects answered “sprint” and “endurance,” respectively.</p></sec><sec id="s4"><title>4. Discussion</title><p>The ratio of ACTN3 genotype determined in this study was quite similar to that in the study of Mikami et al. (2014), which investigated 649 Japanese subjects from the general public as a control group; RR, RX, and XX types were 20.3%, 53.3%, and 26.3%, respectively. This implies that the subjects in this study can be considered as a general group of Japanese subjects who were not biased by experience with sport events or athletic level. On the basis of global data, the XX type is much more prevalent than the RR type (Head et al., 2015; Houweling et al., 2018; Wyckelsma et al., 2021); 80% of humans have the X-type nonsense variant of ACTN3 (North et al., 1999). Thus, the ratio of ACTN3 genotypes in this study is considered to correspond not only with global trends but also with Japanese characteristics.</p><p>Athletes who possess the R-allele are reported to have superior sprint/power (Yang et al., 2003; Yang et al., 2017; Garatachea et al., 2014; Orysiak et al., 2014). However, there are several studies stating that XX type subjects have higher energy efficiency in slow muscle fibers, thus having superior endurance (MacArthur et al., 2007; MacArthur et al., 2008; Berman &amp; North, 2010). If it is assumed that functional properties in skeletal muscle can be characterized into sprint or endurance depending on ACTN3 genotypes (sprint for R-allele vs. endurance for XX type), less than half of the subjects answered their corresponding muscle functional properties (35.6% in R-allele group and 47.4% in XX type). This suggests that exercise experience in childhood or adolescence would not lead to consistent preferences in type of exercise that correspond to the muscle functional properties expected from their genotypes.</p><p>Furthermore, 53.3% in the R-allele group and 31.6% with XX type preferred the type of exercise that did not correspond to muscle functional properties. In other words, their exercise preferences differed from the expected muscle functional properties. In the R-allele group, although superior sprint/power is expected because of the development of fast-twitch muscle fibers due to α-actinin-3 expression (Yang et al., 2003; Yang et al., 2017; Garatachea et al., 2014), this can only be achieved through high-intensity physical training. For ordinary students who do not undergo high-level athletic training or join competitions, there are fewer opportunities to strengthen fast-twitch muscle fibers and improve sprint/power performance. Furthermore, they may have been selectively undergoing moderate exercise stimuli rather than high-intensity sprints whenever they engage in physical activity. These factors may explain why more than half of the R-allele group chose “endurance” as their preference in type of exercise. Consequently, the ratio of inconsistency or mismatch with muscle functional properties in the R-allele group might be larger than that of XX type.</p><p>On the other hand, it is known that the energy efficiency characteristic of the XX type depends on the myoglobin metabolism in slow muscle fibers (MacArthur et al., 2007; MacArthur et al., 2008; Berman &amp; North, 2010). Instead of anaerobic metabolism in fast-twitch muscle fibers, the reprogramming to oxygenated metabolism in red/slow-twitch muscle fibers makes fatigue-induced cramps less likely. Thus, XX type subjects theoretically have greater advantage in sports that require endurance (Seto et al., 2013; Garton et al., 2014; Head et al., 2015). Most activities of daily living done against gravity, such as standing and walking, are considered as low-intensity or low aerobic level activities. The ratio of consistency with muscle functional properties was greater in the XX type (47.4%) than in the R-allele group (35.6%), and the ratio of inconsistency (31.6%) was smaller than that of the R-allele group (53.3%) as well. In other words, the preferences in the type of exercise may have been influenced by 1) the avoidance of high-intensity exercise stimuli in daily life in general students and 2) the awareness of being poor at sprinting in the XX type who have muscle functional properties more attuned for endurance.</p></sec><sec id="s5"><title>5. Conclusion</title><p>This study assessed the association between ACTN3 genotypes and preference in type of exercise (sprint vs. endurance) in ordinary students who were not exposed to high-intensity exercise stimuli. The results showed that 35.5% in R-allele group (combined RR and RX types) preferred sprint, whereas 47.3% in XX type subjects preferred endurance. In contrast, 53.3% in the R-allele group and 31.6% in XX type subjects preferred endurance and sprint, respectively. Greater inconsistency/mismatch in preference and muscle functional properties was observed in the R-allele group than in the XX type group. It was suggested that exercise experience in non-trained individuals and low exercise stimuli in daily life are factors that affect the consistency of muscle functional properties expected from ACTN3 genotypes. Hence, genotype analysis (ACTN3) might optimize selecting sport events and lead higher physical performances in young boys and girls without adequate exercise experiences.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s7"><title>Cite this paper</title><p>Kawamura, T., Azuma, A., &amp; Matsui, K. (2021). Is ACTN3 R577X Genotype Associated with a Preference in Type of Exercise Such as Sprint or Endurance? Advances in Physical Education, 11, 268-275. https://doi.org/10.4236/ape.2021.112022</p></sec></body><back><ref-list><title>References</title><ref id="scirp.109179-ref1"><label>1</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Ahmetov</surname><given-names> I. I.</given-names></name>,<name name-style="western"><surname> Donnikov</surname><given-names> A. E.</given-names></name>,<name name-style="western"><surname> &amp; Trofimov</surname><given-names> D. Y. </given-names></name>,<etal>et al</etal>. (<year>2014</year>)<article-title>. ACTN3 Genotype Is Associated with Testosterone Levels of Athletes</article-title><source> Biology of Sport</source><volume> 31</volume>,<fpage> 105</fpage>-<lpage>108</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.109179-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Berman, Y., &amp; North, K. N. (2010). A Gene for Speed: The Emerging Role of Alpha-Actinin-3 in Muscle Metabolism. Physiology, 25, 250-259. https://doi.org/10.1152/physiol.00008.2010</mixed-citation></ref><ref id="scirp.109179-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Costill, D. L., Daniels, J., Evans, W., Fink, W., Krahenbuhl, G., &amp; Saltin, B. (1976). Skeletal Muscle Enzymes and Fiber Composition in Male and Female Track Athletes. Journal of Applied Physiology, 40, 149-154. https://doi.org/10.1152/jappl.1976.40.2.149</mixed-citation></ref><ref id="scirp.109179-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Garatachea, N., Verde, Z., Santos-Lozano, A., Yvert, T., Rodriguez-Romo, G., Sarasa, F.J., Hernández-Sánchez, S., Santiago, C., &amp; Lucia, A. (2014). ACTN3 R577X Polymorphism and Explosive Leg-Muscle Power in Elite Basketball Players. International Journal of Sports Physiology and Performance, 9, 226-232. https://doi.org/10.1123/ijspp.2012-0331</mixed-citation></ref><ref id="scirp.109179-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Garton, F. C., Seto, J. T., Quinlan, K. G., Yang, N., Houweling, P. J., &amp; North, K. N. (2014). α-Actinin-3 Deficiency Alters Muscle Adaptation in Response to Denervation and Immobilization. Human Molecular Genetics, 23, 1879-1893. https://doi.org/10.1093/hmg/ddt580</mixed-citation></ref><ref id="scirp.109179-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Head, S. I., Chan, S., Houweling, P. J., Quinlan, K. G., Murphy, R., Wagner, S., Friedrich, O., &amp; North, K. N. (2015). Altered Ca2+ Kinetics Associated with α-Actinin-3 Deficiency May Explain Positive Selection for ACTN3 Null Allele in Human Evolution. PLoS Genetics, 11, e1004862. https://doi.org/10.1371/journal.pgen.1004862</mixed-citation></ref><ref id="scirp.109179-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Houweling, P. J., Papadimitriou, I. D., Seto, J. T., Pérez, L. M., Coso, J. D., North, K. N., Lucia, A., &amp; Eynon, N. (2018). Is Evolutionary Loss Our Gain? The Role of ACTN3 p.Arg577Ter (R577X) Genotype in Athletic Performance, Ageing, and Disease. Human Mutation, 39, 1774-1787. https://doi.org/10.1002/humu.23663</mixed-citation></ref><ref id="scirp.109179-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Lewis, E. K., Haaland, W. C., Nguyen, F., Heller, D. A., Allen, M. J., MacGregor R. R., Berger C. S., Willingham, B., Burns, L. A., Scott, G. B. I., Kittrell, C., Johnson B. R., Curl, R. F., &amp; Metzker, M. L. (2005). Color-Blind Fluorescence Detection for Four-Color DNA Sequencing. Proceedings of the National Academy of Sciences of the United States of America, 102, 5346-5351. https://doi.org/10.1073/pnas.0501606102</mixed-citation></ref><ref id="scirp.109179-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">MacArthur, D. G., Seto, J. T., Chan, S., Quinlan, K. G., Raftery, J. M., Turner, N., Nicholson, M. D., Kee, A. J., Hardeman, E. C., Gunning, P. W., Cooney, G. J., Head, S. I., Yang, N., &amp; North, K. N. (2008). An Actn3 Knockout Mouse Provides Mechanistic Insights into the Association between Alpha-Actinin-3 Deficiency and Human Athletic Performance. Human Molecular Genetics, 17, 1076-1086. https://doi.org/10.1093/hmg/ddm380</mixed-citation></ref><ref id="scirp.109179-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">MacArthur, D. G., Seto, J. T., Raftery, J. M., Quinlan, K. G., Huttley, G. A., Hook, J. W., Lemckert, F. A., Kee, A. J., Edwards, M. R., Berman, Y., Hardeman, E. C., Gunning, P. W., Easteal, S., Yang, N., &amp; North, K. N. (2007). Loss of ACTN3 Gene Function Alters Mouse Muscle Metabolism and Shows Evidence of Positive Selection in Humans. Nature Genetics, 39, 1261-1265. https://doi.org/10.1038/ng2122</mixed-citation></ref><ref id="scirp.109179-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Masaki, T., Endo, M., &amp; Ebashi, S. (1967). Localization of 6S Component of an Alpha-Actinin at Z-Band. Journal of Biochemistry, 62, 630-632. https://doi.org/10.1093/oxfordjournals.jbchem.a128717</mixed-citation></ref><ref id="scirp.109179-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Mikami, E., Fuku, N., Murakami, H., Tsuchie, H., Takahashi, H., Ohiwa, N., Tanaka, H., Pitsiladis, Y. P., Higuchi, M., Miyachi, M., Kawahara, T., &amp; Tanaka, M. (2014). ACTN3 R577X Genotype Is Associated with Sprinting in Elite Japanese Athletes. International Journal of Sports Medicine, 35, 172-177. https://doi.org/10.1055/s-0033-1347171</mixed-citation></ref><ref id="scirp.109179-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Mills, M., Yang, N., Weinberger, R., Vander Woude, D. L., Beggs, A. H., Easteal, S., &amp; North, K. (2001). Differential Expression of the Actin-Binding Proteins, α-Actinin-2 and -3, in Different Species: Implications for the Evolution of Functional Redundancy. Human Molecular Genetics, 10, 1335-1346. https://doi.org/10.1093/hmg/10.13.1335</mixed-citation></ref><ref id="scirp.109179-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">North, K. N., Yang, N., Wattanasirichaigoon, D., Mills, M., Easteal, S., &amp; Beggs, A. H. (1999). A Common Nonsense Mutation Results in Alpha-Actinin-3 Deficiency in the General Population. Nature Genetics, 21, 353-354. https://doi.org/10.1038/7675</mixed-citation></ref><ref id="scirp.109179-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Orysiak, J., Busko, K., Michalski, R., Mazur-Rozycka, J., Gajewski, J., Malczewska-Lenczowska, J., Sitkowski, D., &amp; Pokrywka, A. (2014). Relationship between ACTN3 R577X Polymorphism and Maximal Power Output in Elite Polish Athletes. Medicina, 50, 303-308. https://doi.org/10.1016/j.medici.2014.10.002</mixed-citation></ref><ref id="scirp.109179-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Papadimitriou, I. D., Eynon, N., Yan, X., Munson, F., Jacques, M., Kuang, J., Voisin, S., North, K.N., &amp; Bishop, D. J. (2019). A “Human Knockout” Model to Investigate the Influence of the α-Actinin-3 Protein on Exercise-Induced Mitochondrial Adaptations. Scientific Reports, 9, Article No. 12688. https://doi.org/10.1038/s41598-019-49042-y</mixed-citation></ref><ref id="scirp.109179-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Seto, J. T., Quinlan, K. G., Lek, M., Zheng, XF., Garton, F., MacArthur, D. G., Hogarth, M. W., Houweling, P. J., Gregorevic, P., Turner, N., Cooney, G. J., Yang, N., &amp; North, K. N. (2013). ACTN3 Genotype Influences Muscle Performance through the Regulation of Calcineurin Signaling. Journal of Clinical Investigation, 123, 4255-4263. https://doi.org/10.1172/JCI67691</mixed-citation></ref><ref id="scirp.109179-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Vincent, B., De Bock, K., Ramaekers, M., Van den Eede, E., Van Leemputte, M., Hespel P. J., &amp; Thomis, M. (2007). The ACTN3 (R577X) Genotype Is Associated with Fiber Type Distribution. Physiological Genomics, 32, 58-63. https://doi.org/10.1152/physiolgenomics.00173.2007</mixed-citation></ref><ref id="scirp.109179-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Virel, A., &amp; Backman, L. (2004). Molecular Evolution and Structure of Alpha-Actinin. Molecular Biology and Evolution, 21, 1024-1031. https://doi.org/10.1093/molbev/msh094</mixed-citation></ref><ref id="scirp.109179-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Wyckelsma, V. L., Venckunas, T., Houweling, P. J., Schlittler, M., Lauschke, V. M., Tiong, C. F., Wood, H. D., Ivarsson, N., Paulauskas, H., Eimantas, N., Andersson, D. C., North, K. N., Brazaitis, M., &amp; Westerblad, H. (2021). Loss of α-Actinin-3 during Human Evolution Provides Superior Cold Resilience and Muscle Heat Generation. American Journal of Human Genetics, 108, 446-457. https://doi.org/10.1016/j.ajhg.2021.01.013</mixed-citation></ref><ref id="scirp.109179-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Yang, N., MacArthur, D. G., Gulbin, J. P., Hahn, A. G., Beggs, A. H., Easteal, S., &amp; North, K. (2003). ACTN3 Genotype Is Associated with Human Elite Athletic Performance. American Journal of Human Genetics, 73, 627-631. https://doi.org/10.1086/377590</mixed-citation></ref><ref id="scirp.109179-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Yang, N., MacArthur, D. G., Wolde, B., Onywera, V. O., Boit, M. K., Lau, S. Y., Wilson, R. H., Scott, R. A., Pitsiladis, Y. P., &amp; North, K. (2007). The ACTN3 R577X Polymorphism in East and West African Athletes. Medicine and Science in Sports and Exercise, 39, 1985-1988. https://doi.org/10.1249/mss.0b013e31814844c9</mixed-citation></ref><ref id="scirp.109179-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Yang, R., Shen, X., Wang, Y., Voisin, S., Cai, G., Fu, Y., Xu, W., Eynon, N., Bishop, D. J., &amp; Yan, X. (2017). ACTN3 R577X Gene Variant Is Associated with Muscle-Related Phenotypes in Elite Chinese Sprint/Power Athletes. Journal of Strength and Conditioning Research, 31, 1107-1115. https://doi.org/10.1519/JSC.0000000000001558</mixed-citation></ref></ref-list></back></article>