<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">JBM</journal-id><journal-title-group><journal-title>Journal of Biosciences and Medicines</journal-title></journal-title-group><issn pub-type="epub">2327-5081</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/jbm.2021.93006</article-id><article-id pub-id-type="publisher-id">JBM-107859</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Substrate Stiffness Affected the Inflammatory Response of SMCs
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xiuli</surname><given-names>Mao</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lixuan</surname><given-names>Mao</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hong</surname><given-names>Zhang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yiling</surname><given-names>Tan</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Huali</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>School of Engineering, Computing and Mathematics, Plymouth University, Plymouth, UK</addr-line></aff><aff id="aff1"><addr-line>School of Biomedical Engineering, Shanghai Jiao Tong University, Shanghai, China</addr-line></aff><pub-date pub-type="epub"><day>10</day><month>03</month><year>2021</year></pub-date><volume>09</volume><issue>03</issue><fpage>44</fpage><lpage>54</lpage><history><date date-type="received"><day>8,</day>	<month>February</month>	<year>2021</year></date><date date-type="rev-recd"><day>19,</day>	<month>March</month>	<year>2021</year>	</date><date date-type="accepted"><day>22,</day>	<month>March</month>	<year>2021</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  The pathogenesis of atherosclerosis is accompanied by chronic inflammation with changes in the stiffness of the coronary artery wall. Being the main component of the vascular media, the smooth muscle cells (SMCs) are crucial to maintain blood vessel function. SMCs are mechano-sensitive, which can rapidly adapt to the fluctuations in the microenvironment of the blood vessel, including the subtle changes of the vascular stiffness. However, how substrate stiffness influences the phenotype and inflammatory response of SMCs is not well understood. In this study, we investigated the effects of substrate stiffness on SMCs phenotype, inflammatory gene expression and the nuclear factorkappa B (NFκB) signaling pathway of vascular SMCs. From 1 kPa to 100 kPa, the SMCs cytoskeleton became more and more organized with the increase of the substrate stiffness, representing by the uniformed distribution of the stress fibers. SMCs cultured on both soft (1 kPa) and hard (100 kPa) substrate increased the expression of macrophage marker CD68 molecule (CD68) and Galectin 3 (LGALS3) and the inflammatory gene Interleukin-6 (IL-6) and Interleukin-1β (IL-1β) than those on 40 kPa substrate. Moreover, the protein expression level of phosphorylated nuclear factor kappa B inhibitor (p-IκB) was higher on either soft (1 kPa) or hard (100 kPa) substrate. In consistent, the dephosphorylated IκB showed a higher expression level on the substrate stiffness of 40 kPa. These results suggested that substrate stiffness played an important role in SMCs cell morphology, phenotype and inflammatory response by affecting NFκB signaling pathway.
 
</p></abstract><kwd-group><kwd>Vascular Smooth Muscle Cells</kwd><kwd> Substrate Stiffness</kwd><kwd> Inflammatory Response</kwd><kwd> NFκB</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Atherosclerosis, a major cause of heart attack and stroke, is associated with chronic inflammation in the coronary arteries [<xref ref-type="bibr" rid="scirp.107859-ref1">1</xref>]. Innate immune cells such as macrophages are the main cause of vascular inflammation. Studies have shown that in the early stage of atherosclerosis, monocytes adhere to endothelial cells, migrate to the intima, and then mature into macrophages [<xref ref-type="bibr" rid="scirp.107859-ref2">2</xref>]. Macrophages play an important role in atherosclerotic formation, including the clearance of lipoproteins, cytokines and reactive oxygen, which may lead to plaque rupture and thrombosis [<xref ref-type="bibr" rid="scirp.107859-ref3">3</xref>]. More recently, Bennett and Sinha et al. found that smooth muscle cells in atherosclerotic plaques can change their phenotype to macrophage-likecells, and then affect the inflammation of the blood vessels [<xref ref-type="bibr" rid="scirp.107859-ref4">4</xref>]. It has been reported that more than 50% of CD68<sup>+</sup> foam cells are SMCs-derived in atherosclerotic lesion [<xref ref-type="bibr" rid="scirp.107859-ref5">5</xref>].</p><p>Moreover, the vascular environment could change with the development of atherosclerosis. The deposition of lipoproteins in the blood vessels will soften the blood vessels. Subsequently, excessive lipid leads to extracellular matrix, fibrous tissue hyperplasia and calcareous deposition, which gradually increases vascular stiffness, and finally affects the vascular environmental homeostasis [<xref ref-type="bibr" rid="scirp.107859-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.107859-ref7">7</xref>]. In the physiological state, the stiffness of aorta is about 40 kPa. In contrast, the pathological condition could cause stiffness to decrease to as low as 1 kPa and increase to even 100 kPa [<xref ref-type="bibr" rid="scirp.107859-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.107859-ref9">9</xref>]. Substrate stiffness can affect the chemotaxis and adhesion of monocytes by regulating the microRNA expression level of endothelial cells [<xref ref-type="bibr" rid="scirp.107859-ref10">10</xref>]. Meanwhile, SMCs can also sense and respond to substrate stiffness changes in the vascular wall, causing phenotypic switching. Tian et al. found that as substrate stiffness increases, SMCs transform from a synthetic phenotype to a contractile phenotype, and substrate stiffness regulates SMCs matrix remodeling through TGF-β signal pathway. [<xref ref-type="bibr" rid="scirp.107859-ref11">11</xref>]. Hence, it is necessary to explore the effects of substrate stiffness on the SMCs’ immune response in the atherosclerosis.</p><p>Nuclear transcription factor κB (NFκB), the central transcriptional control point in vascular inflammation, is a key regulator in atherosclerosis. Furthermore, NFκB plays a vital role in a complex system that allows cells to adapt and respond to environmental changes. The activation of NFκB depends on phosphorylation-induced degradation of the NFκB protein inhibitor IκB [<xref ref-type="bibr" rid="scirp.107859-ref12">12</xref>]. It has been reported that the activation of NFκB can be induced by both physically (ultraviolet exposure) and physiologically (ischemia) factors [<xref ref-type="bibr" rid="scirp.107859-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.107859-ref14">14</xref>]. There is an evidence that NFκB was activated by low extracellular Mg<sup>2+</sup> in cerebrovascular smooth muscle cells [<xref ref-type="bibr" rid="scirp.107859-ref15">15</xref>]. Macrophages also have been shown to induce the expression of associated inflammatory cytokines (IL-6, TNF-α, IL-1) through the activation of NFκB [<xref ref-type="bibr" rid="scirp.107859-ref16">16</xref>].</p><p>Therefore, the effects of substrate stiffness on the SMCs, including cells morphology, phenotype and immune response were studied. Furthermore, whether NFκB signaling pathway was activated in response of SMCs to the substrate stiffness was also investigated.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Cell Culture and Treatment</title><p>The human aortic smooth muscle cells (SMCs) were grown in SMCs medium (Scien Cell, USA), supplemented with 2% fetal bovine serum, 1% penicillin/streptomycin, and 1% smooth muscle cell growth supplement. SMCs were cultured in a 37˚C incubator (Corning, USA) with the supplement of 5% CO<sub>2</sub>.</p><p>The SMCs were cultured on polyacrylamide hydrogels with different stiffness for 24 hours before proceeding to the experiments.</p></sec><sec id="s2_2"><title>2.2. Preparation of Substrates with Different Stiffness</title><p>Poly-acrylamide hydrogel substrates with different stiffness were prepared as described previously by adjusting the ratio of 40% acrylamide (w/v) (Sangon Biotech, China) to 2% bis-acrylamide (w/v) (Sangon Biotech, China) [<xref ref-type="bibr" rid="scirp.107859-ref11">11</xref>]. Tetramethylethylenediamine (Klamar, China) and 10% ammonium persulfate solution (Sinopharm, China) were added to the mixture for cross-linking. Before polymerization, the mixture was added to a glass slide and a silicified cover glass was put on the gel droplets to form a leveled surface. On completion of the polymerization, the glass slide was removed and the cover glass with the substrates were treated with sulfo-SANPAH (Thermo Fisher, USA) and coated with 1 mg/mL Collagen Type I (Corning, USA) to facilitate cell adhesion. The stiffness of the substrates were measured by an atomic force microscope. The substrates were sterilized by UV and 75% alcohol for 30 minutes before cell culture.</p></sec><sec id="s2_3"><title>2.3. Real-Time Quantitative PCR (RT-qPCR)</title><p>Total RNA was extracted from SMCs using the RNA simple Total RNA Extraction kit (TIANGEN, China). Reverse transcription was performed using the Fastking RT kit with gDNase (TIANGEN, China). For RT-qPCR, the SuperRealPreMix Plus kit (SYBR Green) (TIANGEN, China) was used. The primer pairs sequences were listed in <xref ref-type="table" rid="table1">Table 1</xref>. The mRNA expression of the targetgene was expressed as fold of change to GAPDH control.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> RT-qPCR primer sequences</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Forward primer (5’-3’)</th><th align="center" valign="middle" >Reverse primer (5’-3’)</th></tr></thead><tr><td align="center" valign="middle" >GAPDH</td><td align="center" valign="middle" >GGGAAGGTGAAGGTCGGAGT</td><td align="center" valign="middle" >GGGGTCATTGATGGCAACA</td></tr><tr><td align="center" valign="middle" >MYH11</td><td align="center" valign="middle" >GCTCAGAAAGTTTGCCACCTC</td><td align="center" valign="middle" >CATCCGCCCAACCTTGATA</td></tr><tr><td align="center" valign="middle" >IL-6</td><td align="center" valign="middle" >ATGAGGAGACTTGCCTGGTG</td><td align="center" valign="middle" >GTGAGGAACAAGCCAGAGCT</td></tr><tr><td align="center" valign="middle" >IL-1β</td><td align="center" valign="middle" >TCTTCATTGCTCAAGTGTCTG</td><td align="center" valign="middle" >TGCCACTGTAATAAGCCATC</td></tr><tr><td align="center" valign="middle" >LGALS3</td><td align="center" valign="middle" >CATGCTGATAACAATTCTGGG</td><td align="center" valign="middle" >GGTTAAAGTGGAAGGCAACAT</td></tr></tbody></table></table-wrap></sec><sec id="s2_4"><title>2.4. Western Blotting</title><p>Total SMCs lysates were extracted in the plus RIPA lysis buffer (Beyotime, China) with protease and phosphatase inhibitor. BCA Protein Assay Kit (Thermo Scientific, USA) was used to quantify the protein concentration. Equal amount of the total cell lysates was subject to the SDS-PAGE, and transferred to PVDF membrane. After 10% BSA blocking, primary antibodies of CD68 (Abcam, UK), p-IκB (Cell Signaling Technology, USA), IκB (Cell Signaling Technology, USA), GAPDH (Cell Signaling Technology, USA) and α-Tubulin (Cell Signaling Technology, USA) were incubated overnight at 4˚C, respectively. HRP-conjugated secondary antibodies (Cell Signaling Technology, USA) were incubated for 1hour at room temperature. The bands were visualized by Immobilon western chemiluminescent HRP substrate (Merck Millipore, Germany). The protein expression was normalized to α-Tubulin (Cell Signaling Technology, USA) in the respective samples.</p></sec><sec id="s2_5"><title>2.5. Immunofluorescence Staining and Image Processing</title><p>SMCs were fixed in 4% (w/v) PFA for 10 minutes. Then, F-actin was stained with phalloidin conjugated with iFluorTM488 (AAT Bioquest, USA) for 90 minutes. Finally, cell nucleus was stained with DAPI for 5 minutes. Images were captured under a laser scanning confocal microscope (Leica TCS SP5 II, Germany).</p><p>For image processing, as described in Z. P&#252;sp&#246;ki et al. [<xref ref-type="bibr" rid="scirp.107859-ref17">17</xref>], the local orientation properties of images are computed according to the Orientation J software and were then visualized as color images with the orientation being typically encoded in the color (hue).</p></sec><sec id="s2_6"><title>2.6. Statistical Analysis</title><p>For all the experiments, at least 3 independent trials were performed. Unless otherwise indicated, data were expressed as mean &#177; SEM. Pairwise comparisons were made using a Student t-test. Comparison of three or more groups was performed using One-way ANOVA. A value of *p &lt; 0.05 was considered statistically significant. Data were analyzed by GraphPad Prism 6.0 software.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Substrate Stiffness Affected SMCs Morphology.</title><p>SMCs were grown on different stiffness for 24 hours and subjected to phalloidin staining for F-actin filaments representing the stress fibers in the cell. The morphology of SMCs exhibited significant difference and the average F-acting fluorescence intensity increased with the increase of substrate stiffness (<xref ref-type="fig" rid="fig1">Figure 1</xref>(A) and <xref ref-type="fig" rid="fig1">Figure 1</xref>(B)). The F-actin stress fiber orientation colormaps (<xref ref-type="fig" rid="fig1">Figure 1</xref>(C)) were analyzed by Orientation J software. The color maps of actin stress fibers showed that SMCs on the 1 kPa substrate exhibited mixed colors, whereas the color maps for SMCs on 40 and 100 kPa substrate exhibited similar colors. In</p><p>addition, the distribution of stress fibers orientation on different substrate stiffness were counted. The results showed that, with the increasing of substrate stiffness, the distribution of stress fibers orientation is more condensed, indicating a more organized overall SMCs cytoskeleton (<xref ref-type="fig" rid="fig1">Figure 1</xref>(D)). Taken together, these results suggested that substrate stiffness affected SMCs morphology and cytoskeleton organization.</p></sec><sec id="s3_2"><title>3.2. Substrate Stiffness Regulated SMCs Phenotype</title><p>SMC is an undifferentiated cell type with significant phenotypic plasticity. It has been shown that increased extracellular substrate stiffness drives the development of arterial pathology and changes the phenotype of vascular cells. We analyzed the effect of substrate stiffness on the phenotype of SMCs. With the treatment of different stiffness, the gene expression of SMC contractile maker MYH11 and the macrophage marker LGALS3 and CD68 were examined. The results showed the expression of SMC contractile maker MYH11 was increased (<xref ref-type="fig" rid="fig2">Figure 2</xref>(A)) with the increase of substrate stiffness. And SMCs expressed higher LGALS3 on both soft (1 kPa) and hard (100 kPa) substrates (<xref ref-type="fig" rid="fig2">Figure 2</xref>(B)) than on 40 kPa substrate. Consistently, the Western blotting results showed that the expression level of CD68 was the lowest on 40 kPa substrate (<xref ref-type="fig" rid="fig2">Figure 2</xref>(C), <xref ref-type="fig" rid="fig2">Figure 2</xref>(D)).</p></sec><sec id="s3_3"><title>3.3. Substrate Stiffness Affected SMCs Inflammatory Response</title><p>The acquisition of macrophage phenotypes is associated with inflammatory responses. To further explore the inflammatory response of SMCs on different</p><p>substrate stiffness, the expression of inflammation-related genes was examined in this study. RT-qPCR results showed that, same as the LGALS3 and CD68 the gene expression of IL-6 and IL-1β were higher on both soft (1 kPa) and hard (100 kPa) substrates (<xref ref-type="fig" rid="fig3">Figure 3</xref>(A), <xref ref-type="fig" rid="fig3">Figure 3</xref>(B)). SMCs on the 40 kPa substrate shown a relatively low level of gene expression, suggesting lower inflammation on 40 kPa substrate.</p></sec><sec id="s3_4"><title>3.4. Substrate Stiffness Affected NFκB Signaling Pathway of SMCs</title><p>In vivo and in vitro experiments studies have shown that NFκB is activated in an inflammatory environment. Here, the Western blotting analysis used to detect the activity of NFκB signaling related molecules. The results showed that, compared with the 40 kPa, the protein expression of p-IκB was higher at 1 kPa and 100 kPa. On the contrary, the protein level of IκB was lower at 40 kPa than that on 1 kPa and 100 kPa substrates (<xref ref-type="fig" rid="fig4">Figure 4</xref>). These results suggested that NFκB signaling pathway was involved in the inflammatory response of SMCs.</p></sec></sec><sec id="s4"><title>4. Discussion and Conclusion</title><p>In the process of atherosclerosis, the vascular microenvironment, such as high lipid, reactive oxygen species, substrate stiffness, will change, and then affect the development of lesions. Studies have shown that, compared with normal arteries, the aortic elastic modulus of rabbits fed with high cholesterol gradually decreased within 1 - 8 weeks. Afterwards, with the development of the lesion, the elastic modulus of the aorta gradually increases until calcification [<xref ref-type="bibr" rid="scirp.107859-ref18">18</xref>]. Meanwhile, studies have shown that vascular remodeling may contribute to medial and intimal calcification and increase vascular stiffness [<xref ref-type="bibr" rid="scirp.107859-ref19">19</xref>]. Therefore, it is meaningful to pay attention to the effect of substrate stiffness on the function and structure of vascular cells.</p><p>Smooth muscle cells are the main component of the vascular media. Their main function is contract, which can regulate the tension of blood vessels and maintain blood vessel function [<xref ref-type="bibr" rid="scirp.107859-ref20">20</xref>]. In addition, smooth muscle cells exhibit significant phenotypic plasticity and they can rapidly adapt to fluctuating environmental signals [<xref ref-type="bibr" rid="scirp.107859-ref21">21</xref>]. More and more evidences show that SMCs have undergone significant cytoskeletal remodeling during migration and phenotypic transformation [<xref ref-type="bibr" rid="scirp.107859-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.107859-ref22">22</xref>]. It is reported that vasoconstrictors and vasodilators can induce changes in vascular smooth muscle cytoskeletal remodeling [<xref ref-type="bibr" rid="scirp.107859-ref23">23</xref>]. Our results also showed that substrate stiffness affected SMCs cytoskeleton remodels and phenotypic transformation. The SMCs cytoskeleton were progressively disrupted following the decreasing substrate stiffness (<xref ref-type="fig" rid="fig1">Figure 1</xref>). In addition, in vitro studies, the substrate stiffness showed a significant effect on the autophagy of smooth muscle cells. With the increment of substrate stiffness, the level of autophagy of smooth muscle cells increased and the phenotypic transition of smooth muscle cells was activated [<xref ref-type="bibr" rid="scirp.107859-ref24">24</xref>]. Our results showed that as the stiffness of the substrate changes, SMCs showed a phenotypic switch to foam cells. SMCs expressed higher LGALS3 and CD68 on both soft (1 kPa) and hard (100 kPa) substrates maybe because 1 kPa and 100 kPa substrate stiffness are the pathological stiffness of atherosclerosis which more easily to induce SMCs phenotypic transformation.</p><p>It is well known that atherosclerosis is intimately linked with inflammation. Studies have shown that the inflammation-related genes including IL-6, IL-1β, MCP-1, VCAM-1, etc. showed a significantly up-regulated in atherosclerotic susceptible areas [<xref ref-type="bibr" rid="scirp.107859-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.107859-ref25">25</xref>]. The inflammatory response of SMCs on variational substrate stiffnesses was investigated in this study. Compared with the middle substrate stiffness (40 kPa), the expression of inflammatory factors IL-6 and IL-1β are higher on the softer (1 kPa) and harder (100 kPa) substrate stiffness, which means that a moderate substrate stiffness is beneficial to cellular function. In addition, NFκB is a key regulator of inflammation and atherosclerosis [<xref ref-type="bibr" rid="scirp.107859-ref26">26</xref>]. The activation of NFκB can be initiated under cytokine signaling or environmental stress [<xref ref-type="bibr" rid="scirp.107859-ref27">27</xref>]. Typical pathways for NFκB activation include the rapid degradation of IκB by proteasomes, and the release of NFκB subunits. Then, the NFκB subunits translocate to the nucleus and bind to homologous DNA motifs of target genes to promote transcription [<xref ref-type="bibr" rid="scirp.107859-ref28">28</xref>]. Autieri and Yue et al. found that activation of NFκB signaling pathway could inhibit the adhesion and proliferation of human vascular smooth muscle cells and can prevent the formation of new intima in rat carotid arteries [<xref ref-type="bibr" rid="scirp.107859-ref29">29</xref>]. Interestingly, our results showed that SMCs had higher expression of p-IκB on softer (1 kPa) and harder (100 kPa) substrate stiffness to promote inflammation. It is suggested that a reasonable substrate stiffness can suppress SMCs inflammation by regulating NFκB signal pathway.</p><p>In summary, this study found that substrate stiffness regulated SMCs morphology and cytoskeleton organization. Furthermore, substrate stiffness also affected the phenotypic transformation and inflammatory response of SMCs by activating NFκB signaling pathway. This is complementary to our current understanding of the mechanism and pathogenesis of atherosclerosis.</p></sec><sec id="s5"><title>Conflicts of Interest</title><p>The authors report no commercial or proprietary interest in any product or concept discussed in this article.</p></sec><sec id="s6"><title>Cite this paper</title><p>Mao, X.L., Mao, L.X., Zhang, H., Tan, Y.L. and Wang, H.L. (2021) Substrate Stiffness Affected the Inflammatory Response of SMCs. Journal of Biosciences and Medicines, 9, 44-54. https://doi.org/10.4236/jbm.2021.93006</p></sec></body><back><ref-list><title>References</title><ref id="scirp.107859-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Denk, A., Goebeler, M., Schmid, S., Berberich, I., Ritz, O., Lindemann, D., Ludwig, S. and Wirth, T. (2001) Activation of NF-kappa B via the Ikappa B Kinase Complex Is Both Essential and Sufficient for Proinflammatory Gene Expression in Primary Endothelial Cells. Journal of Biological Chemistry, 276, 28451-28458. https://doi.org/10.1074/jbc.M102698200</mixed-citation></ref><ref id="scirp.107859-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Oeckinghaus, A. and Ghosh, S. (2009) The NF-κB Family of Transcription Factors and Its Regulation. Cold Spring Harbor Symposia on Quantitative Biology, 1, a000034. https://doi.org/10.1101/cshperspect.a000034</mixed-citation></ref><ref id="scirp.107859-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Autieri, M.V., Yue, T.L., Ferstein, G.Z. and Ohlstein, E. (1995) Antisense Oligonucleotides to the p65 Subunit of NF-κB Inhibit Human Vascular Smooth Muscle Cell Adherence and Proliferation and Prevent Neointima Formation in Rat Carotid Arteries. Biochemical and Biophysical Research Communications, 213, 827-836. https://doi.org/10.1006/bbrc.1995.2204</mixed-citation></ref><ref id="scirp.107859-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Kempe, S., Kestler, H., Lasar, A. and Wirth, T. (2005) NF-κB Controls the Global Pro-Inflammatory Response in Endothelial Cells: Evidence for the Regulation of a Proatherogenic Program. Nucleic Acids Research, 33, 5308-5319. https://doi.org/10.1093/nar/gki836</mixed-citation></ref><ref id="scirp.107859-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Liang, J.Q., Gu, S.Y., Mao, X.L., Tan, Y.L., Wang, H.L., Li, S. and Zhou, Y. (2020) Endothelial Cell Morphology Regulates Inflammatory Cells through microRNA Transferred by Extracellular Vesicles. Frontiers in Bioengineering and Biotechnology, 19, 369. https://doi.org/10.3389/fbioe.2020.00369</mixed-citation></ref><ref id="scirp.107859-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Fang, Y., Shi, C.Z., Manduchi, E., Civelek, M. and Davies, P.F. (2010) Microrna-10a Regulation of Proinflammatory Phenotype in Athero-Susceptible Endothelium in Vivo and in Vitro. Proceedings of the National Academy of Sciences of the United States of America, 107, 13450-13455. https://doi.org/10.1073/pnas.1002120107</mixed-citation></ref><ref id="scirp.107859-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Hu, M., Jia, F., Huang, W.P., Li, X., Hu, D.F., Wang, J., Ren, K.F., Fu, G.S., Wang, Y.-B. and Ji, J. (2020) Substrate Stiffness Differentially Impacts Autophagy of Endothelial Cells and Smooth Muscle Cells. Bioactive Materials, 6, 1413-1422. https://doi.org/10.1016/j.bioactmat.2020.10.013</mixed-citation></ref><ref id="scirp.107859-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Hong, Z.K., Reeves, K.J., Sun, Z., Li, Z.H., Brown, N.J. and Meininger, G.A. (2015) Vascular Smooth Muscle Cell Stiffness and Adhesion to Collagen I Modified by Vasoactive Agonists. PLoS ONE, 10, e0119533. https://doi.org/10.1371/journal.pone.0119533</mixed-citation></ref><ref id="scirp.107859-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Kappert, K., Blaschke, F., Meehan, W.P., Kawano, H., Grill, M., Fleck, E, Hsueh, W.A., Law, R.E. and Graf, K. (2001) Integrins Alphavbeta3 and Alphavbeta5 Mediate VSMC Migration and Are Elevated During Neointima Formation in the Rat Aorta. Basic Research in Cardiology, 96, 42-49. https://doi.org/10.1007/s003950170076</mixed-citation></ref><ref id="scirp.107859-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Gomez, D. and Owens, G.K. (2012) Smooth Muscle Cell Phenotypic Switching in Atherosclerosis. Cardiovascular Research, 95, 156-164. https://doi.org/10.1093/cvr/cvs115</mixed-citation></ref><ref id="scirp.107859-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Chang, W.G. and Niklason, L.E. (2017) A Short Discourse on Vascular Tissue Engineering. NPJ Regenerative Medicine, 2, 7. https://doi.org/10.1038/s41536-017-0011-6</mixed-citation></ref><ref id="scirp.107859-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Rattazzi, M., Bertacco, E., Puato, M., Faggin, E. and Pauletto, P. (2012) Hypertension and Vascular Calcification: A Vicious Cycle? Journal of Hypertension, 30, 1885-1893. https://doi.org/10.1097/HJH.0b013e328356c257</mixed-citation></ref><ref id="scirp.107859-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Püspoki, Z., Storath, M., Sage, D. and Unser, M. (2016) Transforms and Operators for Directional Bioimage Analysis: A Survey. Advances in Anatomy, Embryology and Cell Biology, 219, 69-93. https://doi.org/10.1007/978-3-319-28549-8_3</mixed-citation></ref><ref id="scirp.107859-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Liddle, D.M., Monk, J.M., Hutchinson, A.L., Ma, D.W.L. and Robinson, L.E. (2019) CD8+ T Cell/Adipocyte Inflammatory Cross Talk and Ensuing M1 Macrophage Polarization Are Reduced by Fish-Oil-Derived n-3 Polyunsaturated Fatty Acids, in Part by a TNF-Alpha-Dependent Mechanism. Journal of Nutritional Biochemistry, 76, Article ID: 108243. https://doi.org/10.1016/j.jnutbio.2019.108243</mixed-citation></ref><ref id="scirp.107859-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Altura, B.M., Kostellow, A.B., Zhang, A.M., Li, W.Y., Morrill, G.A., Gupta, R.K. and Altura, B.T. (2003) Expression of NFB and Proto-Oncogenes c-fos and c-jun Are Induced by Low Magnesium in Aortic and Cerebral Vascular Smooth Muscle Cells: Possible Link to Hypertension, Atherogenesis, and Stroke. American Journal of Hypertension, 16, 701-707. https://doi.org/10.1016/S0895-7061(03)00987-7</mixed-citation></ref><ref id="scirp.107859-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Xia, J.B., Liu, G.H., Chen, Z.Y., Mao, C.Z., Zhou, D.C., Wu, H.Y., Park, K.S., Zhao, H., Kim, S.K., Cai, D.Q. and Qi, X.F. (2016) Hypoxia/Ischemia Promotes CXCL10 Expression in Cardiac Microvascular Endothelial Cells by NF-κB Activation. Cytokine, 81, 63-70. https://doi.org/10.1016/j.cyto.2016.02.007</mixed-citation></ref><ref id="scirp.107859-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Verma, A., Kushwaha, H.N., Srivastava, A.K., Srivastava, S., Jamal, N., Srivastava, K. and Ray, R.S. (2017) Piperine Attenuates UV-R Induced Cell Damage in Human Keratinocytes via NF-κB, Bax/Bcl-2 Pathway: An Application for Photoprotection. Journal of Photochemistry and Photobiology B Biology, 172, 139-148. https://doi.org/10.1016/j.jphotobiol.2017.05.018</mixed-citation></ref><ref id="scirp.107859-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Baeuerle, P.A. and Henkel, T. (1994) Function and Activation of NF-κB in the Immune System. Annual Review of Immunology, 12, 141-179. https://doi.org/10.1146/annurev.iy.12.040194.001041</mixed-citation></ref><ref id="scirp.107859-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Tian, B.X., Ding, X.L., Song, Y., Chen, W.C., Liang, J.Q., Yang, L., Fan, Y.B., Li, S. and Zhou, Y. (2019) Matrix Stiffness Regulates SMC Functions via TGF-β Signaling Pathway. Biomaterials, 221, Article ID: 119407. https://doi.org/10.1016/j.biomaterials.2019.119407</mixed-citation></ref><ref id="scirp.107859-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Chen, W.C., Tian, B.X., Liang, J.Q., Yu, S.Y., Zhou, Y. and Li, S. (2019) Matrix Stiffness Regulates the Interactions between Endothelial Cells and Monocytes. Biomaterials, 221, Article ID: 119362. https://doi.org/10.1016/j.biomaterials.2019.119362</mixed-citation></ref><ref id="scirp.107859-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Matsumoto, T., Abe, H., Ohashi, T., Kato, Y. and Sato, M. (2002) Local Elastic Modulus of Atherosclerotic Lesions of Rabbit Thoracic Aortas Measured by Pipette Aspiration Method. Physiological Measurement, 23, 635-648. https://doi.org/10.1088/0967-3334/23/4/304</mixed-citation></ref><ref id="scirp.107859-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Tracqui, P., Broisat, A., Toczek, J., Mesnier, N., Ohayon, J. and Riou, L. (2011) Mapping Elasticity Moduli of Atherosclerotic Plaque in Situ via Atomic Force Microscopy. Journal of Structural Biology, 174, 115-123. https://doi.org/10.1016/j.jsb.2011.01.010</mixed-citation></ref><ref id="scirp.107859-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Lyle, A.N. and Raaz, U. (2018) Killing Me Un-Softly: Causes and Mechanisms of Arterial Stiffness. Arteriosclerosis, Thrombosis, and Vascular Biology, 37, e1-e11. https://doi.org/10.1161/ATVBAHA.116.308563</mixed-citation></ref><ref id="scirp.107859-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Dubland, J.A. and Francis, G.A. (2016) So Much Cholesterol: The Unrecognized Importance of Smooth Muscle Cells in Atherosclerotic Foam Cell Formation. Current Opinion in Lipidology, 27, 155-161. https://doi.org/10.1097/MOL.0000000000000279</mixed-citation></ref><ref id="scirp.107859-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Allahverdian, S., Chehroudi, A.C., McManus, B.M., Abraham, T. and Francis, G.A. (2014) Contribution of Intimal Smooth Muscle Cells to Cholesterol Accumulation and Macrophage-Like Cells in Human Atherosclerosis. Circulation, 129, 1551-1559. https://doi.org/10.1161/CIRCULATIONAHA.113.005015</mixed-citation></ref><ref id="scirp.107859-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Bennett, M.R., Sinha, S. and Owens, G.K. (2016) Vascular Smooth Muscle Cells in Atherosclerosis. Circulation Research, 118, 692-702. https://doi.org/10.1161/CIRCRESAHA.115.306361</mixed-citation></ref><ref id="scirp.107859-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Moore, K.J., Sheedy, F.J. and Fisher, E.A. (2013) Macrophages in Atherosclerosis: A Dynamic Balance. Nature Reviews Immunology, 13, 709-721. https://doi.org/10.1038/nri3520</mixed-citation></ref><ref id="scirp.107859-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Moore, K.J. and Tabas, I. (2011) Macrophages in the Pathogenesis of Atherosclerosis. Cell, 145, 341-355. https://doi.org/10.1016/j.cell.2011.04.005</mixed-citation></ref><ref id="scirp.107859-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Libby, P. (2012) Inflammation in Atherosclerosis. Arteriosclerosis, Thrombosis, and Vascular Biology, 32, 2045-2051. https://doi.org/10.1161/ATVBAHA.108.179705</mixed-citation></ref></ref-list></back></article>