The mAbs specific for Thy-1/CD90 (clone 30H12), CD48 (clone OX78), TCRCβ (clone H57-597), CD4 (clone GK1.5), CD8 (clone 53-5.8), CD3ε (clone 2C11), IL-2 (S4B6) and anti-IL-2 isotype control (rat IgG2) were affinity-purified from their respective hybridoma cultures and coupled or not to fluorophores or biotin at the Sunnybrook Research Institute Antibody Facility. The fluorophore-labeled mAb specific for Sca-1/Ly-6A/E (clone D7) was purchased from BD Pharmingen, the mAb specific for IgM (clone 1B4B1) and the PE-conjugated rat IgG2a isotype control for PD-L1 (clone eBR2a) were purchased from eBiosciences. PE-conjugated rat anti-mouse PD-L1 (clone MIH5), hamster anti mouse PD-1 (clone J43) and hamster IgG2κ isotype control for PD-1 were purchased from BD Biosciences. The T5 mAb against anti-T.gondii GPI anchor (clone T5-4E10) was obtained through BEI Resources, Manassas, VA [15].

PD-L1-Fc [16] was purchased from R&D Systems and its isotype control, ChromPure Human IgG was bought from Jackson ImmunoResearch. PD-L1.HIS and CEA.N.HIS were a generous gift from Drs. Jean Gariepy and Aaron Prodeus at the Sunnybrook Research Institute. CEA-N.HIS was expressed and purified as reported previously [17] and used as the control for PD-L1.HIS as they both contain an IgV N-terminal domain and are of similar size. PD-L1.HIS was generated by cloning the extracellular domain of murine PD-L1 into pET30b (Novagen) in frame with a N-terminal histidine tag. After E. coli (BL21 strain, Invitrogen) transformation with this construct, protein expression was induced with 1 mM IPTG for 4 hrs at 37˚C, the cells were lysed and inclusion bodies collected by centrifugation. Pellets were lysed in a buffer containing 8 M urea, 50 mM Tris pH8.0, 250 mM NaCl and 10 mM β-mercaptoethanol and the solution was passed through a NI-NTA column. The histidine-tagged protein was eluted in 250 mM imidazole and refolded by dialysis against Tris buffer saline pH8.0 at 4˚C. The purity of the final recombinant protein was confirmed by SDS-PAGE.

Clone 2.10 is an IL-2-dependent, CD4⁻ murine T cell clone, specific for ovalbumin (OVA) peptide residues 143 - 157 in the context of I-A^b. Clone 2.10 was cultured in serum-free Iscove’s Modified Dulbecco’s Media (IMDM) base supplemented with 3 ng/ml recombinant murine IL-2 and 0.1% L-α-Phosphatidylcholine (soybean lecithin) (Sigma-Aldrich) as previously described [18]. The 2.10 GPI⁻ variant was isolated from the total 2.10 population based on the loss of CD90 expression. The 2.10 MIEV-0 and MIEV-Pigp variants were obtained by infection of 2.10 GPI⁻ clones with the GFP-expressing, bicistronic pMIEV retroviral vector containing or not the Pigp cDNA. Infected GFP⁺ cells were then sorted for CD90 expression (MIEV-Pigp) or not (MIEV-0) to obtained stable infectant populations.

The Piga^flox mice were acquired from Dr. Taroh Kinoshita [19] and bred with mice transgenic for the Cre recombinase driven by the T cell-specific Lck proximal promoter (Jackson Laboratories, stock #003802) for the generation of Lck-Cre/Piga^floxmice. F2 progeny generated T lymphocyte-specific Piga disruption and are referred to as Piga^−/−. Mice lacking Cre expression, yet positive for loxP maintained the expression of GPI-AP and are used as littermate control mice, and referred to here as Piga^+/+.

Heterozygous mice of strain C57BL/6NTac-PigU^{tm1a(EUCOMM)Hmgu}/lcsOrl were acquired from the European Mouse Mutant Archive (EMMA) and bred with the FLP strain C57BL/6NTac-Gt(ROSA)26Sor^{tm2(CAG-flpo,-EYFP)Ics}/Ics at the TAAM (Transgénèse et Archivage d’Animaux Modèles, CNRS, France) to obtain mice bearing the conditional allele Tm1c. To establish the strain on a C57BL/6J background, the Tm1c mice were subsequently backcrossed with C57BL/6J mice expressing the Lck driven-Cre recombinase (Jackson Laboratories, stock #003802) for 5, 8 and 10 generations. The progeny of each of these backcrosses were intercrossed to generate mice with conditional GPI-AP deficiency exclusively on T cells and used in the presented experiments and referred to here as Pigu^−/−. Importantly, no differences in experimental results were noted using intercrossed mice at each of these backcross generations. Mice lacking Cre expression, yet positive for loxP maintained the expression of GPI-AP and were used as littermate control mice, and referred to here as Pigu^+/+. Genotyping was performed using primers and cycling conditions recommended by EMMA. Backcross 10 C57BL/6J Pigu floxed mice are available at The Jackson Laboratory as stock #034291.

All mice were housed and bred within specific pathogen-free conditions and all animal procedures were approved by Sunnybrook Research Institute Animal Care Committee, following guidelines of the Canadian Council on Animal Care.

Primary CD4⁺ or CD8⁺ T cells were purified from the spleens of 6 - 12 weeks old mice using the EasySep^TM CD4⁺ or CD8⁺ T cell isolation kit (STEMCELL Technologies). For the purification of GPI⁻ primary T cells, the selection cocktail was supplemented with biotinylated anti-CD90. T cell preparations were consistently found to be >92% - 95% CD4⁺TCRαβ⁺CD90⁺ for GPI-AP⁺ cells and >90% - 95% CD4⁺TCRαβ⁺CD90⁻ for GPI-AP⁻ cells as assessed flow cytometrically.

Flow cytometric analysis was performed following labelling of 1 × 10⁵ cells in 100 μl of PBS+3%FCS with the indicated fluorochrome-labelled antibodies at concentrations recommended by the manufacturer/in-house facility. After incubation for 10 minutes at 4˚C, the cells were washed using PBS+3%FCS, and resuspended in PBS+3%FCS with the addition of propidium iodide as a viability marker. Flow cytometric analyses were performed on either a FACS Calibur or LSRII (BD Biosciences) and data files were analyzed with FlowJo software (Tree Star). Viable cells were gated using forward/side scatter and exclusion of propidium iodide-positive cells.

For antigen-induced proliferation, 2.5 × 10⁴ 2.10 T cells were cultured with 5 μg/ml OVA^143-157 peptide (Canpeptide), and 5 × 10⁵ irradiated splenocytes isolated from 6 - 10 week old C57BL/6 mice (Jackson Laboratories) in 96-well (Corning Costar) plates. For mAb-mediated proliferation, 2 × 10⁴ 2.10 T cells, or 4 × 10⁴ primary T cells were cultured in 96-well plates pre-coated overnight at 4˚C with the indicated concentrations of anti-TCRCβ or anti-CD3ε. Triplicate cultures were pulsed with 1μCi ³H-TdR, harvested 6 hours later on Unifilter plates (PerkinElmer), and thymidine uptake was assessed using a TopCount NXT^TM Microplate Scintillation and Luminescence Counter (Packard).

IL-2 concentrations in culture supernatants were determined using a mouse IL-2-specific ELISA kit (eBioscience) according to the manufacturer’s protocol. Absorbances at 450 and 570 nm were read using the BioTek Eon spectrophotometer and the BioTek Gen5 software and IL-2 concentrations determined.

2 × 10⁴ GPI^+/− 2.10 variants or 4 × 10⁴ primary CD4⁺ GPI^+/− T cells were stimulated in 96 well plates precoated with either 9 μg/ml of anti-TCRCβ for the clonal variants or 3 μg/ml of anti-CD3ε for primary T cells. At the indicated time points, 12 replicate wells of each of the four populations were harvested and lysed in Tri Reagent^® (Sigma Aldrich) according to the manufacturer’s protocol. The RNA was extracted, quantified and assessed for purity using a NanoDrop spectrophotometer or a Qubit 3 Fluorometer (Thermo Scientific). 0.5 - 1 μg of RNA was used to prepare cDNA using reagents and protocol from Life Technologies. The ddPCR was performed in a 20 μl volume containing cDNA template derived from 10 ng of RNA in RNase/DNase-free water, 100 nM each of forward (AACCTGAAACTCCCCAGGAT) and reverse (CGCAGAGGTCCAAGTTCAT) IL-2 primers and 10 μl of 2× QX200 ddPCR EvaGreen supermix (Bio-Rad). The assay mixtures were loaded into a disposable droplet generator cartridge (Bio-Rad), followed by the addition of 70 μl of droplet generation oil (Bio-Rad) into each of the eight oil wells. The cartridge was then placed inside the QX200 droplet generator (Bio-Rad). When droplet generation was completed, the droplets were transferred to a 96-well PCR plate (Eppendorf) using a multichannel pipette. The plate was heat-sealed with foil using the PX1 PCR Plate Sealer and placed in C1000 Touch Thermal Cycler (Bio-Rad). Thermal cycling conditions were as follows: 95˚C for 5 minutes, then 44 cycles of 95˚C for 30 seconds and 60˚C for 1 minute, and 4˚C for 5 minutes, 90˚C for 5 minutes, and a 4˚C indefinite hold. EvaGreen fluorescent signal, labelling the IL-2 RNA sequence in each droplet was counted by QX200 digital droplet reader and analyzed by QuantaSoft analysis software ver.1.7.4.0917 (Bio-Rad).

The mAb S4B6 renders IL-2 incapable of binding its high affinity receptor, CD25, thereby antagonizing IL-2 cellular function. When added at 1 μg/ml in cultures of anti-CD3ε stimulated GPI⁻ variants, the level of functional IL-2 measured by ELISA in these supernatants was reduced approximately to the level observed in GPI⁺ cultures (data not shown). Note that the IL-2 ELISA kit from eBioscience uses a capture antibody that binds both IL-2 and IL-2-S4B6-complexes whereas the detection antibody reveals only free IL-2 [20], enabling the empirical estimate of the required amount S4B6 to neutralize IL-2 concentrations in GPI⁻ culture supernatants such that they match those in GPI⁺ culture supernatants.

2 × 10⁴ clonal T cells or 4 × 10⁴ primary T cells were seeded per well, in triplicate, on 96 well plates pre-coated with 3 μg/ml of anti-CD3ε alone, or with a titration of PD-L1-Fc or its isotype control. When indicated, S4B6 or its isotype control, rat IgG2a, was added at 1 μg/ml to all cultures containing PD-L1-Fc or PD-L1. HIS or their respective controls. Cultures were pulsed with 1 μCi ³H-TdR at the indicated time points, harvested 6 hours later on Unifilter plates (PerkinElmer) and thymidine uptake was assessed by scintillation spectroscopy. The inhibitory effect of PD-L1-Fc or PD-L1.HIS is presented as % control: the ratio of cpm from cultures containing anti-CD3ε plus PD-L1-Fc, PD-L1.HIS or their respective controls versus those containing anti-CD3ε alone, which was set to 100%.

Results represent the mean ± standard error calculated based on triplicate cultures from representative experiments. Experiments were repeated a minimum of 3 times. P values among experimental groups were determined by the unpaired Student’s t-test.

The initial observation supporting a role for GPI-AP in the regulation of T cell activation and growth was established in GPI-AP deficient variants of the IL-2-dependent, CD4⁻, I-A^b restricted, OVA^143-157 specific, T cell clone 2.10 [18]. The deficiency in the 2.10 GPI⁻ variants is due to an autosomal mutation within a gene encoding one of seven components of the transferase complex termed Pigp [21]. The functional transferase complex predicates the initial step in GPI biosynthesis. The establishment of stable infectants of 2.10 GPI-AP⁻ variants demonstrates the causal role of Pigp deficiency (Figure 1). Insight was derived from the differential kinetics of response of 2.10 GPI^+/− variants to antigen.

While both the GPI-AP⁺ and GPI-AP⁻ 2.10 clonal variants exhibit comparable initial responses, GPI-AP⁻ variants exhibit prolonged ³H-TdR uptake, which was reversed with the rescue of GPI-AP expression mediated by Pigp infection (Figure 1(B)). The potential role of antigen presenting cells in supporting differential responsiveness was excluded by assessing the responses of 2.10 GPI-AP^+/− variants to plate bound anti-TCRCβ which reveals that the differential kinetics of responsiveness to TCR ligation in GPI-AP^+/− variants is cell intrinsic (Figure 1(C)).

2.10 clonal variants are IL-2 dependent, and cell death in the absence of IL-2

ensues through the intrinsic apoptotic pathway [22] [23]. Sustained growth of 2.10 is maintained through either the addition of exogenous IL-2, or TCR-induced production of endogenous IL-2. The differential responses of GPI-AP^+/− 2.10 variants to TCR ligation is not due to impaired function of IL-2R (Figure 2(A) and Figure 2(B)), rather, to differential anti-TCR induced de novo IL-2 mRNA and protein synthesis. While the kinetics of IL-2 mRNA induction

in GPI-AP^+/− variants is comparable, the fold induction of IL-2 mRNA is significantly higher in the GPI⁻ stimulated cells at each time point assayed. Specifically, the peak of anti-TCRCβ induced IL-2 mRNA induction is at day 1 for both GPI-AP^+/− variants, but 3.4-fold higher in GPI-AP⁻ variants. The levels of IL-2 mRNA in GPI-AP^+/− variants declined in parallel with their respective ³H-TdR uptake responses, but levels of IL-2 mRNA remain up to 30-fold higher in GPI-AP⁻ variants over the time course assessed (Figure 1(D)). The role of GPI-AP in the regulation of anti-TCRCβ induced IL-2 mRNA is formally demonstrated using Pigp infectants of 2.10 GPI-AP⁻ variants (Figure 1(E)). Specifically, anti-TCRCβ induced IL-2 mRNA in Pigp infectants approach levels observed in GPI-AP⁺ variants assessed at the earliest time points but consistently rose to levels approaching GPI-AP⁻ variants at the later time points (Figure 1(E)) which, notwithstanding, did not translate into increased levels of IL-2 detected in culture supernatants (Figure 1(F)), as will be discussed below. Levels of anti-TCRCβ induced IL-2 mRNA in MIEV-0 infectants remain within 2-fold of those observed in GPI-AP⁻ variants (Figure 1(G)).

The enhanced and prolonged anti-TCRCβ induced IL-2 mRNA production in GPI-AP⁻ variants correlates with enhanced amounts of IL-2 detected in culture supernatants of the same cell populations over the time course tested. While levels of IL-2 in supernatants of both GPI^+/− variants declined over time, supernatants of GPI-AP⁻ variants contained from 15-188-fold more IL-2 than those from GPI-AP⁺ variants at the same time points (Figure 1(F)). And further, as observed for increases in mRNA induction, IL-2 levels in supernatants of anti-TCRCβ stimulated Pigp infectants of GPI-AP⁻ variants approach levels observed in GPI-AP⁺ variants, with greater effect at later time points (Figure 1(G)). Levels of IL-2 in culture supernatants in MIEV-0 infectants remain either identical to those observed in GPI-AP⁻ variants, or enhanced 2-5-fold (Figure 1(G)).

Convergent evidence for the role of GPI-AP in regulating TCR induced IL-2 production derives from the analysis of the differential effects of PD1 mediated inhibition of TCR signalling in GPI-AP^+/− variants. PD1-mediated effects are mitigated by exogenous IL-2. Specifically, the exogenous IL-2 sensitive sequelae induced upon PD1 ligation [24] include attenuation of TCR-mediated clonal expansion [16] and dramatic decreases in IL-2 production [25].

PD1, and its agonistic ligand, PD-L1 are expressed at comparable levels on both GPI-AP^+/− variants propagated in IL-2 (Figure 2(C)). Further, PD1 expression is materially upregulated and PD-L1 less so, upon anti-CD3ε stimulation in both GPI-AP^+/− variants (Figure 2(C)).

PD1/PD-L1-mediated attenuation of TCR signalling was assessed by stimulating GPI-AP^+/− variants with anti-CD3ε in the presence of increasing concentrations of PD-L1-Fc using a recombinant human B7-H1/PD-L1-Fc chimera [16]. Increasing concentrations of PD-L1-Fc suppress anti-CD3ε induced ³H-TdR uptake by the GPI-AP⁺ clonal variants, exclusively (Figure 1(H)). The formal demonstration of the role of GPI-AP in mediating this differential inhibition is demonstrated by rescuing PD-L1-mediated inhibition of anti-CD3ε induced DNA synthesis in GPI-AP⁻Pigp infectants (Figure 1(I)).

However, as illustrated in Figure 1(J), the efficacy of PD1 mediated inhibition of IL-2 concentrations in culture supernatants of anti-CD3ε stimulated GPI-AP^+/− variants is comparable, ranging from 50-100-fold. This reveals the potential molecular basis of differential PD-LI-Fc mediated inhibition of induced ³H-TdR uptake in GPI⁺ and GPI⁻ clonal variants.

Specifically, the amount of IL-2 detected in culture supernatants of GPI-AP⁻ variants stimulated with anti-CD3ε and 9 μg/ml of PD-L1-Fc, while reduced 30-80-fold relative to controls, was on average 10-50-fold higher compared to levels observed in supernatants of GPI⁺ variants stimulated in the same conditions. Thus, while the fold reduction of IL-2 detected is comparable in the GPI-AP sufficient and deficient variants (Figure 1(J)), the higher concentration of IL-2 in culture supernatants of GPI-AP⁻ variants may be sufficient to mitigate the inhibitory effects of PD1 ligation. The prediction follows that reduction of available IL-2 in culture supernatants of anti-CD3ε stimulated GPI⁻ clonal variants will render them susceptible to PD-L1-Fc mediated inhibition. This was tested through the addition of an IL-2 neutralizing mAb to reduce levels of IL-2 in supernatants of cultures of GPI⁻ variants stimulated with anti-CD3ε in the presence of 9 μg/ml of PD-L1-Fc, to those approximating IL-2 levels observed in the supernatants of the GPI⁺ variants stimulated in the same conditions. As illustrated in Figure 1(K), addition of neutralizing anti-IL-2, but not isotype control, rescued 70% inhibition of the anti-CD3ε induced response of GPI⁻ variants in a PD-L1 specific fashion.

Taken together these results support the conclusion that GPI-AP regulate TCR induced IL-2 production and posits their role in attenuating TCR signalling.

Initial results assessing TCR signalling in GPI-AP deficient primary T cells are mixed. The conditional disruption of the Piga gene that encodes one of the seven components of the tranferase complex predicating the initial step in GPI-anchor biosynthesis revealed no significant impact on TCR signalling [19]. However, subsequent analyses of splenocytes from these animals revealed a 2-3-fold enhanced responsiveness to mitogen, and a 3-fold increased response of CD4⁺ T cells to allogeneic stimulation, both assessed by ³H-TdR uptake [26]. Further, the response of an OVA specific T cell clone derived from these mice to mitogen, but not to antigen, was enhanced 3-fold. Importantly this enhancement was reversed upon retroviral infection of the clone with Piga, restoring GPI-AP expression [26]. These results were based on ³H-TdR uptake, exclusively, notably IL-2 production was not measured. Here we reassess responsiveness of purified GPI-AP⁻ CD4⁺ T cells derived from these mice [19] and demonstrate that they recapitulate the IL-2 phenotype observed in the GPI-AP⁻ clonal variants.

As previously described, conditional disruption of Piga in these mice yields a T cell specific loss of GPI-AP expression, and enables the isolation of >95% pure populations of CD4⁺GPI-AP⁻ T cells (Figure 3(A)). Anti-CD3ε mediated stimulation of GPI-AP⁻ cells results in a 3-7.5 -fold enhancement in ³H-TdR uptake compared to CD4⁺GPI-AP⁺ control T cells, over the time course assessed (Figure 3(B)). In contrast to the precipitous waning of the anti-TCRCβ induced stimulation of the IL-2-dependent GPI-AP⁺ clonal variants (Figure 1(B) and Figure 1(C)), as expected the kinetics of anti-CD3ε induced ³H-TdR uptake in primary GPI-AP^+/− CD4⁺ T cells is not materially exacerbated by IL-2-regulated apoptosis over the time course assessed (Figure 3(B)). Notwithstanding, the concordant observation is that differential TCR induced IL-2 mRNA and protein levels observed in cultures of GPI^+/− primary T cells recapitulate those observed in the GPI-AP^+/− clonal variants.

Specifically, levels of anti-CD3ε induced IL-2 mRNA in GPI-AP⁻ primary T cells range from 3-5-fold higher over the time course assayed (Figure 3(C)). This differential was paralleled by an increase in IL-2 concentrations in supernatants of the anti-CD3ε stimulated GPI-AP⁻ T cells which are up to 20-fold higher at peak (Figure 3(D)). Further, the IL-2-dependent differential susceptibility of GPI-AP^+/− primary CD4⁺ T cells to PD1 mediated inhibition of anti-CD3ε induced ³H-TdR uptake recapitulated the observations in GPI-AP^+/− clonal variants.

Specifically, increasing concentrations of PD-L1-Fc inhibits ³H-TdR uptake by GPI-AP⁺ CD4⁺ primary T cells from 10 to 150-fold, at days 2 and 4, respectively, while no inhibition was observed in GPI-AP⁻ CD4⁺ primary T cells (Figure 4(A)). However, PD-L1-Fc did inhibit anti-CD3ε induced IL-2 concentrations observed in supernatants of both GPI-AP^+/− primary T cells by at least 10-fold at both days 2 and 4 (Figure 4(B)). Importantly, both basal and anti-CD3ε induced upregulated expression of PD1 and PD-L1 levels are comparable in GPI-AP⁺ and GPI-AP⁻ CD4⁺ primary T cells (Figure 4(C)).

To determine whether the 20-100-fold higher concentrations of IL-2 in supernatants of anti-CD3ε stimulated GPI-AP⁻ primary T cells at days 2 and 4, respectively (Figure 4(B)), mitigate PD-L1-Fc-mediated inhibition, the impact of mAb mediated neutralization of IL-2 levels in supernatants of the GPI-AP⁻ CD4⁺ primary T cells to levels observed in supernatants of GPI-AP⁺ variants was assessed. As illustrated in Figure 4(D), mAb mediated neutralization of IL-2 rescues PD-L1-Fc mediated inhibition of anti-CD3ε induced ³H-TdR uptake by GPI-AP⁻ variants to 40% and 85% of control responses, at days 2 and 4, respectively.

It is of note that analyses of CD8⁺ primary T cells did not follow suit. Specifically, levels of ³H-TdR uptake induced by anti-CD3ε in both GPI-AP⁺ and GPI-AP⁻ CD8⁺ primary T cells was robust and comparable to those observed in GPI-AP⁺ CD4⁺ primary T cells, over the same dose range of anti-CD3ε kinetics. However, levels attained by the GPI-AP⁺ CD8⁺ were as high as or exceeded those

observed in the GPI-AP⁻ CD8⁺ populations. Further, levels of IL-2 observed in supernatants of both GPI-AP⁺ and GPI-AP⁻ cultures were below levels of detection (data not shown).

To address the potential differential role of GPI and GPI-AP in the attenuation of anti-CD3ε induced IL-2 production, GPI⁺, GPI-AP⁻ CD4⁺ primary T cells were generated. This was achieved through the conditional disruption of one of the five components that comprise the transamidase complex within the GPI-biosynthetic pathway, which mediates the transfer of protein containing the appropriate C-terminal signal sequence, to a mature GPI-anchor [27]. The conditional disruption of the Pigu gene was selected for this purpose as floxed-Pigu containing embryos were available at the European Mouse Mutant Archive (EMMA) Repository (Figure 5(A)). Embryos heterozygous for floxed exon 2 of Pigu, were implanted into pseudo pregnant females and offspring were bred and rearedin the specific pathogen free environment at the Sunnybrook Research Institute for preparation of the conditional Pigu deficient strain.

A breeding program analogous to that employed for the generation and maintenance of the Piga conditional mutants was implemented [19] with the specific modification to accommodate the fact that Pigu is autosomal. Specifically, floxed-Pigu heterozygous mice were bred with mice transgenic for Cre recombinase under the control of the proximal Lck promoter (Lck-Cre). As for the generation of Piga deficient peripheral T cells, the switch of Lck promoters from the predominate use of the proximal promoter intra-thymically to the predominate use of the distal promoter in peripheral T cells [28], ensures not only that T cells emigrating from the thymus are Pigu deficient, it also safeguards against unwanted Cre-expression in peripheral T cells of these animals. The F₁ progeny [Lck-Cre/Pigu^flox] were then intercrossed yielding some F₂Lck-Cre/Pigu^flox mice bearing the disruption of Pigu on both alleles. The expression of Pigu in progeny tail clippings, B cells and T cells demonstrates the selective absence of Pigu exon-2 in T cells, exclusively (Figure 5(B)). Flow cytometric analyses of splenocytes from Pigu deficient animals confirm the presence of GPI-AP deficient cells in a T cell specific fashion, and enabled the isolation of >95% pure populations of Pigu deficient, GPI-AP⁻, CD4⁺ primary T cells (Figure 5(C)).

Formal proof that mature GPI-anchor expression is retained on Pigudeficient CD4⁺ T cells is demonstrated by staining with a mAb specific for unlinked GPIs expressing an N-acetylgalactosamine side chain [15] [29]. As expected, this mAb does not stain CD4⁺ primary T cells from either Piga or Pigu sufficient CD4⁺ T cells, as the side chain is blocked through the addition of GPI-associated proteins; nor does it stain Piga-deficient CD4⁺ T cells, which lack both the GPI-anchor and therefore GPI-AP (Figure 5(D)). Only Pigu deficient CD4⁺ T cells express the ligand for the T5 mAb, and staining is in the majority PI-PLC sensitive, confirming the GPI-linkage (Figure 5(D)).

Comparative assessment of anti-CD3ε induced ³H-TdR uptake, induction of IL-2 specific mRNA and levels of IL-2 in culture supernatants of Pigu^+/+ and Pigu^−/− primary CD4⁺ T cells demonstrates fundamental differences in the

phenotype of Pigu and Piga deficiency. Specifically, as illustrated in Figure 6(A), levels of anti-CD3ε induced ³H-TdR uptake by Pigu^+/+ CD4⁺ T cells was comparable to or exceeded those by Pigu^−/− CD4⁺ T cells. Anti-CD3ε induced IL-2

mRNA in Pigu^−/− CD4⁺ T cells ranged within 0.5-3.8-fold of those levels in Pigu^+/+ CD4⁺ T cells (Figure 6(B)); and IL-2 levels in culture supernatants of Pigu^−/− CD4⁺ T cells ranged from 1-4-fold of those in culture supernatants of Pigu^+/+ CD4⁺ T cells (Figure 6(C)).

Thus, the differential of anti-CD3ε induced IL-2 mRNA and IL-2 observed in Pigu^−/− versus Pigu^+/+ CD4⁺ T cells is 10-50-fold less relative to that observed in Piga⁺ versus Piga⁻ CD4⁺ T cells (Figure 3, Figure 4 and Figure 6).

Notwithstanding, even a 2-4-fold increment of IL-2 in the surround was sufficient to impact PD-L1 mediated inhibition of anti-CD3ε induced ³H-TdR uptake by in Pigu^−/− CD4⁺ T cells (Figure 6(E)). Importantly, both basal and anti-CD3ε induced levels of expression of PD1 and PD-L1 are comparable in Pigu^−/− and Pigu^+/+ CD4⁺ T cells (Figure 6(D)). Further, and as for PD-L1 mediated inhibition of IL-2 in culture supernatants of anti-CD3ε stimulated Piga⁻ and Piga⁺ CD4⁺T cells (Figure 4(B)), PD-L1 inhibits levels of IL-2 observed in supernatants of anti-CD3ε induced Pigu^−/− and Pigu^+/+ CD4⁺ T cells, comparably (Figure 6(F)).

In sum, the striking differential effects in the regulation of TCR induced DNA synthesis and IL-2 production in primary Pigaand Pigu deficient primary CD4⁺ T cells provide the first evidence that expression of free GPI functions to profoundly attenuate TCR signalling.