<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">WJNS</journal-id><journal-title-group><journal-title>World Journal of Neuroscience</journal-title></journal-title-group><issn pub-type="epub">2162-2000</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/wjns.2021.111005</article-id><article-id pub-id-type="publisher-id">WJNS-107383</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Cerebral Palsy and Stroke—Early and Late Brain Lesion Present Differences in Systemic Biomarkers and Gene Expression Related to Muscle Contractures
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jessica</surname><given-names>Pingel</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Camille</surname><given-names>Potts</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Theis</surname><given-names>Wolter Petersen</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jens</surname><given-names>Bo Nielsen</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Neuroscience, University of Copenhagen, Copenhagen, Denmark</addr-line></aff><pub-date pub-type="epub"><day>29</day><month>01</month><year>2021</year></pub-date><volume>11</volume><issue>01</issue><fpage>34</fpage><lpage>47</lpage><history><date date-type="received"><day>14,</day>	<month>November</month>	<year>2020</year></date><date date-type="rev-recd"><day>22,</day>	<month>February</month>	<year>2021</year>	</date><date date-type="accepted"><day>25,</day>	<month>February</month>	<year>2021</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Background:
   CNS lesions that are acquired early in life e.g. cerebral palsy (CP) disturb muscle development and growth, while CNS injuries acquired later in life e.g. stroke
  ,
   affect fully matured muscles and cause paresis and atrophy. These differences may result in different contracture phenotypes. <b>Aim:</b> The purpose of this study was to compare systemic biomarkers and gene expression levels in muscle of individuals with CNS lesions acquired early and later in life. <b>Methods:</b> Blood samples and muscle biopsies were analyzed using Enzyme-linked immunosorbent assay and Real-time PCR from n = 24 control participants, n = 14 individuals with cerebral palsy, and n = 12 stroke survivors. <b>Results:</b> <b>Systemic</b> <b>markers:</b> Myostatin was significantly decreased in both the cerebral palsy (p = 0.0051), and the stroke group (p = 0.036). Creatine Kinase-MB and C-Reactive Protein were significantly elevated in stroke patients only (p &lt; 0.007 &amp; p &gt; 0.034 respectively). <b>Gene</b> <b>expressions:</b> The expression of myostatin (MSTN) was significantly lower in both the ST and the CP group when compared to Ctrl (p = 0.02). In addition, collagen type 4A1 (COL4A1) was significantly lower in the CP group compared to the other groups (p = 0.015). Finally, the troponin 1 slow skeletal muscle type was significantly increased in the ST group when compared to both CP and Ctrl (p = 0.03). <b>Conclusion:</b> The downregulation of myostatin in individuals with both early and late CNS injury is likely a compensatory reaction to muscle weakness, reduced muscle mass and/or muscle atrophy. Changes in gene expression may reflect a specific alteration depending on when in life the CNS lesions were acquired.
 
</p></abstract><kwd-group><kwd>Cerebral Palsy</kwd><kwd> Stroke</kwd><kwd> Biomarkers</kwd><kwd> Creatin Kinase</kwd><kwd> Myostatin</kwd><kwd> C-Reactive Protein</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Muscle contractures are common complications following lesions to the central nervous system regardless of whether the lesion occurs early in life (e.g. Cerebral palsy; [<xref ref-type="bibr" rid="scirp.107383-ref1">1</xref>] ) or late in life (e.g. stroke; [<xref ref-type="bibr" rid="scirp.107383-ref2">2</xref>] ). Muscle contractures are characterized by increased resistance of the passive elastic elements in the muscle and surrounding tissue leading to reduced range of movement and dislocation of joints [<xref ref-type="bibr" rid="scirp.107383-ref3">3</xref>]. Muscle contractures are therefore one of the most debilitating complications to central nervous lesion causing pain, reduced mobility, compromised hygiene and reduced social participation [<xref ref-type="bibr" rid="scirp.107383-ref4">4</xref>]. There is at present no effective therapy of muscle contractures, although considerable efforts are put into stretching and other forms of physical therapy [<xref ref-type="bibr" rid="scirp.107383-ref5">5</xref>]. Part of the reason why we have not been successful in finding an effective therapy is that the pathophysiology of contractures has not been clarified. There is increasing evidence to suggest that reduced growth of muscles in infants with cerebral palsy may lead to excessive stress on the muscles as bones grow longer and thereby trigger the development of contractures [<xref ref-type="bibr" rid="scirp.107383-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref7">7</xref>]. However, this cannot explain the development of contractures in adults following stroke and other lesions of the central nervous system. It has been assumed for decades that increased muscle activity due to spasticity maintains muscles in a shortened position resulting in development of contractures. However, several studies have now documented that altered resistance of the passive elastic elements in the muscle occurs prior to development of spasticity and that contractures still develop when spasticity has been effectively abolished by section of dorsal roots [<xref ref-type="bibr" rid="scirp.107383-ref8">8</xref>].</p><p>We have recently argued that the lack of a pathophysiological explanation of contractures may reflect that the pathophysiology is complex and likely involves multiple factors in a complex network of tissues, stimuli, and regulatory factors that define tissue homeostasis [<xref ref-type="bibr" rid="scirp.107383-ref3">3</xref>]. Comparing these factors in individuals with cerebral palsy and stroke provides an opportunity to explore which of these factors are similarly altered following lesions early and late in life. Identifying common patterns of changes would help to clarify whether similar signaling pathways or separate pathophysiological mechanisms are involved when lesions occur early and late in life. The present study is a first attempt at addressing this issue by comparing systemic and gene expression levels of specific factors related to contracture development in individuals with cerebral palsy or stroke</p></sec><sec id="s2"><title>2. Materials &amp; Methods</title><p>All participants were Danish citizens, recruited in Copenhagen Denmark and gave informed consent. The protocol was approved by the Regional Ethics Committee for Copenhagen (H-4-2014-047). The protocol was in compliance with the Helsinki Declaration. Blood samples were taken from healthy volunteers, individuals with CP, and stroke survivors. All but one of the ELISA studies included 50 participants: 24 healthy (n = 24 Ctrl), 14 with spastic CP (n = 14; CP), and 12 stroke survivors (n = 12; ST). All subject characteristics are shown in <xref ref-type="table" rid="table1">Table 1</xref> in Mean &#177; SD. The Inclusion criteria for the Ctrl group were both female and male subjects above 18 years of age with no prior history of muscle disease or any other chronic diseases. The exclusion criteria of the Ctrl group were less than 18 years of age, chronic diseases and prior muscle disease. The Inclusion criteria for the CP group were: individuals with spastic CP (both female and male) above 18 years of age with muscle contractures in at least one joint. In Denmark most individuals with CP are diagnosed with CP with less than two years of age.</p><p>The exclusion criteria of the CP group were less than 18 years of age and lack of contractures.</p><p>The Inclusion criteria for the ST group were: individuals above 18 years of age (both female and male), who had experienced a stroke and suffered from muscle contractures in at least one joint. The exclusion criteria of the ST group was less than 18 years of age and lack of contractures. The included participants had a Mean age of: 42 &#177; 3 in the CP group and 47 &#177; 3 in the ST group. The gender distribution was as follows: (CP group n = 8 females and n = 6 males); (ST group n = 6 females and n = 6 males). Thus, individuals from the CP and ST group also underwent a clinical investigation were the Modified Ashworth scale (MAS) and the range of motion (ROM) in their ankle joints was measured and recorded (<xref ref-type="table" rid="table2">Table 2</xref>). Type of CP and a score according to the Gross Motor Function Classification system (GMFCS) were recorded. The clinical history of the participants from the CP and the ST group is shown in detail in <xref ref-type="table" rid="table2">Table 2</xref>. All blood samples were taken from the medial cubital vein and centrifuged to separate the plasma. The plasma was kept at −80˚C until testing. The systemic levels of all markers in the plasma were determined through enzyme-linked immunosorbent assay (ELISA).</p><p>Collagen IV levels were detected using a Sandwich ELISA (Human Collagen IV ELISA Kit from LifeSpan BioSciences, Inc. Seattle, WA), with analytic sensitivity 7.8 - 500 ng/mL and intra-inter assay CV of &lt;10% &amp; &lt;12% respectively.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Subject characteristics</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Group</th><th align="center" valign="middle" >Age (y)</th><th align="center" valign="middle" >Height (m)</th><th align="center" valign="middle" >Weight (kg)</th><th align="center" valign="middle" >BMI (weight/height<sup>2</sup>)</th><th align="center" valign="middle" >Time since stroke (y)</th><th align="center" valign="middle" >Gender F/M</th></tr></thead><tr><td align="center" valign="middle" >CP</td><td align="center" valign="middle" >41.9 &#177; 12</td><td align="center" valign="middle" >173.3 &#177; 11</td><td align="center" valign="middle" >71.9 &#177; 13</td><td align="center" valign="middle" >24.3 &#177; 7</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >8 female/6 male</td></tr><tr><td align="center" valign="middle" >ST</td><td align="center" valign="middle" >46.6 &#177; 11</td><td align="center" valign="middle" >176.1 &#177; 8</td><td align="center" valign="middle" >74.8 &#177; 13</td><td align="center" valign="middle" >24.0 &#177; 3</td><td align="center" valign="middle" >3.6 &#177; 1.3</td><td align="center" valign="middle" >6 female/6 male</td></tr><tr><td align="center" valign="middle" >Ctrl</td><td align="center" valign="middle" >40.5 &#177; 9</td><td align="center" valign="middle" >177 &#177; 11</td><td align="center" valign="middle" >80.5 &#177; 14</td><td align="center" valign="middle" >25.8 &#177; 4</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >9 female/14 male</td></tr></tbody></table></table-wrap><p>All data are shown in Mean &#177; SD.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Clinical history</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >Diagnosis</th><th align="center" valign="middle" >Type</th><th align="center" valign="middle" >Walking Aids</th><th align="center" valign="middle" >Sex</th><th align="center" valign="middle" >Age</th><th align="center" valign="middle" >GMFCS</th><th align="center" valign="middle" >MAS plantarflexion (right)</th><th align="center" valign="middle" >MAS plantarflexion (left)</th><th align="center" valign="middle" >ROM dorsiflexion (right)</th><th align="center" valign="middle" >ROM dorsiflexion (left)</th></tr></thead><tr><td align="center" valign="middle" >CP</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >CP1</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >diplegic</td><td align="center" valign="middle" >Crutches</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >20</td></tr><tr><td align="center" valign="middle" >CP2</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >diplegic</td><td align="center" valign="middle" >Crutches</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >56</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >10</td></tr><tr><td align="center" valign="middle" >CP3</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >42</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >10</td></tr><tr><td align="center" valign="middle" >CP4</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >quadriplegic</td><td align="center" valign="middle" >Wheelchair</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >49</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >10</td></tr><tr><td align="center" valign="middle" >CP5</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >quadriplegic</td><td align="center" valign="middle" >Wheelchair</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >10</td></tr><tr><td align="center" valign="middle" >CP6</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >diplegic</td><td align="center" valign="middle" >Crutches</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >48</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >20</td></tr><tr><td align="center" valign="middle" >CP7</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >diplegic</td><td align="center" valign="middle" >Walking stick</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >48</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >10</td></tr><tr><td align="center" valign="middle" >CP8</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >diplegic</td><td align="center" valign="middle" >Wheelchair</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >51</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >CP9</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >diplegic</td><td align="center" valign="middle" >Crutches</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >58</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >20</td></tr><tr><td align="center" valign="middle" >CP10</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >diplegic</td><td align="center" valign="middle" >Crutches</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >49</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >20</td></tr><tr><td align="center" valign="middle" >CP11</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >48</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >CP12</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >diplegic</td><td align="center" valign="middle" >Wheelchair</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >38</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >10</td></tr><tr><td align="center" valign="middle" >CP13</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >diplegic</td><td align="center" valign="middle" >Crutches</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >10</td></tr><tr><td align="center" valign="middle" >CP14</td><td align="center" valign="middle" >Spastic CP</td><td align="center" valign="middle" >diplegic</td><td align="center" valign="middle" >Crutches</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >20</td></tr><tr><td align="center" valign="middle" >Stroke</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ST1</td><td align="center" valign="middle" >Brain tumor and stroke</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >34</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >22</td></tr><tr><td align="center" valign="middle" >ST2</td><td align="center" valign="middle" >Stroke</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >57</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >ST3</td><td align="center" valign="middle" >Stroke after accident</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >46</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >ST4</td><td align="center" valign="middle" >Stroke</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >-5</td><td align="center" valign="middle" >25</td></tr><tr><td align="center" valign="middle" >ST5</td><td align="center" valign="middle" >Stroke</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >48</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >20</td></tr><tr><td align="center" valign="middle" >ST6</td><td align="center" valign="middle" >Stroke</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Scooter</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >52</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >-10</td><td align="center" valign="middle" >20</td></tr><tr><td align="center" valign="middle" >ST7</td><td align="center" valign="middle" >Stroke after accident</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >48</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >ST8</td><td align="center" valign="middle" >Stroke</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >45</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >20</td></tr><tr><td align="center" valign="middle" >ST9</td><td align="center" valign="middle" >Stroke</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >55</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >ST10</td><td align="center" valign="middle" >Stroke</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >48</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >25</td></tr><tr><td align="center" valign="middle" >ST11</td><td align="center" valign="middle" >Stroke</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >38</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >25</td></tr><tr><td align="center" valign="middle" >ST12</td><td align="center" valign="middle" >Stroke</td><td align="center" valign="middle" >hemiplegic</td><td align="center" valign="middle" >Orthosis</td><td align="center" valign="middle" >M</td><td align="center" valign="middle" >65</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >15</td></tr></tbody></table></table-wrap><p>Troponin I levels were detected using a sandwich ELISA (Human Troponin I from Sigma-aldrich, Saint Louis, MO. USA), with a min. detectable dose of 0.61 ng/mL and intra-inter assay CV of &lt;10% &amp; &lt;12% respectively.</p><p>Matrix Metalloproteinase-2 (MMP-2) levels were detected using a sandwich ELISA (Human Troponin I from Sigma-aldrich, Saint Louis, MO. USA), with a min. detectable dose of 3.5 pg/mL and intra-inter assay CV of &lt;10% &amp; &lt;12% respectively.</p><p>Myostatin levels were detected using a sandwich ELISA (Quantikine ELISA for GDF-8/Myostatin), with a min. detectable dose of 2.25 pg/mL and intra-inter assay CV of &lt;4% &amp; &lt;5% respectively.</p><p>Creatine Kinase-MB (CKMB) levels were detected using a sandwich ELISA (Human CKMB ELISA Kit from ThermoScientific), with a min. detectable dose of 0.3 ng/mL and intra-inter assay CV of &lt;10% &amp; &lt;12% respectively.</p><p>C-Reactive Protein (CRP) levels were detected using a sandwich ELISA (Human C-Reactive Protein from R &amp; D Systems), with a min. detectable dose of 0.01 ng/mL and intra-inter assay CV of &lt;6% &amp; &lt;7% respectively.</p><p>Muscle biopsy procedure</p><p>The muscle biopsies were obtained from the medial Gastrochnemius muscle after local anesthesia (1% lidocaine) and incision of the overlying skin. The biopsy was taken using a 5-mm Bergstrom needle (Stille, Stockholm, Sweden) with manual suction. The obtained muscle biopsies weighted around 80 - 100 mg. The samples were snapfrozen in liquid nitrogen and stored at −80˚C until further investigation.</p><p>RNA extraction</p><p>Total RNA was extracted from fresh frozen muscle samples from 24 subjects using 1 ml of TriReagent (MRC) containing four stainless steel balls of 2.3 mm diameter (BioSpec Products, Inc., Bartlesville, Oklahoma, USA), and one silicon-carbide sharp particle of 1 mm (BioSpec Products, Inc.), by shaking in a Precellys Evolution tissue homogenizer (Bertin Instruments, Rockville, USA) at maximal speed for 15 s. In order to obtain complete homogenization of the tissue, the shaking process was repeated four times with cooling on ice between each shaking step (to avoid heating of the sample). Following homogenization, bromo-chloropropane was added to separate the samples into an aqueous and an organic phase. Following isolation of the aqueous phase, RNA was precipitated using isopropanol. The RNA pellet was washed in 75% ethanol and subsequently dissolved in RNase-free water. The RNA quality was verified using custom made agarose gels and the RNA concentration was determined using a Qubit 3.0 fluorometer (Invitrogen, Thermo Fisher Scientific, Eugene, Oregon, USA). The RNA samples were stored frozen at −80˚C until subsequent cDNA synthesis. All analysis was conducted according to the manufacturers protocols.</p><p>PCR protocol</p><p>The samples were subsequently prepared for PCR analysis using the Brilliant III ultra-Fast QPCR Master Mix kit (Agilent technologies Inc., Foster City, California, USA). In brief, for a final concentration of 300 nM in the reaction the samples were diluted 1:500 as recommended by the manufacturers protocol and 15 ul of mastermix dye was mixed with 0.075 ul primer per well (0.3 uM forward and reverse primer pr well) (<xref ref-type="table" rid="table3">Table 3</xref>). Subsequently, each well was then filled with 23 ul of mastermix. After that 2 ul of prediluted cDNA was added to each</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Primer sequences</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Target</th><th align="center" valign="middle" >Alias</th><th align="center" valign="middle" >Sense</th><th align="center" valign="middle" >Antisense</th></tr></thead><tr><td align="center" valign="middle" >Glyceraldehyde-3-phosphate dehydrogenase</td><td align="center" valign="middle" >GAPDH</td><td align="center" valign="middle" >AGTCAGCCGCATCTTCTTTT</td><td align="center" valign="middle" >CATGGGTGGAATCATATTGG</td></tr><tr><td align="center" valign="middle" >60s acidic ribosomal protein P0</td><td align="center" valign="middle" >RPLP0</td><td align="center" valign="middle" >GGAAACTCTGCATTCTCGCTTCC</td><td align="center" valign="middle" >CCAGGACTCGITGTACCCGGTT</td></tr><tr><td align="center" valign="middle" >Myostatin</td><td align="center" valign="middle" >MSTN</td><td align="center" valign="middle" >TGCTGTAACCTTCCCAGGACCA</td><td align="center" valign="middle" >GCTCATCACAGTCAAGACCAAAATC</td></tr><tr><td align="center" valign="middle" >Collagen type 4A1</td><td align="center" valign="middle" >COL-4A1</td><td align="center" valign="middle" >TCGCTGTGGATCGGCTACTCT</td><td align="center" valign="middle" >CGATGAATGGCGCACTTCTAAAC</td></tr><tr><td align="center" valign="middle" >Collagen type 4As</td><td align="center" valign="middle" >COL-4A3</td><td align="center" valign="middle" >ATCGTGGTCCACCAGGCTCA</td><td align="center" valign="middle" >CAGGGTGGCCCATAGACCCTT</td></tr><tr><td align="center" valign="middle" >Matrix Metallopeptidase-2</td><td align="center" valign="middle" >MMP2</td><td align="center" valign="middle" >CCGCCTTAACTGGAGCAAAAACA</td><td align="center" valign="middle" >TTGGGGAAGCCAGGATCCATT</td></tr><tr><td align="center" valign="middle" >Troponin l1, slow skeletal muscle type</td><td align="center" valign="middle" >TINNI-1</td><td align="center" valign="middle" >GAGGTGGGTGACTGGAGGAAGAA</td><td align="center" valign="middle" >GGCACAGGGCTGGAGGAAAGGT</td></tr><tr><td align="center" valign="middle" >Troponin l2, fast skeletal muscle type</td><td align="center" valign="middle" >TINNI-2</td><td align="center" valign="middle" >GCCAAGAAAAAGAAGGTGCTGTCC</td><td align="center" valign="middle" >TCTGCTGTITCAGCTTCGCCATC</td></tr></tbody></table></table-wrap><p>well (The cDNA was pre-diluted in order to equalize the amount of cDNA to 1.5 ug in each sample).</p><p>The PCR plate was the placed in an Agilent AriaMX machine and the standard thermal protocol for the Agilent AriaMX was applied: 1 cycle for 3 min at 95˚C, 40 cycles for 5 sec at 95˚C followed by 10 sec at 60˚C. Once the PCR protocol had run, the ΔR values for each target were exported to Microsoft exel using the AriaMX software from Agilent Technologies. The fluorescence threshold was set at 500 for all targets. After that all raw data were normalized to the housekeeping gene GAPDH.</p><p>Statistics</p><p>Subject characteristics are shown in Mean &#177; SD in <xref ref-type="table" rid="table1">Table 1</xref>. A nonparametric, unpaired Wilcoxon test was used to compare the groups and determine significant differences between the three groups. Values outside of the sensitivity range of the ELISA kits were removed from the data, as were outliers greater than two standard deviations away from the mean. All graphs and statistical tests were created and performed in R. The level of significance was p &lt; 0.05 for all analyses. The effect size was calculated using Cohen’s d effect size calculation equation. The p values were interpreted as follows: A P value around 0.05 was recognized as “weak evidence”, while a p value less than 0.01 was recognized as “strong evidence” and a p value less than 0.001 was recognized as “very strong evidence”.</p></sec><sec id="s3"><title>3. Results</title><p>Myostatin: The ST and the CP group had significantly lower plasma myostatin levels than the Ctrl group (p = 0.036, p = 0.0051 respectively, <xref ref-type="fig" rid="fig1">Figure 1</xref>). There was no significant difference between ST and CP (p = 0.83). (Mean &#177; SD: CP = 43.3 &#177; 10.9; ST 48.5 pg/mL &#177; 13.8 pg/mL; Ctrl = 7.5 &#177; 30.4 pg/mL).</p><p>Creatine Kinase (MB isoform) (CKMB): The CKMB levels were significantly higher in the ST group than the Ctrl group (p &lt; 0.007, <xref ref-type="fig" rid="fig2">Figure 2</xref>). There was no significant difference between ST and CP (p = 0.26). Furthermore, there was no significant difference between CP and Ctrl (p = 0.11). CKMB: Mean &#177; SD: CP = 10.5 &#177; 4.9 ng/mL; ST = 12.8 &#177; 3.3 ng/mL; Ctrl = 8.0 &#177; 3.3 ng/mL.</p><p>C-reactive protein (CRP): The CRP level in the ST group was significantly higher than both the CP group (p &gt; 0.034) and the Ctrl group (p &gt; 0.031, <xref ref-type="fig" rid="fig3">Figure 3</xref>). Furthermore, there was no significant difference between CP and Ctrl (p = 0.86). CRP: Mean &#177; SD: CP = 476.9 &#177; 383.7 ng/mL; ST = 1026.6 &#177; 776.6 ng/mL; Ctrl = 471.5 &#177; 350.0 ng/mL.</p><p>Subsequent biomarkers: Levels of Collagen IV, Human Troponin I, and Human MMP-2 did not differ significantly (p value &gt; 0.05) between CP, ST and Ctrl; means, standard deviations, and p-values are shown in <xref ref-type="table" rid="table4">Table 4</xref>.</p><p>Gene expressions: The expression of myostatin (MSTN) was significantly lower in both the ST and the CP group when compared to Ctrl (p = 0.02). In addition collagen type 4A1 (COL4A1) was significantly lower in the CP group compared to the other groups (p = 0.015). Finally the troponin 1 slow skeletal muscle type was significantly increased in the ST group when compared to both CP and Ctrl (p = 0.03). All subsequent gene targets showed no significant differences between any of the groups: GAPDH (p = 0.73), RPLP0 (p = 0.86), IL-6 (p = 0.45), COL4A3 (p = 0.09), TINNI-2 (p = 0.28).</p><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Non significant biomarkers</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle"  colspan="3"  >Mean Concentration (ng/mL)</th><th align="center" valign="middle"  colspan="3"  >SD</th><th align="center" valign="middle"  colspan="3"  >p-values</th></tr></thead><tr><td align="center" valign="middle" >Marker</td><td align="center" valign="middle" >ST</td><td align="center" valign="middle" >CP</td><td align="center" valign="middle" >Ctrl</td><td align="center" valign="middle" >ST</td><td align="center" valign="middle" >CP</td><td align="center" valign="middle" >Ctrl</td><td align="center" valign="middle" >ST-CP</td><td align="center" valign="middle" >ST-Ctrl</td><td align="center" valign="middle" >CP-Ctrl</td></tr><tr><td align="center" valign="middle" >Collagen IV</td><td align="center" valign="middle" >26.3</td><td align="center" valign="middle" >20.6</td><td align="center" valign="middle" >11.5</td><td align="center" valign="middle" >26.2</td><td align="center" valign="middle" >9.3</td><td align="center" valign="middle" >2.2</td><td align="center" valign="middle" >0.75</td><td align="center" valign="middle" >0.77</td><td align="center" valign="middle" >0.11</td></tr><tr><td align="center" valign="middle" >Human MMP-2</td><td align="center" valign="middle" >44.5</td><td align="center" valign="middle" >46.2</td><td align="center" valign="middle" >45.4</td><td align="center" valign="middle" >14.8</td><td align="center" valign="middle" >16.1</td><td align="center" valign="middle" >37.2</td><td align="center" valign="middle" >0.85</td><td align="center" valign="middle" >0.97</td><td align="center" valign="middle" >0.97</td></tr><tr><td align="center" valign="middle" >Human Troponin I</td><td align="center" valign="middle" >5.1</td><td align="center" valign="middle" >1.2</td><td align="center" valign="middle" >2.4</td><td align="center" valign="middle" >5.3</td><td align="center" valign="middle" >n/a</td><td align="center" valign="middle" >0.4</td><td align="center" valign="middle" >0.54</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0.37</td></tr></tbody></table></table-wrap><p>The mean concentrations, standard deviations, and p-value comparisons for the markers in which no significant differences were observed between the patient groups.</p></sec><sec id="s4"><title>4. Discussion</title><p>This study has revealed similarities and differences in the systemic and muscle gene expression levels of factors that are putatively involved in the pathophysiology of muscle contractures in individuals with cerebral palsy or stroke.</p><p>It is not surprising that significantly lower myostatin levels were observed in individuals with CP and in stroke survivors when compared to healthy controls both at the systemic level and at gene expression level in skeletal muscle (<xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig4">Figure 4</xref>). Myostatin is a growth and differentiation factor predominantly found in skeletal muscle, which greatly impacts muscle growth and function [<xref ref-type="bibr" rid="scirp.107383-ref9">9</xref>]. Myostatin’s role as a muscle suppressor has been found across species. In humans the crucial role of Myostatin has been verified when a myostatin mutation was identified in a human child leading to abnormal muscle hypertrophy [<xref ref-type="bibr" rid="scirp.107383-ref10">10</xref>]. Myostatin also shows some promise as a potential therapy for conditions associated with muscle wasting and weakness [<xref ref-type="bibr" rid="scirp.107383-ref10">10</xref>]. Individuals with CP and stroke survivors have in common that they have significantly less muscle mass in their affected limbs as compared to healthy controls [<xref ref-type="bibr" rid="scirp.107383-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref12">12</xref>]. The low levels of myostatin in individuals with CP and stroke may indicate a compensatory reaction to muscle weakness, reduced muscle growth and/or atrophy and increased fatigue that these patients experience [<xref ref-type="bibr" rid="scirp.107383-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref14">14</xref>]. While muscle atrophy with</p><p>certainty is causing lower muscle mass in stroke survivors [<xref ref-type="bibr" rid="scirp.107383-ref15">15</xref>], there is considerable more discussion regarding the underlying mechanisms in individuals with CP due to the more complex maturation processes [<xref ref-type="bibr" rid="scirp.107383-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref19">19</xref>]. However, the present finding indicates that myostatin levels decrease regardless of at which stage of life an injury of the CNS is acquired.</p><p>The gene expression of collagen type 4A1 (<xref ref-type="fig" rid="fig4">Figure 4</xref>) was significantly lower expressed in the muscle of individuals with CP when compared to healthy Ctrl and stroke survivors. In contrast, no significant changes in collagen type 4 were found at the systemic level. Collagen type 4 is a crucial part of the basal membrane of muscles and the brain and has been shown to play an important role in several diseases including HANAC syndrome [<xref ref-type="bibr" rid="scirp.107383-ref20">20</xref>] and Walker-Warburg syndrome [<xref ref-type="bibr" rid="scirp.107383-ref21">21</xref>] causing various musculoskeletal symptoms including muscle weakness, hypotonia, and severe myopathy [<xref ref-type="bibr" rid="scirp.107383-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref25">25</xref>]. One study showed an association between the COL4A1 gene and CP when comparing 351 individuals with CP with 220 healthy individuals indicating a potential role of COL4A1 in the pathogenesis of CP [<xref ref-type="bibr" rid="scirp.107383-ref26">26</xref>]. Altered COL4A1 DNA variants have also shown to cause diffuse or periventricular leukoen-cephalopathy [<xref ref-type="bibr" rid="scirp.107383-ref27">27</xref>]. In addition, COL4A1 variants were found in two atypical periventricular hemorrhagic infarction patients who were also diagnosed with spastic unilateral CP [<xref ref-type="bibr" rid="scirp.107383-ref28">28</xref>]. It has been suggested previously that the ubiquitously expression of COL4A1 in the body very likely is involved in the etiology of CP [<xref ref-type="bibr" rid="scirp.107383-ref26">26</xref>]. Since the COL4A1 expression only is affected in CNS injuries with an early onset the present findings support this notion.</p><p>CKMB is an intracellular enzyme found in the myocardium; therefore, high levels of CKMB in the serum suggest injury to the myocardial cell wall [<xref ref-type="bibr" rid="scirp.107383-ref29">29</xref>]. A previous study found elevated levels of CKMB in stroke survivors within 72 hours of onset of an acute ischemic stroke [<xref ref-type="bibr" rid="scirp.107383-ref30">30</xref>]. The elevated levels of CKMB in stroke are suspected to be related to cardiac myocytolysis caused by the activation of the sympathetic nervous system [<xref ref-type="bibr" rid="scirp.107383-ref31">31</xref>] or an increase in systemic catecholamines [<xref ref-type="bibr" rid="scirp.107383-ref32">32</xref>]. In the present study we observed increased CKMB levels in stroke patients when compared to healthy individuals even though the stroke of included subjects was several years prior to the present study. This suggests that the pathological effects of an CNS injury that is acquired later in life are rather long-lasting or that those patients have a higher risk for a subsequent myocardial infarct. Even though CKMB is mostly used as a biomarker for myocardial infarction, CKMB has also been used as a marker for muscle damage since the plasma levels of CKMB have been shown to increase during high intensity exercise [<xref ref-type="bibr" rid="scirp.107383-ref33">33</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref34">34</xref>], rhabdomyolysis [<xref ref-type="bibr" rid="scirp.107383-ref35">35</xref>] and muscle trauma [<xref ref-type="bibr" rid="scirp.107383-ref36">36</xref>]. Whether muscle atrophy and contracture development might cause muscle damage, and thus affect plasma CKMB levels is unclear. However, since we do not have any data on CKMB levels in muscle tissue, but only systemic levels, we cannot draw any final conclusions on muscle involvement as reflected by systemic CKMB expression.</p><p>Another key component of skeletal muscles is Troponin-1 which controls striated muscle contraction and relaxation. Troponin-1 interacts with all major regulatory proteins in the sarcomeric thin filaments of cardiac and skeletal muscles [<xref ref-type="bibr" rid="scirp.107383-ref37">37</xref>]. Previous studies have shown very promising results regarding the use of slow skeletal Troponin I as a systemic biomarker for various muscle disorders [<xref ref-type="bibr" rid="scirp.107383-ref38">38</xref>] [<xref ref-type="bibr" rid="scirp.107383-ref39">39</xref>]. However, in the present study the slow skeletal Troponin I expression showed no differences between the 3 groups at the systemic level, but when measured locally in the muscle tissue the present study reveals an increased troponin-1 expression in stroke survivors when compared to healthy controls and individuals with CP, while there was no difference between the CP and the healthy Ctrl groups (<xref ref-type="fig" rid="fig4">Figure 4</xref>). This finding is somewhat in contrast to other previous findings showing that subjects with spastic CP had less type I fibers and an increased amount of type IIX fibers when compared to healthy controls [<xref ref-type="bibr" rid="scirp.107383-ref40">40</xref>]. Another study showed that denervation through Botulinum toxin A injections caused a type 1 fiber loss and type 2 fiber predominance in the gastrochnemius muscle of children with CP [<xref ref-type="bibr" rid="scirp.107383-ref41">41</xref>]. However, we suggest that the increased gene expression of troponin-1 observed in the ST group might reflect a compensatory mechanism of the muscle, maybe as an effort to counteract the loss of Type I fibers due to denervation of the muscle after a CNS injury that has been acquired later in life. Unfortunately we can only speculate on this without drawing any final conclusions since no further data on fiber-types are available from the present participants.</p><p>CRP is an important component of the innate immune system and is known to increase in injured tissue [<xref ref-type="bibr" rid="scirp.107383-ref42">42</xref>]. The role of CRP within the innate immune system makes it a marker for inflammation. A 2003 study found that post-stroke elevated CRP levels predicted further disease-related ischemic events, suggesting that stroke survivors may be at risk for another ischemic event [<xref ref-type="bibr" rid="scirp.107383-ref43">43</xref>]. This is consistent with our observation that the CRP levels were significantly increased in stroke survivors (late onset) but not in individuals with CP (early onset. This indicates that CRP is primarily of importance for CNS injuries acquired later in life. Furthermore, this finding does also indicate that the stroke survivors still are affected by their stroke even several years (Mean 3.6 years) after the incident. The high level of CRP in stroke may either indicate inflammation in response to injured tissue or low-grade systemic inflammation. Increased levels of inflammation in stroke survivors, however, do not explain phenotypic differences in muscle atrophy and muscle contracture development.</p></sec><sec id="s5"><title>5. Summary</title><p>In summary, the present study shows that individuals with CNS injuries acquired either early (CP) or later in life (stroke survivors) both present differences and similarities in systemic biomarkers and in gene expression levels in skeletal muscle.</p></sec><sec id="s6"><title>Acknowledgements</title><p>We thank all participants for contributing to this study.</p></sec><sec id="s7"><title>Ethics Approval and Consent to Participate</title><p>All participants gave informed consent and the protocol was approved by the Regional Ethics Committee for Copenhagen (H-4-2014-047). The protocol was in compliance with the Helsinki Declaration.</p></sec><sec id="s8"><title>Availability of Data and Material</title><p>All data generated during this study are included in this published article.</p></sec><sec id="s9"><title>Funding</title><p>This project was funded by the Danish Research Council (DFF-1333-00197), and the Elsass Foundation.</p></sec><sec id="s10"><title>Author Contributions</title><p>All authors have contributed equally to this work, and have approved the final version of the manuscript. All authors are designated as authors and are qualified for authorship, and are all listed as authors.</p></sec><sec id="s11"><title>Conflicts of Interest</title><p>The authors declare that they have no competing interests.</p></sec><sec id="s12"><title>Cite this paper</title><p>Pingel, J., Potts, C., Petersen, T.W. and Nielsen, J.B. (2021) Cerebral Palsy and Stroke—Early and Late Brain Lesion Present Differences in Systemic Biomarkers and Gene Expression Related to Muscle Contractures. World Journal of Neuroscience, 11, 34-47. https://doi.org/10.4236/wjns.2021.111005</p></sec></body><back><ref-list><title>References</title><ref id="scirp.107383-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Mathewson, M.A. and Lieber, R.L. (2015) Pathophysiology of Muscle Contractures in Cerebral Palsy. Physical Medicine and Rehabilitation Clinics of North America, 26, 57-67. https://doi.org/10.1016/j.pmr.2014.09.005</mixed-citation></ref><ref id="scirp.107383-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">O’Dwyer, N.J., Ada, L. and Neilson, P.D. (1996) Spasticity and Muscle Contracture Following Stroke. Brain, 119, 1737-1749. https://doi.org/10.1093/brain/119.5.1737</mixed-citation></ref><ref id="scirp.107383-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Pingel, J., Bartels, E.M. and Nielsen, J.B. (2016) New Perspectives on the Development of Muscle Contractures Following Central Motor Lesions. The Journal of Physiology, 595, 1027-1038. https://doi.org/10.1113/JP272767</mixed-citation></ref><ref id="scirp.107383-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Graham, H.K., Rosenbaum, P., Paneth, N., et al. (2016) Cerebral Palsy. Nature Reviews Disease Primers, 2, Article No. 15082. https://doi.org/10.1038/nrdp.2016.5</mixed-citation></ref><ref id="scirp.107383-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Kalkman, B.M., Bar-On, L., O’Brien, T.D., et al. (2020) Stretching Interventions in Children with Cerebral Palsy: Why Are They Ineffective in Improving Muscle Function and How Can We Better Their Outcome? Frontiers in Physiology, 11, 131. https://doi.org/10.3389/fphys.2020.00131</mixed-citation></ref><ref id="scirp.107383-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Gough, M. and Shortland, A.P. (2012) Could Muscle Deformity in Children with Spastic Cerebral Palsy Be Related to an Impairment of Muscle Growth and Altered Adaptation? Developmental Medicine and Child Neurology, 54, 495-499. https://doi.org/10.1111/j.1469-8749.2012.04229.x</mixed-citation></ref><ref id="scirp.107383-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Smith, L.R., Lee, K.S., Ward, S.R., et al. (2011) Hamstring Contractures in Children with Spastic Cerebral Palsy Result from a Stiffer Extracellular Matrix and Increased in Vivo Sarcomere Length. The Journal of Physiology, 589, 2625-2639. https://doi.org/10.1113/jphysiol.2010.203364</mixed-citation></ref><ref id="scirp.107383-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Tedroff, K., Lowing, K., Jacobson, D.N., et al. (2011) Does Loss of Spasticity Matter? A 10-Year Follow-Up after Selective Dorsal Rhizotomy in Cerebral Palsy. Developmental Medicine and Child Neurology, 53, 724-729. https://doi.org/10.1111/j.1469-8749.2011.03969.x</mixed-citation></ref><ref id="scirp.107383-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Sharma, M., McFarlane, C., Kambadur, R., et al. (2015) Myostatin: Expanding Horizons. IUBMB Life, 67, 589-600. https://doi.org/10.1002/iub.1392</mixed-citation></ref><ref id="scirp.107383-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Schuelke, M., Wagner, K.R., Stolz, L.E., et al. (2004) Myostatin Mutation Associated with Gross Muscle Hypertrophy in a Child. The New England Journal of Medicine, 350, 2682-2688. https://doi.org/10.1056/NEJMoa040933</mixed-citation></ref><ref id="scirp.107383-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Barber, L., Hastings-Ison, T., Baker, R., et al. (2011) Medial Gastrocnemius Muscle Volume and Fascicle Length in Children Aged 2 to 5 Years with Cerebral Palsy. Developmental Medicine and Child Neurology, 53, 543-548. https://doi.org/10.1111/j.1469-8749.2011.03913.x</mixed-citation></ref><ref id="scirp.107383-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Nozoe, M., Kanai, M., Kubo, H., et al. (2016) Changes in Quadriceps Muscle Thickness, Disease Severity, Nutritional Status, and C-Reactive Protein after Acute Stroke. Journal of Stroke &amp; Cerebrovascular Diseases, 25, 2470-2474. https://doi.org/10.1016/j.jstrokecerebrovasdis.2016.06.020</mixed-citation></ref><ref id="scirp.107383-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Ada, L., O’Dwyer, N. and O’Neill, E. (2006) Relation between Spasticity, Weakness and Contracture of the Elbow Flexors and Upper Limb Activity after Stroke: An Observational Study. Disability and Rehabilitation, 28, 891-897. https://doi.org/10.1080/09638280500535165</mixed-citation></ref><ref id="scirp.107383-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Geertsen, S.S., Kirk, H., Lorentzen, J., et al. (2015) Impaired Gait Function in Adults with Cerebral Palsy Is Associated with Reduced Rapid Force Generation and Increased Passive Stiffness. Clinical Neurophysiology, 126, 2320-2329. https://doi.org/10.1016/j.clinph.2015.02.005</mixed-citation></ref><ref id="scirp.107383-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">English, C., McLennan, H., Thoirs, K., et al. (2010) Loss of Skeletal Muscle Mass after Stroke: A Systematic Review. International Journal of Stroke, 5, 395-402. https://doi.org/10.1111/j.1747-4949.2010.00467.x</mixed-citation></ref><ref id="scirp.107383-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Braun, T. and Gautel, M. (2011) Transcriptional Mechanisms Regulating Skeletal Muscle Differentiation, Growth and Homeostasis. Nature Reviews Molecular Cell Biology, 12, 349-361. https://doi.org/10.1038/nrm3118</mixed-citation></ref><ref id="scirp.107383-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Herskind, A., Ritterband-Rosenbaum, A., Willerslev-Olsen, M., et al. (2016) Muscle Growth Is Reduced in 15-Month-Old Children with Cerebral Palsy. Developmental Medicine and Child Neurology, 58, 485-491. https://doi.org/10.1111/dmcn.12950</mixed-citation></ref><ref id="scirp.107383-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Durand, P., Couto, R.A., Isakov, R., et al. (2016) Botulinum Toxin and Muscle Atrophy: A Wanted or Unwanted Effect. Aesthetic Surgery Journal, 36, 482-487. https://doi.org/10.1093/asj/sjv208</mixed-citation></ref><ref id="scirp.107383-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Gough, M. (2009) Does Botulinum Toxin Prevent or Promote Deformity in Children with Cerebral Palsy? Developmental Medicine and Child Neurology, 51, 89-90. https://doi.org/10.1111/j.1469-8749.2008.03247.x</mixed-citation></ref><ref id="scirp.107383-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Plaisier, E., Chen, Z., Gekeler, F., et al. (2010) Novel COL4A1 Mutations Associated with HANAC Syndrome: A Role for the Triple Helical CB3[IV] Domain. American Journal of Medical Genetics Part A, 152, 2550-2555. https://doi.org/10.1002/ajmg.a.33659</mixed-citation></ref><ref id="scirp.107383-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Vajsar, J. and Schachter, H. (2006) Walker-Warburg Syndrome. Orphanet Journal of Rare Diseases, 1, 29. https://doi.org/10.1186/1750-1172-1-29</mixed-citation></ref><ref id="scirp.107383-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Decio, A., Tonduti, D., Pichiecchio, A., et al. (2015) A Novel Mutation in COL4A1 Gene: A Possible Cause of Early Postnatal Cerebrovascular Events. American Journal of Medical Genetics Part A, 167, 810-815. https://doi.org/10.1002/ajmg.a.36907</mixed-citation></ref><ref id="scirp.107383-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Giorgio, E., Vaula, G., Bosco, G., et al. (2015) Two Families with Novel Missense Mutations in COL4A1: When Diagnosis Can Be Missed. Journal of the Neurological Sciences, 352, 99-104. https://doi.org/10.1016/j.jns.2015.03.042</mixed-citation></ref><ref id="scirp.107383-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Jeanne, M., Labelle-Dumais, C., Jorgensen, J., et al. (2012) COL4A2 Mutations Impair COL4A1 and COL4A2 Secretion and Cause Hemorrhagic Stroke. American Journal of Human Genetics, 90, 91-101. https://doi.org/10.1016/j.ajhg.2011.11.022</mixed-citation></ref><ref id="scirp.107383-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Tonduti, D., Pichiecchio, A., La Piana, R., et al. (2012) COL4A1-Related Disease: Raised Creatine Kinase and Cerebral Calcification as Useful Pointers. Neuropediatrics, 43, 283-288. https://doi.org/10.1055/s-0032-1325116</mixed-citation></ref><ref id="scirp.107383-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Bi, D., Wang, H., Shang, Q., et al. (2016) Association of COL4A1 Gene Polymorphisms with Cerebral Palsy in a Chinese Han Population. Clinical Genetics, 90, 149-155. https://doi.org/10.1111/cge.12723</mixed-citation></ref><ref id="scirp.107383-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Alamowitch, S., Plaisier, E., Favrole, P., et al. (2009) Cerebrovascular Disease Related to COL4A1 Mutations in HANAC Syndrome. Neurology, 73, 1873-1882. https://doi.org/10.1212/WNL.0b013e3181c3fd12</mixed-citation></ref><ref id="scirp.107383-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Harteman, J.C., Van Haastert, I.C., Liem, K.D., Stroink, H., Bierings, M.B., Huisman, A. and De Vries, L. (2012) Atypical Timing and Presentation of Periventricular Haemorrhagic Infarction in Preterm Infants: The Role of Thrombophilia. Developmental Medicine &amp; Child Neurology, 54, 140-147. https://doi.org/10.1111/j.1469-8749.2011.04135.x</mixed-citation></ref><ref id="scirp.107383-ref29"><label>29</label><mixed-citation publication-type="book" xlink:type="simple">Cabaniss, C.D. (1990) Chapter 32 Creatine Kinase. In: Walker, H.K., Hall, W.D., et al., Eds., Clinical Methods: The History, Physical, and Laboratory Examinations, Butterworth Publishers, Boston.</mixed-citation></ref><ref id="scirp.107383-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Suleiman, H.M., Aliyu, I.S., Abubakar, S.A., et al. (2017) Cardiac Troponin T and Creatine Kinase MB Fraction Levels among Patients with Acute Ischemic Stroke in Nigeria. Nigerian Journal of Clinical Practice, 20, 1618-1621.</mixed-citation></ref><ref id="scirp.107383-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Myers, M.G., Norris, J.W., Hachinski, V.C., et al. (1982) Cardiac Sequelae of Acute Stroke. Stroke, 13, 838-842. https://doi.org/10.1161/01.STR.13.6.838</mixed-citation></ref><ref id="scirp.107383-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Barber, M., Morton, J.J., Macfarlane, P.W., et al. (2007) Elevated Troponin Levels Are Associated with Sympathoadrenal Activation in Acute Ischaemic Stroke. Cerebrovascular Diseases (Basel, Switzerland), 23, 260-266. https://doi.org/10.1159/000098325</mixed-citation></ref><ref id="scirp.107383-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Nie, J., Tong, T.K., George, K., et al. (2011) Resting and Post-Exercise Serum Biomarkers of Cardiac and Skeletal Muscle Damage in Adolescent Runners. Scandinavian Journal of Medicine &amp; Science in Sports, 21, 625-629. https://doi.org/10.1111/j.1600-0838.2010.01096.x</mixed-citation></ref><ref id="scirp.107383-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Shave, R., George, K.P., Atkinson, G., et al. (2007) Exercise-Induced Cardiac Troponin T Release: A Meta-Analysis. Medicine and Science in Sports and Exercise, 39, 2099-2106. https://doi.org/10.1249/mss.0b013e318153ff78</mixed-citation></ref><ref id="scirp.107383-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Sutidze, M., Sulakvelidze, M., Kochiashvili, D., et al. (2006) Creatine Kinase MB, Cardiac Troponin T and Cardiac Troponin I as the Markers of Rhabdomyolysis in Chronic Hemodialysis Patients. Georgian Medical News, No. 132, 68-71.</mixed-citation></ref><ref id="scirp.107383-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Schwartz, J.G., Prihoda, T.J., Stuckey, J.H., et al. (1988) Creatine Kinase MB in Cases of Skeletal Muscle Trauma. Clinical Chemistry, 34, 898-901. https://doi.org/10.1093/clinchem/34.5.898</mixed-citation></ref><ref id="scirp.107383-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Layland, J., Solaro, R.J. and Shah, A.M. (2005) Regulation of Cardiac Contractile Function by Troponin I Phosphorylation. Cardiovascular Research, 66, 12-21. https://doi.org/10.1016/j.cardiores.2004.12.022</mixed-citation></ref><ref id="scirp.107383-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Simpson, J.A., Labugger, R., Collier, C., et al. (2005) Fast and Slow Skeletal Troponin I in Serum from Patients with Various Skeletal Muscle Disorders: A Pilot Study. Clinical Chemistry, 51, 966-972. https://doi.org/10.1373/clinchem.2004.042671</mixed-citation></ref><ref id="scirp.107383-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Chapman, D.W., Simpson, J.A., Iscoe, S., et al. (2013) Changes in Serum Fast and Slow Skeletal Troponin I Concentration Following Maximal Eccentric Contractions. Journal of Science and Medicine in Sport, 16, 82-85. https://doi.org/10.1016/j.jsams.2012.05.006</mixed-citation></ref><ref id="scirp.107383-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Ponten, E.M. and Stal, P.S. (2007) Decreased Capillarization and a Shift to Fast Myosin Heavy Chain IIx in the Biceps Brachii Muscle from Young Adults with Spastic Paresis. Journal of the Neurological Sciences, 253, 25-33. https://doi.org/10.1016/j.jns.2006.11.006</mixed-citation></ref><ref id="scirp.107383-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Valentine, J., Stannage, K., Fabian, V., et al. (2016) Muscle Histopathology in Children with Spastic Cerebral Palsy Receiving Botulinum Toxin Type A. Muscle &amp; Nerve, 53, 407-414. https://doi.org/10.1002/mus.24763</mixed-citation></ref><ref id="scirp.107383-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Ansar, W. and Ghosh, S. (2013) C-Reactive Protein and the Biology of Disease. Immunologic Research, 56, 131-142. https://doi.org/10.1007/s12026-013-8384-0</mixed-citation></ref><ref id="scirp.107383-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Arenillas, J.F., Alvarez-Sabin, J., Molina, C.A., et al. (2003) C-Reactive Protein Predicts Further Ischemic Events in First-Ever Transient Ischemic Attack or Stroke Patients with Intracranial Large-Artery Occlusive Disease. Stroke, 34, 2463-2468. https://doi.org/10.1161/01.STR.0000089920.93927.A7</mixed-citation></ref></ref-list></back></article>