<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2021.121003</article-id><article-id pub-id-type="publisher-id">AJPS-106626</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Knockdown of &lt;i&gt;GmSOG1&lt;/i&gt; Compromises Drought Tolerance in Transgenic Soybean Lines
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Samuel</surname><given-names>Aduse Poku</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Peter</surname><given-names>Nkachukwu Chukwurah</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Htut</surname><given-names>Htet Aung</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ikuo</surname><given-names>Nakamura</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Laboratory of Plant Cell Technology, Chiba University, Chiba, Japan</addr-line></aff><pub-date pub-type="epub"><day>18</day><month>01</month><year>2021</year></pub-date><volume>12</volume><issue>01</issue><fpage>18</fpage><lpage>36</lpage><history><date date-type="received"><day>2,</day>	<month>December</month>	<year>2020</year></date><date date-type="rev-recd"><day>17,</day>	<month>January</month>	<year>2021</year>	</date><date date-type="accepted"><day>20,</day>	<month>January</month>	<year>2021</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Plants are regularly exposed to myriads of stress factors that cause tremendous damage to their genetic make-up. To ensure genome stability and survival over several generations under harsher environmental conditions, plants have evolved a unique mechanism for dealing with DNA damage known as the DNA damage response pathway (DDR). It has been proposed that there may exist a relationship between the DNA damage response pathway and abiotic stress response in plants. To further investigate this relationship, we 
  knocked down the soybean suppressor of gamma response 1 gene (GmSOG1),
   a master regulatory gene of the DDR, in soybean plants and subjected the generated transgenic plants to drought stress analysis. Gene expression analysis of the 
  GmSOG1
   gene in drought stressed soybean tissues revealed high levels of expression in buds and young leaves. The root lengths and root fresh weights of transgenic soybean plants grown on Murashige and Skoog media supplemented with Gamborg B5 vitamins (MSB5 media) containing 200 mM mannitol for 10 days were significantly lesser than those of drought stressed wild-type plants. Polyethylene glycol (PEG) induced drought stress assay 
  in vivo 
  resulted in significant damage in transgenic plants compared with wild-type plants. Also, the relative expressions of known drought responsive transcription factors such as 
  GmDREB1
   and 
  GmLEA
   as well as antioxidation related genes like 
  GmAPX
   and 
  GmCAT 
  were downregulated in transgenic soybean lines relative to wild-type plants. Moreover, wild-type soybean plants accumulated more chlorophyll and less malondialdehyde (MDA) than transgenic lines. A confirmatory experiment in 
  GmSOG1 
  overexpressing Arabidopsis 
  plants also showed significantly higher survival rates and anti-oxidation
   enzyme accumulation in drought stressed 
  GmSOG1
   overexpressing Arabidopsis lines compared with wild-type plants. These results suggest that the 
  SOG1
   gene may play active roles in plant abiotic stress defense.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;GmSOG1&lt;/i&gt;</kwd><kwd> DNA Damage</kwd><kwd> Abiotic Stress</kwd><kwd> Drought Stress</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The soybean plant is the most cultivated oil seed crop worldwide, occupying about 6% of the world’s total landmass under cultivation [<xref ref-type="bibr" rid="scirp.106626-ref1">1</xref>]. The plant contains several useful metabolites and it is the most economically important oil seed crop as well as the leading source of vegetable oil in the world [<xref ref-type="bibr" rid="scirp.106626-ref2">2</xref>]. Research has identified several useful health benefits for the plant including the prevention of cancer, kidney diseases, obesity and diabetes [<xref ref-type="bibr" rid="scirp.106626-ref3">3</xref>].</p><p>Drought stress is one of the major factors affecting soybean production, causing about 40% of global yield losses annually [<xref ref-type="bibr" rid="scirp.106626-ref4">4</xref>]. Drought is usually caused by a variety of factors such as low humidity, high temperatures and water deficiency [<xref ref-type="bibr" rid="scirp.106626-ref5">5</xref>]. Soybean plants exposed to drought conditions experience reduced nitrogen fixation, loss of CO<sub>2 </sub>accumulation and reduction in leaf area [<xref ref-type="bibr" rid="scirp.106626-ref6">6</xref>], which consequently results in a decrease in protein synthesis and yield losses [<xref ref-type="bibr" rid="scirp.106626-ref7">7</xref>].</p><p>Given the useful nature of the soybean crop, several studies have identified useful drought defense genes in the plant. For example, Arabidopsis plants expressing the soybean dehydration responsive binding protein 2 gene (GmDREB2) were reported to have shown enhanced tolerance to drought and salt stresses [<xref ref-type="bibr" rid="scirp.106626-ref8">8</xref>]. The soybean ethylene responsive factor 3 (GmERF3) transcription factor was also found to confer drought tolerance to transgenic tobacco plants [<xref ref-type="bibr" rid="scirp.106626-ref9">9</xref>]. Wheat and Arabidopsis plants expressing the soybean basic leucine zipper 1 (GmbZIP1) transcription factor showed tolerance to drought and other abiotic stresses [<xref ref-type="bibr" rid="scirp.106626-ref10">10</xref>].</p><p>Under stress conditions, reactive oxygen species (ROS) such as singlet oxygen, superoxide anions and hydroxyl radicals accumulate in plants leading to DNA damage. One mechanism by which plants deal with reactive oxygen species is via the anti-oxidation pathway by means of enzymes such as catalase (CAT) and ascorbate peroxidase (APX). In addition to the antioxidation pathway, plants have evolved an efficient system known as the DNA damage response (DDR) pathway [<xref ref-type="bibr" rid="scirp.106626-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.106626-ref12">12</xref>]. The DDR pathway is made up of key components including DNA damage sensors, signal transducers, mediators, and effectors [<xref ref-type="bibr" rid="scirp.106626-ref13">13</xref>] that perform functions such as the activation of DNA repair pathways and the termination of cell division in proliferating cells experiencing DNA damage [<xref ref-type="bibr" rid="scirp.106626-ref14">14</xref>].</p><p>Thesuppressor of gamma response 1 (SOG1) gene has been identified as an important gene in plant DNA damage response [<xref ref-type="bibr" rid="scirp.106626-ref15">15</xref>]. This gene is a plant specific transcription factor belonging to the no apical meristem (NAM), Arabidopsis transcription activation factor (ATAF1/2), and cup shaped cotyledon (CUC2); NAC family of proteins [<xref ref-type="bibr" rid="scirp.106626-ref15">15</xref>]. In addition to a central NAC domain, the gene possesses two other domains: The N-terminal extension and the C-terminal transcription regulatory domain which contains five serine-glutamine sites that are phosphorylated in response to DNA damage [<xref ref-type="bibr" rid="scirp.106626-ref16">16</xref>]. The SOG1 gene has been shown to play significant roles in cell cycle regulation during DNA damage. For example, Irradiated SOG1 Arabidopsis mutants showed decreases in expression levels of genes related with cell cycle regulation such as the cyclin dependent kinase B2-1 gene (CDKB2-1) and KNOLLE for a 24-hour period [<xref ref-type="bibr" rid="scirp.106626-ref15">15</xref>]. Also, the growth of roots of seedlings of sog1-1 lines was not inhibited relative to those of wild-type seedlings when grown in media containing zeocin, a mutagen [<xref ref-type="bibr" rid="scirp.106626-ref17">17</xref>]. Other studies have also identified SOG1 to be involved in programmed cell death [<xref ref-type="bibr" rid="scirp.106626-ref18">18</xref>], the initiation of endoreduplication [<xref ref-type="bibr" rid="scirp.106626-ref17">17</xref>] and the maintenance of genome stability in response to DNA damage [<xref ref-type="bibr" rid="scirp.106626-ref15">15</xref>].</p><p>The ability of a plant to maintain its genome integrity under stress conditions is likely to play a vital role in stress tolerance. However, very few studies have focused on the roles DDR related genes play in abiotic stress defense [<xref ref-type="bibr" rid="scirp.106626-ref14">14</xref>]. Here we report the functional characterization of the GmSOG1 gene. In this work, we chose the GmSOG1 gene because of its unique characteristic as a major player in the DDR pathway. We hypothesized that the GmSOG1 gene apart from being a potentially valuable drought defense gene for soybeans, might also help us understand the interplay between the DDR and abiotic stress response in plants.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Phylogenetic Analysis of the GmSOG1</title><p>Amino acid sequences of the protein (XP_006604012) encoded by GmSOG1 was aligned with homologous sequences from Phaseolus vulgaris (XP_007141005), Arabidopsis thaliana (NP_001319443), Vigna unguiculata (XP_027922212), Solanum lycopersicum (XP_004231842), Capsicum annuum (XP_016561625), Gossypium hirsutum (XP_016673290), Brassica napus (XP_013642093.1) and Cucumis melo (XP_008458820) with the Clustal W software [<xref ref-type="bibr" rid="scirp.106626-ref19">19</xref>]. Using the MEGA 5.0 software, a phylogenetic tree was constructed by means of the neighbor-joining method. The tree was constructed with 1000 bootstrap replicates [<xref ref-type="bibr" rid="scirp.106626-ref20">20</xref>]</p></sec><sec id="s2_2"><title>2.2. Generation of GmSOG1 Knockdown Transgenic Soybean Lines</title><p>A 395 bp fragment of the open reading frame of the GmSOG1 gene (XM_006603949) was PCR amplified with gene specific primers from cDNA isolated from soybean leaves. The amplified sequence was first cloned into the PCR8 entry vector, confirmed via sequencing and then cloned into the pANDA35HK RNAi vector by means of the Gateway LR cloning method. Two copies of GmSOG1 fragments were inserted in inverted orientation at both ends of the Gus linker (1.2 kb) sequence under the control of cauliflower mosaic virus (CaMV) 35S promoter (<xref ref-type="fig" rid="fig2">Figure 2</xref>(B)). Half seed explants of the Japanese soybean variety “Kurosengoku” were transformed according to the method previously described by Hinchee et al. [<xref ref-type="bibr" rid="scirp.106626-ref21">21</xref>] with few modifications. Soybean seeds were surface sterilized with 70% alcohol for 40 s and 1% sodium hypochlorite solution for 20 minutes. The sterilized seeds were plated on Gamborg B5 medium and germinated for 5 days. Explants were prepared by splitting 5-day old seedlings into equal halves along the hilium to separate the two cotyledons and the axillary bud region of cotyledonary nodes wounded with a surgical blade. Agrobacterium tumefaciens EHA105 cells carrying the RNAi construct (pANDA35HK::GmSOG1i) was vacuum infiltrated into wounded explants at a pressure of 25 mm of Hg for 20 mins. Co-cultivation was carried out in the dark on MS medium overlaid with filter paper for three days. Subsequently, explants were washed, blotted dry and plated on shoot induction medium (SIM) containing 70 mg/L kanamycin for 2 weeks. Developing shoots were excised from cotyledons and transferred onto rooting medium without kanamycin. The trimmed cotyledons were also transferred to a fresh shoot induction medium containing 75 mg/L kanamycin for another 2 weeks. Afterwards, the cotyledons were transferred onto shoot elongation medium (SEM) containing 75 mg/L kanamycin every two weeks until enough elongating shoots were obtained. 2 - 3 cm long putative transgenic shoots were rooted on rooting medium and transferred into pots containing soil. T<sub>3</sub> transgenic soybean seeds were obtained for further analysis.</p></sec><sec id="s2_3"><title>2.3. Generation of GmSOG1 Overexpressing Arabidopsis Lines</title><p>The full-length open reading frame of GmSOG1 was amplified from the cDNA of soybean leaves using gene specific primers and cloned into the PCR8 entry vector. After sequencing, the GmSOG1 gene was inserted downstream of the CaMV 35S promoter at the attR1-attR2sites of the pGWB2 binary vector [<xref ref-type="bibr" rid="scirp.106626-ref22">22</xref>] by means of LR cloning. For Arabidopsis thaliana transformation, Agrobacterium tumefaciens EHA105 cells bearing the pGWB2::GmSOG1 were transformed into Arabidopsis plants via the floral inoculation method [<xref ref-type="bibr" rid="scirp.106626-ref23">23</xref>]. T<sub>0</sub> transgenic seeds were harvested and sown on MS media containing 50 mg/L kanamycin and 20 mg/L meropenem. Kanamycin selection of putative seeds was carried out until T<sub>3</sub> homozygous lines were obtained. Lines 1, 2 and 3 were selected for further analysis.</p></sec><sec id="s2_4"><title>2.4. RT-PCR of Transgenic Soybean Plants</title><p>RNAs extracted from wild-type and transgenic soybean plants were converted to cDNA using the PrimeScript RT reagent with gDNA eraser kit (TaKaRa Bio Inc, Japan). Using cDNAs as template the GUS linker sequence in the pANDA35HK vector was amplified according to the following PCR conditions; initial denaturation: 94˚C for 2 minutes, denaturation: 94˚C, for 10 seconds, annealing: 62˚C for 10 seconds and extension: 68˚C for 15 seconds. Amplifications were carried out for 30 cycles with the soybean elongation factor 1α (GmEF1a) as an internal control gene.</p></sec><sec id="s2_5"><title>2.5. Real Time PCR</title><p>Quantitative real time PCR was carried out with the KOD SYBR qPCR Mix (TOYOBO) on a Step One Plus Real-Time PCR System machine (Applied Biosystems). Triplicates of 20 μl reaction mixture were set up for each treatment.</p></sec><sec id="s2_6"><title>2.6.In Vitro Drought Stress Analysis of Soybean Plants</title><p>Seeds of T3 transgenic and wild-type soybean plants (8 seeds per line for a single independent experiment) were germinated on MSB5 medium for three days and then transferred onto fresh MSB5 media containing 200 mM mannitol for 10 days. After ten days of growth, parameters such as weight of root mass and length of primary roots of individual plants were measured.</p></sec><sec id="s2_7"><title>2.7. Drought Stress Analysis of Transgenic Soybean Plants on Soil</title><p>Seeds of wild-type and T<sub>3</sub> transgenic soybean plants were germinated on MSB5 medium for 7 days. Afterwards, 10 plants (for a single independent experiment) of each line were transferred onto soils and grown in a plant growth chamber under 16/8 photoperiod. At 2 weeks, soybean plants were irrigated with 15% polyethylene glycol (PEG) for 10 days. Subsequently, plants were recovered with water for 3 days and parameters such as rate of survival and plant fresh weights taken. Plant survival rate was computed as the percentage of soybean plants not showing signs of whole plant wilting (plants with less than 90% - 100% of leaves not showing signs of wilting).</p></sec><sec id="s2_8"><title>2.8. Drought Stress Analysis of Transgenic Arabidopsis Plants</title><p>Seeds of T<sub>3</sub> transgenic Arabidopsis plants and wild-type Arabidopsis thaliana (Columbia-0 ecotype, Col-0) were surface-sterilized with 1% sodium hypochlorite solution for 10 mins, rinsed five times in sterile double-distilled water, plated on &#189; MS medium and vernalized in the dark at 4˚C for 2 days. The plates were taken out after two days and grown at 22˚C under 16 h light/8 h dark cycles for 12 more days. The seedlings were then transferred to soil and grown under the same conditions until the third week. 3-weeks-old seedlings (10 plants per line for a single independent experiment) were subjected to drought stress by withholding water for 14 days, followed by recovery by watering for 3 days.</p></sec><sec id="s2_9"><title>2.9. Rate of Water Loss</title><p>The rate of water loss in detached Arabidopsis leaves was determined according to the methods of [<xref ref-type="bibr" rid="scirp.106626-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.106626-ref25">25</xref>]. The rate of transpiration of detached Arabidopsis leaves was determined over a 6-hour period. Three sets of readings were taken for the Fresh weight (LWt) of leaves at every 60 min interval and the relative water loss (RWL) of leaves determined as follows: RWL = (FW-LWt)/FW &#215; 100, where LWt is the weight of the leaf subjected to desiccation treatment for t hours, and FW is the weight of leaves before desiccation.</p></sec><sec id="s2_10"><title>2.10. Lipid Peroxidation and Chlorophyll Content Determination</title><p>Malondialdehyde (MDA) content, a marker of lipid peroxidation, was determined in leaves according to the method previously described by Heath and Packer [<xref ref-type="bibr" rid="scirp.106626-ref26">26</xref>]. Leaf samples were ground with liquid nitrogen, suspended in 0.1% trichloroacetic acid (TCA), vortexed and centrifuged at 10,000 rpm for 5 mins. Next, 1 ml of the supernatant was dispensed into a separate tube and 4 ml of 0.5% thiobarbituric acid (TBA) added. The mixture was incubated at 95˚C for 30 mins. After incubation, the reaction was quickly cooled on ice and centrifuged at 5000 rpm for 5 mins to settle debris. Absorbances of the supernatants were measured at 532 and 600 nm. Unspecific turbidity was corrected for by subtracting the value at 600 nm. MDA concentration was determined according to an extinction (ε) of 155 mM<sup>−</sup><sup>1</sup>∙cm<sup>−</sup><sup>1</sup> and expressed as nanomoles per gram of fresh weight of leaf samples used.</p><p>The chlorophyll contents of plants were determined according to the method of Zhang et al. [<xref ref-type="bibr" rid="scirp.106626-ref27">27</xref>]. 0.1 g of leaf tissues were ground to a fine powder with liquid nitrogen and homogenized with 1 ml 100% DMF. The homogenized samples were centrifuged for 10 mins and the supernatants collected into fresh tubes. The optical densities of supernatants were measured at 664 nm and 647 nm and the total chlorophyll content determined according to the formula: [chlorophyll a + chlorophyll b] = 17.90 &#215; A647 + 8.08 &#215; A664.</p></sec><sec id="s2_11"><title>2.11. Determination of Ascorbate Peroxidase (APX) and Catalase (CAT) Contents</title><p>The activities of APX and catalase CAT were determined in the supernatants of 0.02 g of Arabidopsis leaves homogenized with 50 mM ice-cold phosphate buffer (pH 7.8) containing 1 mM EDTA. The activity of APX (EC 1.11.1.6) was assayed in accordance with the method of Nagano and Asada [<xref ref-type="bibr" rid="scirp.106626-ref28">28</xref>]. A total of 3 ml reaction mixture containing 50 mM phosphate buffer (pH 7.8), 0.1 mM EDTA, 0.5 mM ascorbate, 0.1 mM H<sub>2</sub>O<sub>2</sub> and 0.2 ml enzyme extract was set up. The activity of APX was determined spectrophotometrically by measuring the hydrogen peroxide induced oxidation of ascorbate at 290 nm for 3 mins at 30 seconds intervals. The molar extinction coefficient for ascorbate 2.8 mM<sup>−</sup><sup>1</sup>∙cm<sup>−</sup><sup>1</sup> was used to quantify APX activity. CAT activity was determined following the method outlined by Cakmak and Marschner [<xref ref-type="bibr" rid="scirp.106626-ref29">29</xref>] in 3 ml of reaction solution consisting of 100 mM phosphate buffer (pH7.0), 0.1 mM EDTA, 0.1% H<sub>2</sub>O<sub>2</sub> and 0.2 ml enzyme extract. CAT activity was quantified at an extinction enzyme extract co-efficient of 39.4 mM<sup>−</sup><sup>1</sup>∙cm<sup>−</sup><sup>1</sup> after the rate of decrease hydrogen peroxide measured at 240 nm on a spectrophotometer.</p></sec><sec id="s2_12"><title>2.12. Statistical Analysis</title><p>The SPSS software (SPSS Inc., Chicago, IL, USA) was used to analyze the data generated. The Duncan’s test was used to separate differences in means between treatments at a probability level of 0.05. Graphs were generated with Microsoft Excel. All experiments were performed in triplicates. Sequences of primers used in this work are given in <xref ref-type="table" rid="table1">Table 1</xref>.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> List of primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequences (5’ - 3’)</th></tr></thead><tr><td align="center" valign="middle" >GmLEAFP</td><td align="center" valign="middle" >TGGGTAATATTGGGCGAAGGAATG</td></tr><tr><td align="center" valign="middle" >GmLEARP</td><td align="center" valign="middle" >AATTTCAGGGGTGTGGTTAATGGG</td></tr><tr><td align="center" valign="middle" >GmDREB1FP</td><td align="center" valign="middle" >AGGAAGAAGAGCAGGTGTTGGATA</td></tr><tr><td align="center" valign="middle" >GmDREB1RP</td><td align="center" valign="middle" >GGCATCCAAGTCAGCATCTTCATA</td></tr><tr><td align="center" valign="middle" >GmAPX1FP</td><td align="center" valign="middle" >GTTGTTGAGTGGTGAGAAGGAAGG</td></tr><tr><td align="center" valign="middle" >GmAPX1RP</td><td align="center" valign="middle" >GCATATTTATCAACGAGAGGGCGG</td></tr><tr><td align="center" valign="middle" >GmCAT1FP</td><td align="center" valign="middle" >CCTGCATTTTGCCCTGCCATTATT</td></tr><tr><td align="center" valign="middle" >GmCAT1RP</td><td align="center" valign="middle" >TCCAAGTCTGTGTCTCTGGGTATC</td></tr><tr><td align="center" valign="middle" >GmEF1a5P</td><td align="center" valign="middle" >ACTGTGCTGTCCTGATTATTGACT</td></tr><tr><td align="center" valign="middle" >GmEF1a3P</td><td align="center" valign="middle" >GGACCAAAAGTAACAACCATACCA</td></tr><tr><td align="center" valign="middle" >HPTFP</td><td align="center" valign="middle" >CAGCTTCGATGTAGGAGGGCGTGG</td></tr><tr><td align="center" valign="middle" >HPTRP</td><td align="center" valign="middle" >AATCCCCGAACATCGCCTCGCTCC</td></tr><tr><td align="center" valign="middle" >GmSOG1RNAiFP</td><td align="center" valign="middle" >AGGTGAATATGTGGTTTCAAAAAT</td></tr><tr><td align="center" valign="middle" >GmSOG1RNAiRP</td><td align="center" valign="middle" >GAAAGTAAATTTTAGTGAACCAAG</td></tr><tr><td align="center" valign="middle" >GmSOG1FP</td><td align="center" valign="middle" >CTCTTCTTCGATACAATGGCTAGG</td></tr><tr><td align="center" valign="middle" >GmSOG1RP</td><td align="center" valign="middle" >CGCATAACCTGTCCATCCAATCAA</td></tr><tr><td align="center" valign="middle" >Gus linkerFP</td><td align="center" valign="middle" >CATGAAGATGCGGACTTACG</td></tr><tr><td align="center" valign="middle" >Gus linkerRP</td><td align="center" valign="middle" >ATCCACGCCGTATTCGG</td></tr></tbody></table></table-wrap></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Phylogenetic and Expression Analysis of GmSOG1 in Soybean Tissues</title><p>To understand the evolutionary relationship that exists between GmSOG1 and homologous proteins from other plants, a phylogenetic tree was constructed. The results of phylogenetic analysis revealed that GmSOG1 was closely related with a homologous protein in Gossypium hirsutum but distantly related with a similar protein in Arabidopsis thaliana (<xref ref-type="fig" rid="fig1">Figure 1</xref>(A)). Gene expression analysis of GmSOG1 in unstressed, drought stressed, and salt stressed soybean tissues showed the expression of the gene in all tissues tested. GmSOG1 was highly expressed in buds, young leaves and young shoots. Immature soybean pods on the other hand showed the lowest level of expression (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)).</p></sec><sec id="s3_2"><title>3.2. Generation of GmSOG1 Transgenic Soybean Lines</title><p>We generated six putative transgenic lines. Out of this number, only two lines could produce viable seeds. These lines were denoted as R1 and R2. qRT-PCR analysis confirmed the successful knockdown of the GmSOG1 gene in transgenic soybean lines. The GmSOG1 gene was found to be highly downregulated in R1 plants than R2 plants. On average, Knockdown transgenic lines showed about a 1.92-fold decrease in GmSOG1 expression relative to the wild-type (<xref ref-type="fig" rid="fig2">Figure 2</xref>(A)). Furthermore, transgenic plants were shown to be RT-PCR positive. The GUS-linker sequence of the pANDA35HK vector was successfully amplified from cDNAs isolated from transgenic soybean lines (<xref ref-type="fig" rid="fig2">Figure 2</xref>(B)).</p></sec><sec id="s3_3"><title>3.3. In Vitro Drought Stress Analysis of Soybean Plants</title><p>The drought tolerance capacities of soybean plants were evaluated based on root length and root fresh weight measurements of wild-type and transgenic plants (8 plants per line) subjected to drought stress on Murashige and Skoog medium plus B5 vitamins (MSB5) media containing 200 mM mannitol. After 10 days of droughts stress treatment, root lengths and root fresh weights were significantly higher in wild type soybean plants compared with RNAi transgenic lines (<xref ref-type="fig" rid="fig2">Figure 2</xref>(C), <xref ref-type="fig" rid="fig2">Figure 2</xref>(D)).</p></sec><sec id="s3_4"><title>3.4. Drought Stress Assays of Soybean Plants on Soil</title><p>The survival rates of wild-type soybean plants subjected to PEG-induced drought stress were significantly higher than transgenic lines. More than 70% of the tested wild-type plants survived after recovery whereas less than 10% of the two transgenic lines tested showed signs of recovery (<xref ref-type="fig" rid="fig3">Figure 3</xref>(A), <xref ref-type="fig" rid="fig3">Figure 3</xref>(B)). The fresh weights of wild-type soybean plants after drought stress treatment were also significantly higher than RNAi transgenic lines (<xref ref-type="fig" rid="fig3">Figure 3</xref>(C)).</p></sec><sec id="s3_5"><title>3.5. Relative Expression of Transcription Factors</title><p>The relative expression levels of two transcription factors: the soybean dehydration responsive element binding protein 1 gene (GmDREB1) and the soybean late embryogenesis abundant protein 5 gene (GmLEA-5) were investigated in leaves of unstressed and drought stressed wild-type and GmSOG1 knockdown soybean lines. The transcript levels of the two transcription factors tested were low and showed no significant differences between wild-type and knockdown lines in unstressed leaf samples. The rates of expression of both genes were however, upregulated in response to drought stress in all lines tested. Expression levels of the genes in drought stressed tissues were significantly higher in the wild-type line than transgenic lines (<xref ref-type="fig" rid="fig4">Figure 4</xref>(A), <xref ref-type="fig" rid="fig4">Figure 4</xref>(B)).</p></sec><sec id="s3_6"><title>3.6. Relative Expression of Anti-Oxidation Related Genes</title><p>The relative expression levels of anti-oxidation related genes such as GmAPX and GmCAT were studied in wild-type and knockdown transgenic soybean lines before and after drought stress application. The differences in the transcript levels of the two genes were minute in unstressed wild-type and transgenic lines. However, under drought stress, the wild-type line showed significantly higher transcription levels of both GmAPX and GmCATrelative to transgenic lines (<xref ref-type="fig" rid="fig4">Figure 4</xref>(C), <xref ref-type="fig" rid="fig4">Figure 4</xref>(D)). After drought stress application, on average, wild type plants accumulated approximately 10 times more GmAPX and 12 times more GmCAT1 transcripts than transgenic plants (<xref ref-type="fig" rid="fig4">Figure 4</xref>(C), <xref ref-type="fig" rid="fig4">Figure 4</xref>(D)).</p></sec><sec id="s3_7"><title>3.7. Relative MDA and Chlorophyll Contents</title><p>The relative amount of MDA was found to be significantly higher in knockdown transgenic soybean lines than in wild-type plants under both non-stressed and drought stressed conditions, indicating a higher level of lipid peroxidation in transgenic lines compared with wild-type plants. Averagely, unstressed wild-type soybean plants accumulated 2.31 times the amount of MDA in unstressed transgenic plants. Drought stressed wild-type soybean plants on the other hand accumulated 2.24 times the amount of MDA in transgenic plants under the same condition (<xref ref-type="fig" rid="fig5">Figure 5</xref>(A)). The chlorophyll contents of wild-type and transgenic plants were also significantly different under both non-stressed and drought stressed conditions. Transgenic plants accumulated significantly lesser amounts of chlorophyll compared to wild-type plants. On average, drought stressed wild-type soybean plants accumulated 1.4 times the amount of chlorophyll in transgenic plants under the same condition (<xref ref-type="fig" rid="fig5">Figure 5</xref>(B)).</p></sec><sec id="s3_8"><title>3.8. Drought Stress Analysis of Transgenic Arabidopsis Plants</title><p>3-weeks-old Arabidopsis seedlings were subjected to drought stress by with-holding water for 14 days. At the end of the drought stress application period, plants were recovered with water for 3 days. After drought stress application and recovery, all transgenic plants tested survived whereas none of the wild-type plants tested showed signs of recovery (<xref ref-type="fig" rid="fig6">Figure 6</xref>(A), <xref ref-type="fig" rid="fig6">Figure 6</xref>(B)). The rate of water loss in detached transgenic Arabidopsis leaves was also investigated over a period of six hours. Our results showed that leaves of wild-type plants had lost a significantly higher amount of water compared with transgenic plants. The wild-type line lost about 65% of its water content compared with a water loss rate of 25%, 34% and 39% for line 3, line 1 and line 2 transgenic Arabidopsis plants respectively (<xref ref-type="fig" rid="fig6">Figure 6</xref>(C)).</p></sec><sec id="s3_9"><title>3.9. Enzymatic Activities of APX and CAT in Arabidopsis Plants</title><p>The activities of APX and CAT were assayed in Arabidopsis plants prior and after drought stress treatment. The activities of the two enzymes tested were not significantly different in unstressed plants except in line 3. However, both APX and CAT showed significantly higher activities in drought stressed transgenic Arabidopsis lines compared to wild-type plants. On average, Transgenic lines accumulated 0.68 times more APX and 1.18 times more CAT than wild-type plants (<xref ref-type="fig" rid="fig7">Figure 7</xref>(A), <xref ref-type="fig" rid="fig7">Figure 7</xref>(B)).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>NAC genes are a major group of transcription factors that play major roles in plant root development and stress responses. This family of transcription factors contains several valuable candidate genes that can be used for plant drought stress improvement [<xref ref-type="bibr" rid="scirp.106626-ref30">30</xref>]. In this report, we studied the roles of GmSOG1 in drought stress tolerance.</p><p>Soybean plants when exposed to drought stress exhibit morphological changes in their growth [<xref ref-type="bibr" rid="scirp.106626-ref31">31</xref>]. One vital part of the soybean plant that shows changes in its morphology in response to drought stress is its root system [<xref ref-type="bibr" rid="scirp.106626-ref32">32</xref>] thus root traits have been proposed as useful drought tolerance indicators in soybean plants [<xref ref-type="bibr" rid="scirp.106626-ref33">33</xref>] [<xref ref-type="bibr" rid="scirp.106626-ref34">34</xref>]. A positive relationship has been found to exist between soybean root traits such as root weight and drought stress tolerance [<xref ref-type="bibr" rid="scirp.106626-ref31">31</xref>]. In this study, wild-type soybean plants recorded significantly higher root lengths and root fresh weights compared with GmSOG1 knockdown transgenic lines (<xref ref-type="fig" rid="fig2">Figure 2</xref>(C), <xref ref-type="fig" rid="fig2">Figure 2</xref>(D)). Evidence support the fact that deep penetrating roots with larger lateral root systems are advantageous under drought conditions [<xref ref-type="bibr" rid="scirp.106626-ref35">35</xref>]. Research has shown that roots with such architectures possess a greater total surface area and hence have the capacity to ensure maximum water and nutrient uptake to sustain photosynthesis under stress conditions [<xref ref-type="bibr" rid="scirp.106626-ref35">35</xref>].</p><p>Plant weight parameters have also been identified as useful markers for soybean drought tolerance [<xref ref-type="bibr" rid="scirp.106626-ref31">31</xref>]. The weight of plants after drought stress treatment can give an indication as to the extent to which the plants could maintain metabolism under such conditions. Our results showed that wild-type soybean plants had significantly higher fresh weights after drought stress recovery compared with knockdown transgenic lines (<xref ref-type="fig" rid="fig3">Figure 3</xref>(C)). The survival rates of wild-type plants were also significantly higher than knockdown transgenic lines (<xref ref-type="fig" rid="fig3">Figure 3</xref>(A), <xref ref-type="fig" rid="fig3">Figure 3</xref>(B)). A report on the functional study of the soybean delta-1-pyrroline-5-carboxylate synthase gene (GmP5CS) revealed higher rates of survival in drought stressed wild-type plants compared with P5CSknocked-down transgenic soybean lines [<xref ref-type="bibr" rid="scirp.106626-ref36">36</xref>]. In a confirmatory experiment involving GmSOG1 overexpressing Arabidopsis plants, all transgenic lines tested showed signs of recovery after recovery from drought stress whereas none of the wild-type plants could survive (<xref ref-type="fig" rid="fig6">Figure 6</xref>(A), <xref ref-type="fig" rid="fig6">Figure 6</xref>(B)).</p><p>Transcription factors play vital roles in plant stress defense by regulating the expression of other genes. We investigated the effects the downregulation of GmSOG1 would have on two known drought responsive genes: the GmLEA5 and GmDREB1 genes. Our results showed that the downregulation of GmSOG1 expression in transgenic lines resulted in a corresponding downregulation in the expression levels of the two genes tested (<xref ref-type="fig" rid="fig4">Figure 4</xref>(A), <xref ref-type="fig" rid="fig4">Figure 4</xref>(B)). In line with this result, it has been reported that the AtSOG1 transcription factor regulates the expression of certain abiotic stress responsive genes [<xref ref-type="bibr" rid="scirp.106626-ref37">37</xref>]. Another way plants deal with the deleterious effects of stress factors is by making changes in the expression profiles of antioxidation related genes [<xref ref-type="bibr" rid="scirp.106626-ref38">38</xref>]. Antioxidants play integral roles in both redox systems and DDR pathways to counteract the harmful effects of genotoxic stress in plants [<xref ref-type="bibr" rid="scirp.106626-ref39">39</xref>]. In this research, antioxidation related genes such as GmAPX and GmCAT were all downregulated in knockdown transgenic soybean plants relative to wild-type plants (<xref ref-type="fig" rid="fig4">Figure 4</xref>(C), <xref ref-type="fig" rid="fig4">Figure 4</xref>(D)). Furthermore, the activities of APX and CAT were greatly enhanced in GmSOG1 overexpressing transgenic Arabidopsis plants (<xref ref-type="fig" rid="fig7">Figure 7</xref>(A), <xref ref-type="fig" rid="fig7">Figure 7</xref>(B)).</p><p>Plants produce reactive oxygen species as a result of normal metabolic activities and in response to environmental stresses. The accumulation of these compounds in plant cells causes lipid peroxidation which adversely impacts the chlorophyll content of plants [<xref ref-type="bibr" rid="scirp.106626-ref40">40</xref>]. In this study, GmSOG1 knockdown transgenic lines accumulated significantly higher amounts of MDA than wild-type plants under both normal and drought stressed conditions (<xref ref-type="fig" rid="fig5">Figure 5</xref>(A)). The accumulation of ROS due to normal cellular activities has been identified as a major cause of DNA damage in plants [<xref ref-type="bibr" rid="scirp.106626-ref14">14</xref>]. The downregulation of GmSOG1, a major plant DNA damage responsive gene, in transgenic lines possibly interfered with the mechanisms of ROS scavenging hence the higher accumulation of MDA in transgenic plants. A significantly higher amount of chlorophyll was also observed in wild-type soybean plants relative to transgenic lines (<xref ref-type="fig" rid="fig5">Figure 5</xref>(B)). The chloroplast of plants has been identified as a major site for the production of reactive oxygen species (ROS) [<xref ref-type="bibr" rid="scirp.106626-ref41">41</xref>]. The buildup of ROS in the photosynthetic machinery of plants as a result of stresses, may lead to chlorophyll degradation [<xref ref-type="bibr" rid="scirp.106626-ref40">40</xref>] [<xref ref-type="bibr" rid="scirp.106626-ref42">42</xref>] [<xref ref-type="bibr" rid="scirp.106626-ref43">43</xref>]. Transgenic soybean lines therefore had lower amounts of chlorophyll under drought stress as they may have lacked a protective mechanism against ROS induced chlorophyll degradation.</p></sec><sec id="s5"><title>5. Conclusion</title><p>We have shown that there may exist an interplay between the DNA damage response (DDR) pathway and abiotic stress response in plants. The GmSOG1 gene, a chief regulatory gene of the DDR pathway was found to play roles in drought tolerance. The suppression of GmSOG1 expression in soybean plants led to a compromised ROS scavenging system under drought conditions. The SOG1 gene is a potentially useful candidate gene for plant stress engineering hence the need to identify and functionally characterize homologous genes in other plant species.</p></sec><sec id="s6"><title>Acknowledgements</title><p>The authors express their sincere gratitude to Dr. Hiroyuki Tsuji of Kihara Institute of Biological Research, Yokohama City University, Japan for providing us with the pANDA35HK RNAi binary vector. The authors would also like to thank the Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT) for the award of scholarship to S. A. Poku.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflict of interest regarding publication of this manuscript.</p></sec><sec id="s8"><title>Cite this paper</title><p>Poku, S.A., Chukwurah, P.N., Aung, H.H. and Nakamura, I. (2021) Knockdown of GmSOG1 Compromises Drought Tolerance in Transgenic Soybean Lines. American Journal of Plant Sciences, 12, 18-36. https://doi.org/10.4236/ajps.2021.121003</p></sec></body><back><ref-list><title>References</title><ref id="scirp.106626-ref1"><label>1</label><mixed-citation publication-type="book" xlink:type="simple">Goldsmith, P.D. (2008) Economics of Soybean Production, Marketing, and Utilization. In: Johnson, L.P., White, P.A. and Galloway, R., Eds., Soybeans: Chemistry, Production, Processing and Utilization, AOCS Press, Urbana, 117-150.  
https://doi.org/10.1016/B978-1-893997-64-6.50008-1</mixed-citation></ref><ref id="scirp.106626-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Sakai, T. and Kogiso, M. (2008) Soy Isoflavones and Immunity. Journal of Medical Investigation, 55, 167-173. https://doi.org/10.2152/jmi.55.167</mixed-citation></ref><ref id="scirp.106626-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Friedman, M. and Brandon, D.L. (2001) Nutritional and Health Benefits of Soy Proteins. Journal of Agriculture and Food Chemistry, 49, 1069-1086.  
https://doi.org/10.1021/jf0009246</mixed-citation></ref><ref id="scirp.106626-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Le, D.T., Nishiyama, R., Watanabe, Y., Tanaka, M., Seki, M., Ham, L., Yamaguchi-Shinozaki, K. Shinozaki, K. and Lam, T. (2012) Differential Gene Expression in Soybean Leaf Tissues at Late Developmental Stages under Drought Stress Revealed by Genome-Wide Transcriptome Analysis. PLoS ONE, 7, e49522.  
https://doi.org/10.1371/journal.pone.0049522</mixed-citation></ref><ref id="scirp.106626-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Hirt, H. and Shinozaki, K. (2004) Plant Responses to Abiotic Stress. Springer, Berlin. https://doi.org/10.1007/b84369</mixed-citation></ref><ref id="scirp.106626-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Sinclair, T. and Serraj, R. (1995) Legume Nitrogen-Fixation and Drought. Nature, 378, 344. https://doi.org/10.1038/378344a0</mixed-citation></ref><ref id="scirp.106626-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Purcell, L.C. and King, C.A. (1996) Drought and Nitrogen Source Effects on Nitrogen Nutrition, Seed Growth, and Yield in Soybean. Journal of Plant Nutrition, 19, 969-993. https://doi.org/10.1080/01904169609365173</mixed-citation></ref><ref id="scirp.106626-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Chen, M., Wang, Q.Y., Cheng, X.G., Xu, Z.S., Li, L.C., Ye, X.G., Xia, L.Q. and Ma, Y.Z. (2007) GmDREB2, a Soybean DRE-Binding Transcription Factor, Conferred Drought and High-Salt Tolerance in Transgenic Plants. Biochemical and Biophysical Research Communications, 353, 299-305.  
https://doi.org/10.1016/j.bbrc.2006.12.027</mixed-citation></ref><ref id="scirp.106626-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, G., Chen, M., Li, L., Xu, Z., Chen, X., Guo, J. and Ma, Y. (2009) Overexpression of the Soybean GmERF3 Gene, an AP2/ERF Type Transcription Factor for Increased Tolerances to Salt, Drought, and Diseases in Transgenic Tobacco. Journal of Experimental Botany, 60, 3781-3796. https://doi.org/10.1093/jxb/erp214</mixed-citation></ref><ref id="scirp.106626-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Gao, S.Q., Chen, M., Xu, Z.S., Zhao, C.P., Li, L., Xu, H.J., Tang, Y.M., Zhao, X. and Ma, Y.Z. (2011) The Soybean GmbZIP1 Transcription Factor Enhances Multiple Abiotic Stress Tolerances in Transgenic Plants. Plant Molecular Biology, 75, 537-553.  
https://doi.org/10.1007/s11103-011-9738-4</mixed-citation></ref><ref id="scirp.106626-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Baxter, A., Mittler, R. and Suzuki, N. (2013) ROS as Key Players in Plant Stress Signaling. Journal of Experimental Botany, 65, 1129-1240.  
https://doi.org/10.1093/jxb/ert375</mixed-citation></ref><ref id="scirp.106626-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Foyer, C.H. and Shigeoka, S. (2011) Understanding Oxidative Stress and Antioxidant Functions to Enhance Photosynthesis. Plant Physiology, 155, 93-100.  
https://doi.org/10.1104/pp.110.166181</mixed-citation></ref><ref id="scirp.106626-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Sancar, A., Lindsey-Boltz, L.A., Unsal-Kacmaz, K. and Linn, S. (2004) Molecular Mechanisms of Mammalian DNA Repair and the DNA Damage Checkpoints. Annual Review of Biochemistry, 73, 39-85.  
https://doi.org/10.1146/annurev.biochem.73.011303.073723</mixed-citation></ref><ref id="scirp.106626-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Nisa, M.U., Huang, Y., Benhamed, M. and Raynaud, C. (2019) The Plant DNA Damage Response: Signaling Pathways Leading to Growth Inhibition and Putative Role in Response to Stress Conditions. Frontiers in Plant Science, 10, 653.  
https://doi.org/10.3389/fpls.2019.00653</mixed-citation></ref><ref id="scirp.106626-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Yoshiyama, K.O., Conklin, P.A., Huefner, N.D. and Britt, A.B. (2009) Suppressor of Gamma Response 1 (SOG1) Encodes a Putative Transcription Factor Governing Multiple Responses to DNA Damage. Proceedings of the National Academy of Sciences, USA, 106, 12843-12848. https://doi.org/10.1073/pnas.0810304106</mixed-citation></ref><ref id="scirp.106626-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Yoshiyama, K.O. and Kimura, S. (2018) Ser-Gln Sites of SOG1 Are Rapidly Hyperphosphorylated in Response to DNA Double-Strand Breaks. Plant Signaling &amp; Behavior, 13, e1477904. https://doi.org/10.1080/15592324.2018.1477904</mixed-citation></ref><ref id="scirp.106626-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Adachi, S., Minamisawa, K., Okushima, Y., Inagaki, S., Yoshiyama, K., Kondou, Y., Kaminuma, E., Kawashima, M., Toyoda, T., Matsui, M., Kurihara, D., Matsunaga, S. and Umeda, M. (2011) Programmed Induction of Endoreduplication by DNA Double-Strand Breaks in Arabidopsis. Proceedings of the National Academy of Sciences, USA, 108, 10004-10009. https://doi.org/10.1073/pnas.1103584108</mixed-citation></ref><ref id="scirp.106626-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Furukawa, T., Curtis, M.J., Tominey, C.M., Duong, Y.H., Wilcox, B.W., Aggoune, D., Hays, J.B. and Britt, A.B. (2010) A Shared DNA-Damage-Response Pathway for Induction of Stem-Cell Death by UVB and by Gamma Irradiation. DNA Repair, 9, 940-948. https://doi.org/10.1016/j.dnarep.2010.06.006</mixed-citation></ref><ref id="scirp.106626-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J. and Higgins, D.G. (2007) Clustal W and Clustal X Version 2.0. Bioinformatics, 23, 2947-2948. https://doi.org/10.1093/bioinformatics/btm404</mixed-citation></ref><ref id="scirp.106626-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Molecular Biology and Evolution, 24, 1596-1599. https://doi.org/10.1093/molbev/msm092</mixed-citation></ref><ref id="scirp.106626-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Hinchee, M.A.W., Connor-Ward, D.V., Newell, C.A., McDonnell, R.E., Sato, S.J., Gasser, C.S., Fischhoff, D.A., Re, D.B., Fraley, R.T. and Horsch, R.B. (1988) Production of Transgenic Soybean Plants Using Agrobacterium-Mediated DNA Transfer. Bio-Technology, 6, 915-922. https://doi.org/10.1038/nbt0888-915</mixed-citation></ref><ref id="scirp.106626-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Nakagawa, T., Kurose, T., Hino, T., Tanaka, K., Kawamukai, M., Niwa, Y., Toyooka, K., Matsuoka, K., Jinbo, T. and Kimura, T. (2007) Development of Series of Gateway Binary Vectors, pGWBs, for Plant Transformation. Journal of Bioscience and Bioengineering, 104, 34-41. https://doi.org/10.1263/jbb.104.34</mixed-citation></ref><ref id="scirp.106626-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Narusaka, M., Shiraishi, T., Iwabuchi, M. and Narusaka, Y. (2010) The Floral Inoculating Protocol: A Simplified Arabidopsis thaliana Transformation Method Modified from Floral Dipping. Plant Biotechnology, 27, 349-351.  
https://doi.org/10.5511/plantbiotechnology.27.349</mixed-citation></ref><ref id="scirp.106626-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Huang, X.S., Luo, T., Fu, X.Z., Fan, Q.J. and Liu, J.H. (2011) Cloning and Molecular Characterization of a Mitogen-Activated Protein Kinase Gene from Poncirus trifoliata Whose Ectopic Expression Confers Dehydration/Drought Tolerance in Transgenic Tobacco. Journal of Experimental Botany, 62, 5191-5206.  
https://doi.org/10.1093/jxb/err229</mixed-citation></ref><ref id="scirp.106626-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Wang, B.Q., Zhang, Q.F., Liu, J.H. and Li, G.H. (2011) Overexpression of PtADC Confers Enhanced Dehydration and Drought Tolerance in Transgenic Tobacco and Tomato: Effect on ROS Elimination. Biochemical and Biophysical Research Communications, 413, 10-16. https://doi.org/10.1016/j.bbrc.2011.08.015</mixed-citation></ref><ref id="scirp.106626-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Heath, R.L. and Packer, L. (1968) Photoperoxidation in Isolated Chloroplasts I. Kinetic and Stoichiometry of Fatty Acid Peroxidation. Archives of Biochemistry and Biophysics, 125, 189-198. https://doi.org/10.1016/0003-9861(68)90654-1</mixed-citation></ref><ref id="scirp.106626-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, Z. and Huang, R. (2013) Analysis of Malondialdehyde, Chlorophyll Proline, Soluble Sugar, and Glutathione Content in Arabidopsis Seedling. Bio-Protocol, 3, e817. https://doi.org/10.21769/BioProtoc.817</mixed-citation></ref><ref id="scirp.106626-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Nagano, Y. and Asada, K. (1981) Hydrogen Peroxide Is Scavenged by Ascorbate-Specific Peroxidase in Spinach Chloroplasts. Plant Cell Physiology, 22, 867-880.</mixed-citation></ref><ref id="scirp.106626-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Cakmak, I. and Marschner, H. (1992) Magnesium Deficiency and High Light Intensity on Enhance Activities of Superoxide Dismutase, Peroxidase and Glutathione Reductase in Bean Leaves. Plant Physiology, 98, 1222-1227.  
https://doi.org/10.1104/pp.98.4.1222</mixed-citation></ref><ref id="scirp.106626-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Hu, H., Dai, M., Yao, J., Xiao, B., Li, X., Zhang, Q. and Xiong, L. (2006) Overexpressing a NAM, ATAF, and CUC (NAC) Transcription Factor Enhances Drought Resistance and Salt Tolerance in Rice. Proceedings of the National Academy of Sciences, USA, 103, 12987-12992. https://doi.org/10.1073/pnas.0604882103</mixed-citation></ref><ref id="scirp.106626-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Liu, F., Anderson, M.N., Jacobson, S.E. and Jensen, C.R. (2005a) Stomatal Control and Water Use Efficiency of Soybean (Glycine max L. Merr.) during Progressive Soil Drying. Environmental and Experimental Botany, 54, 33-40.  
https://doi.org/10.1016/j.envexpbot.2004.05.002</mixed-citation></ref><ref id="scirp.106626-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Benjamin, J.G. and Nielsen, D.C. (2006) Water Deficit Effects on Root Distribution of Soybean, Field Pea and Chickpea. Field Crops Research, 97, 248-253.  
https://doi.org/10.1016/j.fcr.2005.10.005</mixed-citation></ref><ref id="scirp.106626-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Liu, Y., Gai, J.Y., Lu, H.N., Wang, Y.J. and Chen, S.Y. (2005) Identification of Drought Tolerant Germplasm and Inheritance and QTL Mapping of Related Root Traits in Soybean (Glycine max (L.) Merr.). Acta Genetica Sinica, 32, 855-863.</mixed-citation></ref><ref id="scirp.106626-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Read, D.J. and Bartlett, E.M. (1972) The Physiology of Drought Resistance in Soybean Plant (Glycine max): The Relationship between Drought Resistance and Growth. Journal of Applied Ecology, 9, 487-489. https://doi.org/10.2307/2402447</mixed-citation></ref><ref id="scirp.106626-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Lopes, M.S., Araus, J.L., Van Heerden, P.D.R. and Foyer, C.H. (2011) Enhancing Drought Tolerance in C4 Crops. Journal of Experimental Botany, 62, 3135-3153.  
https://doi.org/10.1093/jxb/err105</mixed-citation></ref><ref id="scirp.106626-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">De Ronde, J.A., Spreeth, M.H. and Cress, W.A. (2000) Effect of Antisense L-Δ1-Pyrroline-5-Carboxylate Reductase Transgenic Soybean Plants Subjected to Osmotic and Drought Stress. Plant Growth Regulation, 32, 13-26.  
https://doi.org/10.1023/A:1006338911617</mixed-citation></ref><ref id="scirp.106626-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Ogita, N., Okushima, Y., Tokizawa, M., Yamamoto, Y.Y., Tanaka,  M., Seki, M., Makita, Y., Matsui, M., Okamoto-Yoshiyama, K., Sakamoto, T., Kurata, T., Hiruma, K., Saijo, Y., Takahashi, N. and Umeda, M. (2018) Identifying the Target Genes of Suppressor of Gamma Response 1, a Master Transcription Factor Controlling DNA Damage Response in Arabidopsis. The Plant Journal, 94, 439-453.  
https://doi.org/10.1111/tpj.13866</mixed-citation></ref><ref id="scirp.106626-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Cushman, J.C. and Bohnert, H.J. (2000) Genomic Approaches to Plant Stress Tolerance. Current Opinion Plant Biology, 31, 117-124.  
https://doi.org/10.1016/S1369-5266(99)00052-7</mixed-citation></ref><ref id="scirp.106626-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Foyer, C.H. and Noctor, G. (2003) Redox Sensing and Signalling Associated with Reactive Oxygen in Chloroplasts, Peroxisomes and Mitochondria. Physiological Plantarum, 119, 355-364. https://doi.org/10.1034/j.1399-3054.2003.00223.x</mixed-citation></ref><ref id="scirp.106626-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Phang, T., Shao, G. and Lam, H. (2008) Salt Tolerance in Soybean. Journal of Integrative Plant Biology, 50, 1196-1212.  
https://doi.org/10.1111/j.1744-7909.2008.00760.x</mixed-citation></ref><ref id="scirp.106626-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Yoshiyama, K.O., Kimura, S., Maki, H., Britt, A.B. and Umeda, M. (2014) The Role of SOG1, a Plant-Specific Transcriptional Regulator, in the DNA Damage Response. Plant Signaling &amp; Behavior, 9, e28889. https://doi.org/10.4161/psb.28889</mixed-citation></ref><ref id="scirp.106626-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Sajedi, N.A., Ardakani, M.R., Rejali, F., Mohabbati, F. and Miransari, M. (2010) Yield and Yield Components of Hybrid Corn (Zea mays L.) as Affected by Mycorrhizal Symbiosis and Zinc Sulfate under Drought Stress. Physiology and Molecular Biology of Plants, 16, 343-351. https://doi.org/10.1007/s12298-010-0035-5</mixed-citation></ref><ref id="scirp.106626-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Sajedi, N.A., Ardakani, M.R., Madani, H., Naderi, A. and Miransari, M. (2011) The Effects of Selenium and Other Micronutrients on the Antioxidant Activities and Yield of Corn (Zea mays L.) under Drought Stress. Physiology and Molecular Biology of Plants, 17, 215-222. https://doi.org/10.1007/s12298-011-0067-5</mixed-citation></ref></ref-list></back></article>