<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">JBM</journal-id><journal-title-group><journal-title>Journal of Biosciences and Medicines</journal-title></journal-title-group><issn pub-type="epub">2327-5081</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/jbm.2020.811018</article-id><article-id pub-id-type="publisher-id">JBM-104361</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Development of Genetic Engineering Tools for p75ngfr Methylation and Expression Modulation
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>D.</surname><given-names>A. Lanshakov</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>E.</surname><given-names>V. Sukhareva</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Postgenomic Neurobiology Laboratory, Institute of Cytology and Genetics SB RAS, Novosibirsk, Russia</addr-line></aff><aff id="aff2"><addr-line>Functional Neurogenomics Laboratory, Institute of Cytology and Genetics SB RAS, Novosibirsk, Russia</addr-line></aff><pub-date pub-type="epub"><day>05</day><month>11</month><year>2020</year></pub-date><volume>08</volume><issue>11</issue><fpage>197</fpage><lpage>207</lpage><history><date date-type="received"><day>28,</day>	<month>October</month>	<year>2020</year></date><date date-type="rev-recd"><day>23,</day>	<month>November</month>	<year>2020</year>	</date><date date-type="accepted"><day>26,</day>	<month>November</month>	<year>2020</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  
    Neurotrophic factors, as well as their receptors are key players in the formation and development of the central nervous system. Like the sculptor’s incisor, they form the neural networks and circuits of the future organism. The neurotrophic growth factor receptor p75ngfr interacts with sortilin, serves as a receptor for proform of neurotrophic factors and exhibits a proapoptotic effect in developing neurons—dorsal root ganglia neurons and brainstem norepinephrine neurons. p75ngfr is highly expressed in Locus Coeruleus norepinephrine neurons. Therefore, an important task for developing further methods of CNS gene therapy is the development of tools and molecular methods for suppressing p75ngfr expression in norepinephrine neurons. For this purpose, we’ve developed improved dCas9 vectors with Suntag system to suppress gene expression and enhance methylation of CpG islands. We used 10 times repetitive GCN peptide that were fused to dCas9. Single chain antibody against GCN peptide was fused to KRAB repressor or Dnmt3a catalytic domain. Expression specificity was achieved by using a promoter consisting of 8 repeated phox2a/2b binding sites. In this work, we’ve tested a set of guide RNAs targeting p75ngfr cpg island in the promoter. Usage of Suntag system led us to the conclusion that topological orientation and length of the final complex could influence on p75ngfr antisense transcript expression, and that sequence was established in the rat P3 brainstem. 
  
 
</p></abstract><kwd-group><kwd>dCas9</kwd><kwd> Suntag System</kwd><kwd> CRISPRi</kwd><kwd> Dnmt3a</kwd><kwd> p75ngfr</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Neurotrophic factors and their receptors plays pivotal role in nervous system development and maturation [<xref ref-type="bibr" rid="scirp.104361-ref1">1</xref>]. Ngf signaling is crucial for DRG [<xref ref-type="bibr" rid="scirp.104361-ref2">2</xref>]and nociceptive neuron survival [<xref ref-type="bibr" rid="scirp.104361-ref3">3</xref>]. Ngf receptors are TrkA and p75ngfr. Trk receptors has tyrosine kinase domain [<xref ref-type="bibr" rid="scirp.104361-ref4">4</xref>]. Their signaling has survival action, regulates synaptic strength and plasticity [<xref ref-type="bibr" rid="scirp.104361-ref4">4</xref>]. p75ngfr is receptor for proforms of neurotrophins [<xref ref-type="bibr" rid="scirp.104361-ref1">1</xref>]. It’s signaling has opposite action. It regulates growth cone collapse and support apoptosis [<xref ref-type="bibr" rid="scirp.104361-ref5">5</xref>]. Also it participates in cell migration [<xref ref-type="bibr" rid="scirp.104361-ref6">6</xref>], neurite outgrowth [<xref ref-type="bibr" rid="scirp.104361-ref7">7</xref>] and cell cycle arrest [<xref ref-type="bibr" rid="scirp.104361-ref8">8</xref>]. In the developing brain p75ngfr expressed in the septal acetylcholine neurons [<xref ref-type="bibr" rid="scirp.104361-ref9">9</xref>], Locus Coereleus norepinephrine neurons [<xref ref-type="bibr" rid="scirp.104361-ref10">10</xref>], hypothalamic GnRH neurons [<xref ref-type="bibr" rid="scirp.104361-ref11">11</xref>]. Disturbances in p75ngfr signaling implicates to various neurological disorders such as Alzheimer’s disease (AD) [<xref ref-type="bibr" rid="scirp.104361-ref12">12</xref>], schizophrenia [<xref ref-type="bibr" rid="scirp.104361-ref13">13</xref>], major depressive disorder (MDD) [<xref ref-type="bibr" rid="scirp.104361-ref14">14</xref>], posttraumatic stress disorder (PTSD) [<xref ref-type="bibr" rid="scirp.104361-ref15">15</xref>], amyotrophic lateral sclerosis (ALS) [<xref ref-type="bibr" rid="scirp.104361-ref16">16</xref>], and Parkinson’s disease (PD) [<xref ref-type="bibr" rid="scirp.104361-ref17">17</xref>]. This makes p75ngfr promising therapeutic target. Crispr/cas9 is modern toolbox for genomic engineering and genes expression modulation. Today it allows various applications from gene editing [<xref ref-type="bibr" rid="scirp.104361-ref18">18</xref>] with Cas9 to gene expressions activation with Cas9 fused to VP64 activator [<xref ref-type="bibr" rid="scirp.104361-ref19">19</xref>]. Gene expression downregulation could be achieved by Cas9 fused to transcriptional repression KRAB (CRISPRi - inhibitory CRISPR) [<xref ref-type="bibr" rid="scirp.104361-ref20">20</xref>]. Epigenome intervention could be done with Cas9 fused to Dnmt3a or Tet catalytic domain [<xref ref-type="bibr" rid="scirp.104361-ref21">21</xref>]. Crispr/cas9 system could be enhanced with Sun tag system - multiple GCN peptide fused to Cas9 and single chain antibody recognizing GCN peptide [<xref ref-type="bibr" rid="scirp.104361-ref22">22</xref>], fused to activator or repressor. Effectiveness of gene transcription downregulation with CRISPRi depends on proper guide RNA selection. In this work we generate tools for gene downregulation with CRISPRi in norepinephrine neurons enhanced with SunTag systems. Set of gRNAs for p75ngfr expression downregulation with engineered system was screened in PC12 cells.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Constructs</title><p>Construct expressed single chain antibody against GCN peptide (scfv) fused to KRAB repressor or Dnmt3a catalytical domain were created using Gibson Assembley method. Overlapping primers were designed using Nebuilder hifi dna assembly online tool (<xref ref-type="table" rid="table1">Table 1</xref> primers # 1-10). Briefly, fragments were amplified, purified and subsequently used in 20 &#181;l assembly reaction with 2&#215; NEB Builder Master Mix (1 hour at 50˚C). After incubation 1 &#181;l of the reaction were transformed to Stbl3 E. coli strain with transformation efficiency 1 &#215; 109. Specificity of the expression in the norepinephrine neurons was achieved using promoter comprising of eight repeated phox2a/2b binding sites from the plasmid pLenti-PRSX8ChR2 (H134R)eYFP (was a gift from Ruth Stornetta (Addgene plasmid # 89539; http://n2t.net/addgene:89539; RRID:Addgene_89539). Scfv was amplified from the plasmid pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS (was a gift from Ron Vale (Addgene plasmid # 60904; http://n2t.net/addgene:60904; RRID:Addgene_60904). KRAB repressor was amplified from the plasmid pLVUT-tTR-KRAB (was a gift from Patrick Aebischer &amp; Didier Trono (Addgene plasmid # 11651; http://n2t.net/addgene:11651; RRID:Addgene_11651), Dnmt3a catalytical domain domain was amplified from Fuw-dCas9-Dnmt3a (Fuw-dCas9-Dnmt3a was a gift from Rudolf Jaenisch (Addgene plasmid # 84476; http://n2t.net/addgene:84476; RRID:Addgene_84476). Guide RNAs across the cpg island within the promoter region differently located to the p75ngfr transcription start site and strand were designed using CRISPOR http://crispor.tefor.net/. gRNA were annealed and cloned with BbsI sites to the pAAV-U6-BbsI-gRNA- CB-EmGFP vector (was a gift from William Lagor (Addgene plasmid # 89060; http://n2t.net/addgene:89060; RRID:Addgene_89060) <xref ref-type="table" rid="table1">Table 1</xref>, primers #11-20. For the generation HEK293T cell line with doxycycline inducible red reporter pCW57-RFP-P2A-MCS (Neo) plasmid were used (was a gift from Adam Karpf (Addgene plasmid # 89182; http://n2t.net/addgene:89182; RRID:Addgene_89182). For the effectiveness transcription downregulation of the obtained construct gRNA targeting Doxycycline inducible promoter U6-spTRE3G-CMV-mTagBFP2 was used (U6-spTRE3G-CMV-mTagBFP2 was a gift from Michael Lin (Addgene plasmid # 102854; http://n2t.net/addgene:102854; RRID:Addgene_102854).</p></sec><sec id="s2_2"><title>2.2. Cell Lines and Transfection</title><p>HEK293T cells were maintained according to the standard protocols on DMEM medium supplied with 10% FBS and penicillin streptomycin. PC12 cell line was maintained on the same medium. For transfection PC12 cells were seeded on a 24-well plate the day before. On the day of transfection cells were washed with 1 &#215; PBS. 1 &#181;g of total DNA per well, together with PEI (1 &#181;g/&#181;l) in molar ratio to DNA 3:1 in 300 &#181;l Opti-MEM were put on the cell for 6 hours. After that incubation time 300 &#181;l of previous cell medium was added. Next day the medium was changed to the fresh one. FACS soring and further analysis was done the day after.</p></sec><sec id="s2_3"><title>2.3. FACS and Microscopy</title><p>For the FACS sorting cells were washed with 1xPBS and detached with 1 &#215; Triple in 1 &#215; PBS. Single cell suspension was analyzed on BD FACS Aria 3 in the FITC channel and 488 nm laser. For the subcloning of doxycycline inducible reporter single cells were sorted in 96 well plate using the PE-Texas red channel and 561 nm laser and 405 nm laser and 488/45 BP filter. For the evaluation of construct effectiveness cells were imaged on Zeiss epifluorescence inverted microscope using ZEN software. Five images per well were acquired.</p></sec><sec id="s2_4"><title>2.4. qRT-PCR</title><p>For the evaluation of p75ngfr downregulation in PC12 cells the day after transfection with plasmid carrying gRNA, 10xGCNdCas9 (pHRdSV40-dCas9-10xGCN4_ v4-P2A-BFP) and constructs obtained after Gibson Assembly, 100 cells were</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Oligos sequences</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >oligo number</th><th align="center" valign="middle" >Name</th><th align="center" valign="middle" >sequence</th></tr></thead><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >prsF</td><td align="center" valign="middle" >tacagggacagcagagatccagttggatcgggtttattacagggacagcag</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >prsR</td><td align="center" valign="middle" >cggggcccatggtggccatggtggcaccggttctag</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >scfvgfpF</td><td align="center" valign="middle" >accggtgccaccatggccaccatgggccccgac</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >scfvgfpR</td><td align="center" valign="middle" >ctggagccgggagggccctccgccaccgccacc</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >krabF</td><td align="center" valign="middle" >ggcggtggcggagggcggacactggtgaccttc</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" >krabR</td><td align="center" valign="middle" >ctcttcggtccgagatcctcctccactaccaactgatgatttgatttcaaatgcagtc</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" >dnmtF</td><td align="center" valign="middle" >ggcggtggcggagggccctcccggctccagatg</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" >dnmtR</td><td align="center" valign="middle" >ctcttcggtccgagatcctcctccactacccacacacgcaaaatactccttcagc</td></tr><tr><td align="center" valign="middle" >9</td><td align="center" valign="middle" >pHRdScfvFwd</td><td align="center" valign="middle" >ggtagtggaggaggatctc</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" >pHRdScfvRev</td><td align="center" valign="middle" >gatccaaactggatctctgc</td></tr><tr><td align="center" valign="middle" >11</td><td align="center" valign="middle" >gRNA1F</td><td align="center" valign="middle" >caccggcccacagagaagccgcagcggg</td></tr><tr><td align="center" valign="middle" >12</td><td align="center" valign="middle" >gRNA1R</td><td align="center" valign="middle" >aaaccccgctgcggcttctctgtgggcc</td></tr><tr><td align="center" valign="middle" >13</td><td align="center" valign="middle" >gRNA2F</td><td align="center" valign="middle" >caccgtgctccggactccacaccccagg</td></tr><tr><td align="center" valign="middle" >14</td><td align="center" valign="middle" >gRNA2R</td><td align="center" valign="middle" >aaaccctggggtgtggagtccggagcac</td></tr><tr><td align="center" valign="middle" >15</td><td align="center" valign="middle" >gRNA3F</td><td align="center" valign="middle" >caccgcgcacccgtgtgccccgctgcgg</td></tr><tr><td align="center" valign="middle" >16</td><td align="center" valign="middle" >gRNA3R</td><td align="center" valign="middle" >aaacccgcagcggggcacacgggtgcgc</td></tr><tr><td align="center" valign="middle" >17</td><td align="center" valign="middle" >gRNA4F</td><td align="center" valign="middle" >caccgaccgcgcccgcccggctgcctgg</td></tr><tr><td align="center" valign="middle" >18</td><td align="center" valign="middle" >gRNA4R</td><td align="center" valign="middle" >aaacccaggcagccgggcgggcgcggtc</td></tr><tr><td align="center" valign="middle" >19</td><td align="center" valign="middle" >gRNA5F</td><td align="center" valign="middle" >caccgctgccggaaccgcgcccgcccgg</td></tr><tr><td align="center" valign="middle" >20</td><td align="center" valign="middle" >gRNA5R</td><td align="center" valign="middle" >aaacccgggcgggcgcggttccggcagc</td></tr><tr><td align="center" valign="middle" >21</td><td align="center" valign="middle" >p75F</td><td align="center" valign="middle" >tgctttcaagaggtggaaca</td></tr><tr><td align="center" valign="middle" >22</td><td align="center" valign="middle" >p75R</td><td align="center" valign="middle" >actgtcgctgtgcagttt</td></tr><tr><td align="center" valign="middle" >23</td><td align="center" valign="middle" >p75prb</td><td align="center" valign="middle" >/6-fam/-aaataaacaaggcgccaacagccg-/bhq-1/</td></tr><tr><td align="center" valign="middle" >24</td><td align="center" valign="middle" >hprt1F</td><td align="center" valign="middle" >agttctttgctgacctgctggattacatta</td></tr><tr><td align="center" valign="middle" >25</td><td align="center" valign="middle" >hprt1R</td><td align="center" valign="middle" >ccgttgactggtcattacagtagctct</td></tr><tr><td align="center" valign="middle" >26</td><td align="center" valign="middle" >hprt1prb</td><td align="center" valign="middle" >/hex/- agcgctgaatagaaatagtgataggtccattcctatgac -/bhq-1/</td></tr><tr><td align="center" valign="middle" >27</td><td align="center" valign="middle" >5’OUT</td><td align="center" valign="middle" >aggtgctgcctgcagcgccatgg</td></tr><tr><td align="center" valign="middle" >28</td><td align="center" valign="middle" >5’IN</td><td align="center" valign="middle" >gcctgctgctgctgctgattctaggg</td></tr><tr><td align="center" valign="middle" >29</td><td align="center" valign="middle" >3’OUT</td><td align="center" valign="middle" >ccctagaatcagcagcagcagcaggc</td></tr><tr><td align="center" valign="middle" >30</td><td align="center" valign="middle" >3’IN</td><td align="center" valign="middle" >ccatggcgctgcaggcagcacct</td></tr></tbody></table></table-wrap><p>FACS sorted in the 100 &#181;l of RLT buffer. Total cellular RNA was isolated using Qiagen RNeasy Mini Kit according to the manufacturer instructions. For the removal of gDNA traces RNA was on column treated with RNAse free DNAse I. Reverse transcription was performed with the MMLV Reverse Transcriptase (Sibenzyme) 100 ng total RNA and oligodT primer (Evrogen). All real-time PCR reactions were performed using the ABI ViiA7 system (Thermo) and standard cycle. Amplifications were done using the real time PCR Master Mix qPCRmix +LowROX (Evrogen) and primers and probes from <xref ref-type="table" rid="table1">Table 1</xref> oligos #21-26.</p></sec><sec id="s2_5"><title>2.5. RACE</title><p>Total cellular RNA from P3 rat brainstem was isolated using TRIZOL reagent. First strand were synthesized using Mint-2 cDNA kit (Evrogen). Race was done using Mint RACE cDNA amplification primer set (Evrogen) and primers. For the p75ngfr-as 5’ Race first strand were used. For the 3’ Race cDNA library amplified with M1 primer (Evrogen) was used. First round of pcr was done with “OUT” primers; second round pcr was done with “IN” primers. After gel electrophoresis band were cut, cloned to pALT/A (Evrogen) vector and sequenced with M13 primers.</p></sec><sec id="s2_6"><title>2.6. Statistics</title><p>Statistical analyses were performed using STATISTICA software. For the analysis of construct effectiveness, qRT-PCR ONE WAY ANOVA was used. All significant values were further analyzed using Fisher LSD post hoc analysis.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Usage of KRAB - Suntag System Improves Decrease in Transcription of Doxycycline Inducible Promoter</title><p>To test the effectiveness of the construct we’ve created with lentiviral transduction on the basis of HEK293T reporter cell line. Red fluorescence reporter protein expressed under doxycycline inducible promoter TRE together with reverse tetracycline transactivator rtTA (pCW57-RFP-P2A-MCS). With lentivirus carrying Red reporter cells were transduced with lentivirus carrying guide RNA to the TRE (U6-spTRE3G-CMV-mTagBFP2). After subcloning obtained reporter cell line were transfected with various constructs:dCas9 (pB-CAGGS-dCas9 was a gift from Alejandro Chavez &amp; George Church (Addgene plasmid # 110823; http://n2t.net/addgene:110823; RRID:Addgene_110823); dCas9-KRAB (pB- -dCas9-KRAB was a gift from Alejandro Chavez &amp; George Church (Addgene plasmid # 110822; http://n2t.net/addgene:110822; RRID:Addgene_ 110822); dCas9-10xGCN+scfv-Krab; dCas9-Dnmt3a;dCas9-10xGCN+scfv-Dnmt3a. Usage of Suntag system with KRAB repressor lead to significant improvement in transcription decrease We’ve observed significant drop in red fluorescence signal in the case of dCas9-10xGCN+scfv-Krab (4, 38) = 4.5039, p = 0.00447 compare to the control group dCas9 Figures 1(A)-(C). Transfection of dCas9-KRAB leads to moderate decrease in red fluorescence. Interestingly that neither dCas9-Dnmt3a nor dCas9-10xGCN+scfv-Dnmt3a transfection did not cause a decrease in red fluorescence signal.</p></sec><sec id="s3_2"><title>3.2. Effectiveness of gRNA in CRISPRi Depends on Location to the Transcription Start Site and General Complex Topology</title><p>After our preliminary experiment was done with checking constructs on the reporter cell line, a set of gRNAs to target p75ngfr were designed. gRNA1-gRNA4 were situated in the region of p75ngfr’s CpG island:-80 to -23 bp Figures 2(A)-(C),</p><p>gRNA5 overlapped the transcription start site (TSS). Then that set of gRNA’s was tested in the cell line with norepinephrine phenotype rat pheochromacytoma PC12 cell line. Interestingly, that decrease in p75ngfr mRNA level was observed mostly after gRNA5 <xref ref-type="fig" rid="fig2">Figure 2</xref>(D) in the case dCas9-KRAB (F (5, 15) = 5.8753, p = 0.00335) compare to the control group dCas9) and also in the case Suntag-KRAB system (F (5, 21) = 13.706 p &lt; 0.05 compare to the control group dCas9). After dCas9-10xGCN+scfv-Krab-gRNA5 transfection p75ngfr mRNA level decreased 8 folds and after dCas9-Krab9-gRNA5 mRNA decline was 2 folds <xref ref-type="fig" rid="fig2">Figure 2</xref>(D) Interestingly that we’ve observed 2-fold increase in mRNA after gRNA2 and dCas9-10xGCN+scfv-Krab p = 0.065. When constructs with Dnmt3a catalytic domain were transfected around 1.5 folds decrease in mRNA level was observed only in the case of dCas9-Dnmt3a and gRNA1 (F(5, 15) = 4.0241 p = 0.02 and gRNA5 p = 0.04 compare to control dCas9 group). In the case of Suntag-Dnmt3a system we didn’t observe a significant decrease in p75ngfr mRNA expression.</p></sec><sec id="s3_3"><title>3.3. p75ngfr has Antisense lncRNA that Could Regulate Its Expression</title><p>Increasing mRNA level after gRNA2 and Suntag-KRAB could be explained by topological orientation of the complex. Probably complex size is sufficient to bring a KRAB repressor on a longer distance compared to dCas9-KRAB. Because of it Cas9-10xGCN+scfv-Krab-gRNA2 could probably downregulate p75ngfr antisense transcript, that oppositely regulate p75ngfr expression <xref ref-type="fig" rid="fig3">Figure 3</xref>(A). To define a probable sequence of p75ngfr antisense transcript RACE was done. Two bands corresponding to 5’ of antisense transcript overlapped with several last exons of p75ngfr <xref ref-type="fig" rid="fig3">Figure 3</xref>(B). Also there was observed alternative splicing of antisense transcripts (band A and band B) <xref ref-type="fig" rid="fig3">Figure 3</xref>(C). Band A was</p><p>5’ end of longer transcript that comes from two last exons. Band B corresponds to a shorter transcript overlapped with 4 last exons of p75ngfr. Pcr with 3’ primers didn’t get results linked to p75ngfr.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>CRISPR/Cas9 technology is spreading worldwide for genomic engineering and gene expression modulation. Nowadays it could even be used to intervene cell epigenome: methylation and demethylation using Cas9 fused to Dnmt3a or Tet catalytic domain [<xref ref-type="bibr" rid="scirp.104361-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.104361-ref22">22</xref>]. Decrease in gene transcription could be achieved by Cas9 fused to KRAB repressor [<xref ref-type="bibr" rid="scirp.104361-ref20">20</xref>]. In this work, we tried to develop an improved inhibitory CRISPRi and Cas9 methylation system with Suntag approach for effective gene downregulation and methylation in norepinephrine neurons. Constructs expression specificity was achieved by using a promoter consisting of repeated phox2a/2b transcription factors binding site [<xref ref-type="bibr" rid="scirp.104361-ref23">23</xref>]. These transcription factors are expressed in the norepinephrine neurons of the brainstem, and also they play a crucial role in the specification of this type of neurons [<xref ref-type="bibr" rid="scirp.104361-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.104361-ref25">25</xref>]. For the verification of the obtained constructs, we’ve developed reporter cell line HEK293TET that expressed RFP under control of doxycycline inducible promoter TRE and constitutive expression of reverse tetracycline transactivator rtTA together with gRNA targeting TRE promoter. In our test system, we’ve seen improvement in expression downregulation using 10 times repeated GCN peptide fused to catalytically inactive Cas9 together with single chain antibody to GCN peptide fused to KRAB repressor. Interestingly that neither dCas9 directly fused Dnmt3a catalytic domain nor dCas9-10xGCN+scfv-Dnmt3a didn’t influence the Red fluorescence signal intensity. It could be explained by the fact that only methylation of the CpG islands affects transcription. Probably, using several gRNA to TRE promoter could give some results using dCas9 Dnmt3a. p75ngfr is a receptor for proneurotrophins [<xref ref-type="bibr" rid="scirp.104361-ref26">26</xref>]. Together with its coreceptors SorCS1-3 and sortilin they play a fundamental role in nerve system development [<xref ref-type="bibr" rid="scirp.104361-ref27">27</xref>]. p75ngfr signaling is crucial for the development of dorsal root ganglia (DRG) [<xref ref-type="bibr" rid="scirp.104361-ref2">2</xref>] and nociceptive neurons [<xref ref-type="bibr" rid="scirp.104361-ref3">3</xref>]. p75ngfr participates in collapsing growth cone and apoptosis. Altogether this makes p75ngfr promising target for therapeutics intervention. From the set of gRNA’s covered p75ngfr cpg island and transcription start site, the most effective in classical CRISPRi with dCas9-KRAB and Suntag CRISPRi was gRNA5 that is overlapped with TSS. Nucleosome positions on the DNA influence on effectiveness of CRISPRi with dCas9-KRAB. Nucleosomes impede access of the dCas9 complex to the DNA [<xref ref-type="bibr" rid="scirp.104361-ref28">28</xref>]. Remarkably, that dCas9 couldn’t bind nucleosomal DNA in vitro [<xref ref-type="bibr" rid="scirp.104361-ref28">28</xref>]. Also effective cleavage of normal Cas9 is observed in the regions that lack nucleosomes, like transcription start site [<xref ref-type="bibr" rid="scirp.104361-ref29">29</xref>]. Taking into account this fact, it is obvious that gRNA5 was the most effective in dCas9-KRAB and Suntag-KRAB. Interestingly, that usage of gRNA1 and gRNA5 only with dCas9-Dnmt3a leads to 1.5-fold decrease in mRNA amount with absence of significant changes with Suntag-Dnmt3a. This fact could be explained by the larger distance from the gRNA site to the actual CpG residue that is methylated by Dnmt3a in the Suntag-Dnmt3a, in the case of dCas9-Dnmt3a the distance should be shorter. This prompted us that elevation of p75ngfr mRNA in the case of gRNA2 and the Suntag-KRAB complex could be explained by topological orientation. Thus overall Suntag-KRAB-gRNA2 complex inhibits not transcription of p75ngfr, but inhibits transcription of p75ngfr-as antisense transcript. It could be antisense lncRNA that oppositely regulate p75ngfr expression. RACE confirms existence of two alternatively spliced antisense transcripts in the neonatal rat brainstem. This lncRNA could play role in p75ngfr expression regulation during development. Although there aren’t any annotated antisense transcript in the p75ngfr in rat and mouse, but in the human genome there is annotated lncRNA AC006487.1-201 that overlap several last exons of human p75ngfr according to Ensemble database (GRCh38.p13). In conclusion we’ve developed effective system for p75ngfr downregulation in the norepinephrine neurons.</p></sec><sec id="s5"><title>Acknowledgements</title><p>The work was funded through Basic Russian Science Program 0259-2019-0003- C01 and RFBR grant No. 18-315-20028.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s7"><title>Cite this paper</title><p>Lanshakov, D.A. and Sukhareva, E.V. (2020) Development of Genetic Engineering Tools for p75ngfr Methylation and Expression Modulation. Journal of Biosciences and Medicines, 8, 197-207. https://doi.org/10.4236/jbm.2020.811018</p></sec></body><back><ref-list><title>References</title><ref id="scirp.104361-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Kraemer, B.R., et al. (2014) A Role for the p75 Neurotrophin Receptor in Axonal Degeneration and Apoptosis Induced by Oxidative Stress. J Biol Chem, 289, 21205-21216. https://doi.org/10.1074/jbc.M114.563403</mixed-citation></ref><ref id="scirp.104361-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Luo, W., et al. (2007) A Hierarchical NGF Signaling Cascade Controls Ret-Dependent and Ret-Independent Events during Development of Nonpeptidergic DRG Neurons. Neuron, 54, 739-754.  
https://doi.org/10.1016/j.neuron.2007.04.027</mixed-citation></ref><ref id="scirp.104361-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Barker, P.A., et al. (2020) Nerve Growth Factor Signaling and Its Contribution to Pain. J Pain Res, 13, 1223-1241. https://doi.org/10.2147/JPR.S247472</mixed-citation></ref><ref id="scirp.104361-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Haddad, Y., Adam, V. and Heger, Z. (2017) Trk Receptors and Neurotrophin Cross-Interactions: New Perspectives toward Manipulating Therapeutic Side-Effects.  
Front Mol Neurosci, 10, 130. https://doi.org/10.3389/fnmol.2017.00130</mixed-citation></ref><ref id="scirp.104361-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Marchetti, L., et al. (2019) Fast-Diffusing p75(NTR) Monomers Support Apoptosis and Growth Cone Collapse by Neurotrophin Ligands. Proc Natl Acad Sci U S A, 116, 21563-21572. https://doi.org/10.1073/pnas.1902790116</mixed-citation></ref><ref id="scirp.104361-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Hempstead, B.L. (2005) Coupling Neurotrophins to Cell Migration through Selective Guanine Nucleotide Exchange Factor Activation. Proc Natl Acad Sci U S A, 102, 5645-5646. https://doi.org/10.1073/pnas.0501718102</mixed-citation></ref><ref id="scirp.104361-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Howard, L., et al. (2013) ProNGF Promotes Neurite Growth from a Subset of NGF-Dependent Neurons by a p75NTR-Dependent Mechanism. Development, 140, 2108-2117. https://doi.org/10.1242/dev.085266</mixed-citation></ref><ref id="scirp.104361-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Khwaja, F., et al. (2006) The p75(NTR) Tumor Suppressor Induces Cell Cycle Arrest Facilitating Caspase Mediated Apoptosis in Prostate Tumor Cells. Biochem Biophys Res Commun, 341, 1184-1192. https://doi.org/10.1016/j.bbrc.2006.01.073</mixed-citation></ref><ref id="scirp.104361-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Boskovic, Z., et al. (2014) The Role of p75NTR in Cholinergic Basal Forebrain Structure and Function. J Neurosci, 34, 13033-13038.  
https://doi.org/10.1523/JNEUROSCI.2364-14.2014</mixed-citation></ref><ref id="scirp.104361-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Wislet, S., Vandervelden, G. and Rogister, B. (2018) From Neural Crest Development to Cancer and Vice Versa: How p75(NTR) and (Pro)neurotrophins Could Act on Cell Migration and Invasion? Front Mol Neurosci, 11, 244.  
https://doi.org/10.3389/fnmol.2018.00244</mixed-citation></ref><ref id="scirp.104361-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Pinet-Charvet, C., et al. (2020) Beta-Nerve Growth Factor Stimulates Spontaneous Electrical Activity of in Vitro Embryonic Mouse GnRH Neurons through a P75 Mediated-Mechanism. Sci Rep, 10, 10654. https://doi.org/10.1038/s41598-020-67665-4</mixed-citation></ref><ref id="scirp.104361-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Coulson, E.J. (2006) Does the p75 Neurotrophin Receptor Mediate Abeta-Induced Toxicity in Alzheimer’s Disease? J Neurochem, 98, 654-60. 
https://doi.org/10.1111/j.1471-4159.2006.03905.x</mixed-citation></ref><ref id="scirp.104361-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Lu, B. and Martinowich, K. (2008) Cell Biology of BDNF and its Relevance to Schizophrenia. Novartis Found Symp, 289, 119-129; Discussion 129-135, 193-195. 
https://doi.org/10.1002/9780470751251.ch10</mixed-citation></ref><ref id="scirp.104361-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Villanueva, R. (2013) Neurobiology of Major Depressive Disorder. Neural Plast, 2013, Article ID: 873278. https://doi.org/10.1155/2013/873278</mixed-citation></ref><ref id="scirp.104361-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Feng, D.Y., et al. (2020) Nerve Growth Factor against PTSD Symptoms: Preventing the Impaired Hippo-campal Cytoarchitectures. Prog Neurobiol, 184, Article ID: 101721. https://doi.org/10.1016/j.pneurobio.2019.101721</mixed-citation></ref><ref id="scirp.104361-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Shepheard, S.R., et al. (2014) The Extracellular Domain of Neurotrophin Receptor p75 as a Candidate Biomarker for Amyotrophic Lateral Sclerosis. PLoS ONE, 9, e87398. https://doi.org/10.1371/journal.pone.0087398</mixed-citation></ref><ref id="scirp.104361-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Li, W.W., et al. (2019) Ge-netic Association between NGFR, ADAM17 Gene Polymorphism, and Parkin-son’s Disease in the Chinese Han Population. Neurotox Res, 36, 463-471. https://doi.org/10.1007/s12640-019-00031-z</mixed-citation></ref><ref id="scirp.104361-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Cullot, G., et al. (2019) CRISPR-Cas9 Genome Editing Induces Megabase-Scale Chromosomal Trunca-tions. Nat Commun, 10, 1136. 
https://doi.org/10.1038/s41467-019-09006-2</mixed-citation></ref><ref id="scirp.104361-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Xu, X., et al. (2019) Gene Activation by a CRISPR-Assisted Trans Enhancer. Elife, 8. 
https://doi.org/10.7554/eLife.45973</mixed-citation></ref><ref id="scirp.104361-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">MacLeod, R.S., et al. (2019) Effective CRISPR Interference of an Endogenous Gene via a Single Transgene in Mice. Sci Rep, 9, 17312. 
https://doi.org/10.1038/s41598-019-53611-6</mixed-citation></ref><ref id="scirp.104361-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Liu, X.S., et al. (2016) Editing DNA Methylation in the Mammalian Genome. Cell, 167, 233-247.E17. https://doi.org/10.1016/j.cell.2016.08.056</mixed-citation></ref><ref id="scirp.104361-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Pflueger, C., et al. (2018) A Modular dCas9-SunTag DNMT3A Epigenome Editing System Overcomes Pervasive Off-Target Activity of Direct Fusion dCas9-DNMT3A Constructs. Genome Res, 28, 1193-1206. https://doi.org/10.1101/gr.233049.117</mixed-citation></ref><ref id="scirp.104361-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Li, D., et al. (2007) Noradrenergic Cell Specific Gene Transfer with Neuronal Nitric Oxide Synthase Reduces Cardiac Sympathetic Neurotransmission in Hypertensive Rats. Hypertension, 50, 69-74.  
https://doi.org/10.1161/HYPERTENSIONAHA.107.088591</mixed-citation></ref><ref id="scirp.104361-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Pattyn, A., Goridis, C. and Brunet, J.F. (2000) Specification of the Central Noradrenergic Phenotype by the Homeobox Gene Phox2b. Mol Cell Neurosci, 15, 235-243.  
https://doi.org/10.1006/mcne.1999.0826</mixed-citation></ref><ref id="scirp.104361-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Fan, Y., et al. (2011) Transcription Factor Phox2 Upregulates Expression of Norepinephrine Transporter and Dopamine Beta-Hydroxylase in Adult Rat Brains. Neuroscience, 192, 37-53. https://doi.org/10.1016/j.neuroscience.2011.07.005</mixed-citation></ref><ref id="scirp.104361-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Glerup, S., Nykjaer, A. and Vaegter, C.B. (2014) Sortilins in Neurotrophic Factor Signaling. Handb Exp Pharmacol, 220, 165-189.  
https://doi.org/10.1016/j.neuroscience.2011.07.005</mixed-citation></ref><ref id="scirp.104361-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Glerup, S., et al. (2014) SorCS2 Regulates Dopaminergic Wiring and Is Processed into an Apop-totic Two-Chain Receptor in Peripheral Glia. Neuron, 82, 1074-1087. 
https://doi.org/10.1016/j.neuron.2014.04.022</mixed-citation></ref><ref id="scirp.104361-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Horlbeck, M.A., et al. (2016) Nucleosomes Impede Cas9 Access to DNA in Vivo and in Vitro. Elife, 5. https://doi.org/10.7554/eLife.12677</mixed-citation></ref><ref id="scirp.104361-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Yarrington, R.M., et al. (2018) Nucleosomes Inhibit Target Cleavage by CRISPR-Cas9 in Vivo. Proc Natl Acad Sci U S A, 115, 9351-9358. 
https://doi.org/10.1073/pnas.1810062115</mixed-citation></ref></ref-list></back></article>