Brown rots of Red Fuji apples were observed in Hangzhou city (Zhengjiang Province, China). The causal agent was isolated and identified in both morphological and molecular genetic levels. The phenotype and phylogenetic analysis revealed that the isolate was Diaporthe phaseolorum var. caulivora , and its pathogenicity on apple fruit was confirmed by re-inoculation experiment. To our knowledge, this is the first report of D. phaseolorum var. caulivora causing postharvest fruit rot on apple in China.
Apple (Malus domestica Borkh.) is a kind of popular edible fruit in China and the apple industry is one of the advantageous industries of China’s agricultural economy. In 2018, the apple production of China was 39.24 million tonnes accounting for 45.55% of the world total (http://www.fao.org/faostat/en/#data/QC). Apple fruit containing high levels of sugars and nutrients was susceptible to fungal infection at suboptimal conditions which lead to serious commercial losses and mycotoxin contamination for some toxigenic fungi [
Naturally infected apples (Malus domestica Borkh. cv. Red Fuji) were collected from the local supermarket in Jianggan District of Hangzhou City. For the isolation of the causal agent, a small piece (about 0.2 cm) of necrotic tissue with the structure of reproduction of fungus was cut from infected apple fruit, disinfected by 75% ethanol for 2 min followed by rinsing with sterile distilled water, air-dried, plated onto potato dextrose agar (PDA) medium. After 7 days of culturing, hyphal tips were transferred to PDA and cultured at 25˚C under 16 h photoperiods with a light intensity of 1500 lux. Repeat this step until the colonial phenotype was stable.
Morphological characteristics of isolates (conidia, mycelia, colonies, and symptoms) were observed. Also, the total genome DNA of pathogen was extracted from the mycelia by a DNeasy Plant Mini Kit (Qiagen, Germany) following the product manual. The internal transcribed spacer (ITS) of rDNA and β-tubulin regions were amplified using a PrimeSTAR HS DNA Polymerase (Takara, Japan) and the primer sets ITS1/ITS4 (CTTGGTCATTTAGAGGAAGTAA/TCCTCCGCTTATTGATATGC), TS4/ITS5 (TCCTCCGCTTATTGATATGC/GGAAGGTAAAAGTCGTAACAAG), and BT2a/BT2b (AACATGCGTGAGATTGTAAGT/TCTGGATGTTGTTGGGAATCC) [
To confirm the pathogenicity, twelves surface-sterilized apples at commercial maturity and without mechanical injury were wounded by a sterile syringe needle. Six apples were inoculated with mycelial plugs (5 mm diameter) from 7-day old cultures. As a negative control, six apples were inoculated with sterile PDA plugs. All fruit were incubated in a moist chamber at 25˚C and 80% humidity with a 16 h light/8 h darkness period. The decay incidence and lesion diameter were recorded. Two replicates were conducted. The pathogens were re-isolated from symptomatic fruits and identified by the steps described above.
In August 2018, brown rots of “Red Fuji” apples were observed in several supermarkets in Hangzhou city (Zhengjiang Province, China). Early symptoms of fruit rot included light to dark brown lesions with defined margins. In more advanced stages of the disease, the fruit became completely rotten and soft. In the PDA plate, the isolated fungus developed fast and quickly formed a dense white mycelium, which gradually became fluffy. The color of mycelium was white at first, turning light yellow-green on the front and dark brown on the reverse side of plates. After 2 weeks of culturing, black stromata with irregular shapes were visible. The perithecia had a variable-length neck. Conidia were hyaline, round, elongate to ellipsoidal, or irregular (
After amplification using universal primer pairs, DNA fragments about 600 - 700 bp were obtained, sequenced, and mega blasted. MegaBLAST searches against GenBank showed that our sequences best matched with 97.69% (ITS1/ITS4), 97.69% (ITS4/ITS5), and 97.60% (BT2a/BT2b) nucleotide identity to Diaporthe phaseolorum var. caulivora. Phylogenetic analysis revealed that the isolate was clustered within D. phaseolorum var. caulivora (
| Primer pairs | Length (bp) | Sequence information |
|---|---|---|
| ITS1/ITS4 | 619 | cttggtcatttagaggaagtaaaagtcgtaacaaggtctccgttggtgaaccagcggagggatcattgctggaacgcgccccaggcgcacccagaaaccctttg tgaacttataccttactgttgcctcggcgcaggccggcccccctgggggccccccggagacggggagcagcccgccggcggccaagttaactcttgtttttata ctgaaactctgagaaataaacataaatgaatcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaa ttgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccctctggtattccggagggcatgcctgttcgagcgtcatttcaaccctcaagcctggcttgg tgttggggcactgcgtctctcgcgggatgcaggccctgaaattcattggcgagctcgccaggaccccgagcgcagtagttaaaccctcgctctggaaggccctg gcggtgccctgccgttaaacccccaacttctgaaaatttgacctcggatcaggtaggaatacccgctgaacttaagcatatcaataagcggagga |
| ITS4/ITS5 | 605 | tcctccgcttattgatatgcttaagttcagcgggtattcctacctgatccgaggtcaaattttcagaagttgggggtttaacggcagggcaccgccagggccttcca gagcgagggtttaactactgcgctcggggtcctggcgagctcgccaatgaatttcagggcctgcatcccgcgagagacgcagtgccccaacaccaagccagg cttgagggttgaaatgacgctcgaacaggcatgccctccggaataccagagggcgcaatgtgcgttcaaagattcgatgattcactgaattctgcaattcacatt acttatcgcatttcgctgcgttcttcatcgatgccagaaccaagagatccgttgttgaaagttttgattcatttatgtttatttctcagagtttcagtataaaaacaaga gttaacttggccgccggcgggctgctccccgtctccggggggcccccaggggggccggcctgcgccgaggcaacagtaaggtataagttcacaaagggtttct gggtgcgcctggggcgcgttccagcaatgatccctccgctggttcaccaacggagaccttgttacgacttttacttcc |
| BT2a/BT2b | 705 | cgtcggcccatgctgctttcgcatcctcgtcttgcccctgagccctgagcctaccccaccatcgcggccacgccctcggtcgggcctcaaaacatcaccaacacc ttgcgacgagcacccagatgccctcagcacacgcgtcagattgctaacttgacccttttgctcgcctctaggttcacctgcagaccggccaatgcgtaagctgctc ctgtcaacaccgccggacgggccttgtcatcgccacccctagctgacacgtttcccagggtaaccaaatcggggctgctttctggggcgggccgcctccagctc caagcctgccaccgcgaggctcgacgcgccaccatgcgacctcgagacacccttactgaccccgaactcttaggcaaaccatctctggcgagcacggtctcga cagcaatggcgtgtatgcactcctgttccctgtccccgcatcgagccctccccggcttggcactgacaatttgcgcagttacaacggcacttccgagcttcagctc gagcgcatgaacgtctacttcaacgaggtaagccggcggccacgtccttgaccagtcctgcaccacggtttccggccgtcgccaggtgccctgctgaccagtta tcgcccaggcctccggtaacaagtatgtaccccgcgccgtcctcgtcgatctcgagcccggcccatggacgccgtc |
Through the artificial infection test, all of the inoculated fruit show typical symptoms and lesion diameter ranged from 2.4 to 4.7 cm after 10 days of culturing. The negative control fruits remained healthy. The results indicated that the pathogen was highly pathogenic to apples. The re-isolated fungi had morphological characteristics that resembled the original isolates from infected apples. The identity of these isolates was confirmed as D. phaseolorum var. caulivora by sequencing.
Diaporthe phaseolorum var. caulivorav, belonging to the class ascomycetes, was first found in Iowa in the 1940s which was responsible for soybean stem canker. In recent years, it has been reported in most soybean-growing regions in the world with high adaptability in a large number of hosts [
A causal agent for brown rots of “Red Fuji” apples was isolated and identified by morphological characteristics and molecular identification. To our knowledge, this is the first report of D. phaseolorum var. caulivora causing postharvest rot on apple fruit in Zhejiang province, China.
This research was financially supported by the Zhejiang Provincial Natural Science Foundation of China (LY19C200010 and LY18C150009) and the Master Innovation Program of Zhejiang Provincial First-Class Biological Disciplines.
The authors declare no conflicts of interest regarding the publication of this paper.
Chen, Y.Z., Zhou, Q., Sun, Y.Y., Li, R., Liu, Y.Y. and Zhou, T. (2020) First Report of a Postharvest Fruit Rot on Apple Caused by Diaporthe phaseolorum var. caulivora in China: A Note. American Journal of Plant Sciences, 11, 1612-1617. https://doi.org/10.4236/ajps.2020.1110116