<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">JBM</journal-id><journal-title-group><journal-title>Journal of Biosciences and Medicines</journal-title></journal-title-group><issn pub-type="epub">2327-5081</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/jbm.2020.89004</article-id><article-id pub-id-type="publisher-id">JBM-102738</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Occurrence of Extended Spectrum Beta Lactamase Encoding Genes among Urinary Pathogenic &lt;i&gt;Escherichia coli&lt;/i&gt; and &lt;i&gt;Klebsiella pneumoniae&lt;/i&gt; Isolates Obtained from a Tertiary Hospital in Gombe Nigeria
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Adamu</surname><given-names>Yarima</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ali</surname><given-names>Ahmed Haroun</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Timothy</surname><given-names>Bulus</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mohammed</surname><given-names>M. Manga</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Department of Biological Sciences, Nigerian Defence Academy, Kaduna, Nigeria</addr-line></aff><aff id="aff3"><addr-line>Department of Biochemistry, Kaduna State University, Kaduna, Nigeria</addr-line></aff><aff id="aff1"><addr-line>Department of Plant Science, Bioresource Development Center Michika, National Biotechnology Development Agency, Abuja, Nigeria</addr-line></aff><aff id="aff4"><addr-line>Department of Medical Microbiology and Immunology, Gombe State University and Federal Teaching Hospital Gombe, Gombe, Nigeria</addr-line></aff><pub-date pub-type="epub"><day>04</day><month>09</month><year>2020</year></pub-date><volume>08</volume><issue>09</issue><fpage>42</fpage><lpage>55</lpage><history><date date-type="received"><day>23,</day>	<month>June</month>	<year>2020</year></date><date date-type="rev-recd"><day>6,</day>	<month>September</month>	<year>2020</year>	</date><date date-type="accepted"><day>9,</day>	<month>September</month>	<year>2020</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  This study was conducted to assess the occurrence and nature of extended-spectrum beta lactamase (ESBL) producing 
  <em>Escherichia coli</em> and 
  <em>Klebsiella pneumoniae</em> isolates from patients who presented with urinary tract infection at Federal Teaching Hospital Gombe. Isolates collected were recovered on MacConkey agar at 35
  &amp;deg;C and were identified as members of Enterobacteriaceae, and further screened for antimicrobial susceptibility and resistance by disc diffusion method. Isolates resistant to oxyimino-cephalosporins were confirmed as ESBL producers using Double Disks Synergy Test (DDST). The study shows 66% resistance to ceftriaxone (30 μg) in 
  <em>K. pneumoniae</em>, which was the highest value recorded and a 51% resistance to cefpodoxime (10 
  <em>μ</em>g) in 
  <em>E. coli</em>. The sensitivity of 
  <em>E. coli </em>and 
  <em>K. pneumoniae</em> isolates to cefpodoxime (10 
  <em>μ</em>g) were 49% and 33.9% respectively. ESBLs were detected among 40% (40/100) of 
  <em>E. coli</em> and 54.13% (59/109) of 
  <em>K. pneumoniae</em> isolates. Molecular characterization of ESBL encoding genes among 
  <em>E. coli</em> isolates using multiplex-PCR showed 10% prevalence of SHV gene and 5% prevalence for CTX-M gene while TEM gene was not detected. In 
  <em>K. pneumoniae</em> isolates, 5% prevalence was recorded for each of the three genes screened. The study revealed a co-occurrence of SHV and CTX-M in 75% of the 
  <em>E. coli</em> and 70% of the 
  <em>K. pneumoniae</em> isolates; the occurrence of all the three genes was seen in 10% and 5% of 
  <em>K. pneumoniae</em> and 
  <em>E. coli</em> respectively. Multiplex-PCR method provided an efficient and rapid detection of ESBL related genes, hence could be used in epidemiological studies among ESBL isolates. Monitoring dissemination and transmissions of ESBL producers are highly recommended for optimum patient care and preventing the spread of multidrug resistant (MDR) pathogens.
 
</p></abstract><kwd-group><kwd>ESBL</kwd><kwd> Double Disk Synergy Test</kwd><kwd> M-PCR</kwd><kwd> TEM</kwd><kwd> SHV</kwd><kwd> CTX-M Genes</kwd><kwd> Nigeria</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Beta-lactam antibiotics are a class of broad-spectrum antibiotics, consisting of all antibiotic agents that contain a beta-lactam ring in their molecular structures, and are frequently prescribed antimicrobial agents all over the world in treatment of infections caused by Gram positive and Gram negative bacteria [<xref ref-type="bibr" rid="scirp.102738-ref1">1</xref>]. These agents are widely used antimicrobials for humans as well as animals [<xref ref-type="bibr" rid="scirp.102738-ref2">2</xref>]. Beta-lactam antibiotics are named after their molecular core structure, the beta-lactam ring, which forms the center and active part of the drug [<xref ref-type="bibr" rid="scirp.102738-ref2">2</xref>]. There are six different groups of beta-lactam antibiotics based on their mode of actions: Penicillins, Cephalosporins (1<sup>st</sup>, 2<sup>nd</sup>, 3<sup>rd</sup>, 4<sup>th</sup> and 5<sup>th</sup> generations), Carbapenems, Penems, Monobactams and beta lactamase inhibitors like clavulanic acid and sulbactam [<xref ref-type="bibr" rid="scirp.102738-ref3">3</xref>]. The latter group has no antibacterial activity on its own but inhibits the activity of beta lactamase enzymes and is often given in combination with other beta-lactam antibiotics. Beta lactam antibiotics are known to irreversibly inhibit enzymes involved in the final steps of cell wall synthesis [<xref ref-type="bibr" rid="scirp.102738-ref4">4</xref>]. Beta lactamases are bacterial enzymes that provide multi-resistance to beta lactam antibiotics such as Penicillins, Cephalosporins and Carbapenems, although Carbapenems are relatively resistant to beta lactamase. Beta lactamase enzymes break down the antibiotics structure thereby rendering them ineffective against the bacteria.</p><p>As bacteria continue to develop resistance against beta lactam antibiotics such as Penicillins and Cephalosporins newer antibiotics were discovered and used in the treatment. However, the bacteria incessantly evolved and changed the existing beta-lactamase enzymes to break down these new antibiotics. This further class of enzymes that can break down these newer antibiotics was referred to as Extended-Spectrum Beta Lactamases (ESBLs) [<xref ref-type="bibr" rid="scirp.102738-ref5">5</xref>]. Extended-spectrum beta lactamases are plasmid-mediated enzymes which have the ability to hydrolyze and inactivate broad spectrum of beta lactam antibiotics such as penicillins, cephalosporins (3<sup>rd</sup> generation) and monobactams, but are inhibited by beta lactamase inhibitors like clavulanic acid [<xref ref-type="bibr" rid="scirp.102738-ref6">6</xref>]. The beta lactamase enzymes like TEM-1 were first reported in 1965 [<xref ref-type="bibr" rid="scirp.102738-ref7">7</xref>], SHV-1 in 1972 [<xref ref-type="bibr" rid="scirp.102738-ref8">8</xref>] and CTX-M in 1986 [<xref ref-type="bibr" rid="scirp.102738-ref9">9</xref>]. The spread of beta-lactamases may be chromosomal or plasmid mediated [<xref ref-type="bibr" rid="scirp.102738-ref10">10</xref>].</p><p>The occurrence of ESBL among pathogenic bacteria is rising and is associated with increasing treatment failure, morbidity, and mortality, length of hospital stays and overall cost of patient care [<xref ref-type="bibr" rid="scirp.102738-ref11">11</xref>]. Most ESBL plasmids also carry genes conferring resistance to several non-beta-lactam antibiotics apart from encoding genes conferring resistance to the extended spectrum antibiotics [<xref ref-type="bibr" rid="scirp.102738-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref12">12</xref>]. Presently, more than 400 different ESBLs have been identified, and these are clustered into three major groups: TEM, SHV and CTX-M, with 183, 134 and 103 variants, respectively [<xref ref-type="bibr" rid="scirp.102738-ref13">13</xref>]. Among the mentioned ESBL variants, TEM and SHV were the major types in some countries [<xref ref-type="bibr" rid="scirp.102738-ref14">14</xref>]. Klebsiella pneumoniae and Escherichia coli remain the major ESBL-producing organisms isolated worldwide, but these enzymes have also been identified in several other members of the Enterobacteriaceae family and in certain non-fermentors [<xref ref-type="bibr" rid="scirp.102738-ref15">15</xref>].</p><p>Urinary Tract Infection (UTI) is one of the most common infections prevalent among both females and males [<xref ref-type="bibr" rid="scirp.102738-ref16">16</xref>]. It is also a common bacterial infection among infants and young children [<xref ref-type="bibr" rid="scirp.102738-ref17">17</xref>]. It can occur anywhere along the urinary tract and mostly caused by the Enterobacteriaceae with E. coli, and Klebsiella species being most prominent [<xref ref-type="bibr" rid="scirp.102738-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref19">19</xref>]. Annually, over 150 million people are diagnosed with UTIs accounting for about 40% of all infections and making it the second most diagnosed infection worldwide [<xref ref-type="bibr" rid="scirp.102738-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref21">21</xref>]. These infections are treated with a variety of antibiotics including beta lactams, beta lactam/beta lactamase inhibitor combinations, fluoroquinolones and carbapenems [<xref ref-type="bibr" rid="scirp.102738-ref22">22</xref>]. Recent studies revealed that, there is an increase in the antibiotic resistance among the urinary tract pathogens worldwide [<xref ref-type="bibr" rid="scirp.102738-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref24">24</xref>]. This increase in antibiotic resistance is associated with increase in Extended Spectrum Beta Lactamase producing isolates, which are a class of organisms that produce beta lactamase enzymes involved in the hydrolysis of extended spectrum beta lactam antibiotics [<xref ref-type="bibr" rid="scirp.102738-ref6">6</xref>]. Identified risk factors for developing ESBL producers include prolonged hospitalization and indiscriminate use/abuse of antibiotics [<xref ref-type="bibr" rid="scirp.102738-ref25">25</xref>]. In Nigeria, several studies about UTIs have been reported from different parts of the country [<xref ref-type="bibr" rid="scirp.102738-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref27">27</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref28">28</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref29">29</xref>]. Even though several studies have been carried out on the prevalence of ESBL, few have been associated with urinary tract infections, especially in north-eastern Nigeria where the prevalence of urinary tract infection is reported to be as high as 33.34% in Gombe [<xref ref-type="bibr" rid="scirp.102738-ref30">30</xref>]. It is in view of this, that this study was designed to evaluate the prevalence and molecular nature of ESBL in isolates obtained from patients with urinary tract infections in Gombe, Nigeria. This work, to the best of our knowledge is the first report of the molecular characterization of urinary tract pathogenic E. coli and K. pneumonia from patients who presented at Federal Teaching Hospital, Gombe, North Eastern Nigeria.</p><p>The economic and healthcare burden resulting from infections due to multidrug resistant bacteria are estimated to be at least ?.5 billion every year [<xref ref-type="bibr" rid="scirp.102738-ref31">31</xref>]. WHO [<xref ref-type="bibr" rid="scirp.102738-ref32">32</xref>] reported that about 1.8 million children are being killed every year due to increase in resistance among bacteria causing pneumonia. Mortality due to resistant bacterial infections exceeds 25,000 annually [<xref ref-type="bibr" rid="scirp.102738-ref31">31</xref>] in Europe. Production of beta-lactamase enzymes remains the most important contributing factor to bacterial resistance [<xref ref-type="bibr" rid="scirp.102738-ref33">33</xref>].</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Study Area</title><p>Federal Teaching Hospital (FTH) Gombe is a 450 bedded tertiary healthcare institution that was established in 1996 and is located within Gombe, the capital city of Gombe State Nigeria. It has the full complement of almost all medical/surgical specialties including the clinical microbiology laboratory where cultures and antibiotic susceptibility tests are routinely performed.</p></sec><sec id="s2_2"><title>2.2. Ethical Approval</title><p>This study was approved by the Research and Ethics Committee of the Federal Teaching Hospital Gombe.</p></sec><sec id="s2_3"><title>2.3. Sample Collection and Identification</title><p>Two hundred and nine (209) urinary clinical isolates of E. coli (n = 100) and K. pneumoniae (n = 109) were taken from the Department of Medical Microbiology to Microbiology Laboratory FTH Gombe from September, 2018 to April, 2019. They were recovered on MacConkey agar plates at 35˚C for 18 hours. Suspected bacterial isolates were identified using biochemical tests as based on established testing methods.</p></sec><sec id="s2_4"><title>2.4. Phenotypic Detection of ESBL Production</title><p>Two tests were done; initial screen test using the indicator cephalosporins (such as ceftazidime) and phenotypic confirmatory test as described by Elsayed [<xref ref-type="bibr" rid="scirp.102738-ref34">34</xref>].</p></sec><sec id="s2_5"><title>2.5. Screening Test</title><p>The screening was done by disc diffusion technique. This involves screening for reduced susceptibility to more than one of the indicator antimicrobials (ceftazidime 30 μg, ceftriaxone 30 μg and cefpodoxime 10 μg). Briefly, A loopful of test isolates was suspended into a normal saline to match 0.5 McFarland turbidity standard and were subsequently swabbed on to a surface of Muller-Hinton agar plates using sterile swab stick. The susceptibility discs of Cefpodoxime (10 &#181;g), Ceftriaxone (30 &#181;g) and Ceftadizime (30 &#181;g) were placed 20 mm apart onto the surface of Muller Hinton agar using sterile forceps, leaving 15 mm away from the edge of the Petri dish. After incubation at 37˚C for 18 hours, inhibition zones were measured to the nearest mm. When a diameter zone of ≤22 mm for ceftazidime, ≤25 mm for ceftriaxone and ≤17 mm for cefpodoxime were recorded, the isolates were reported as suspected ESBL [<xref ref-type="bibr" rid="scirp.102738-ref35">35</xref>]. Suspected ESBL positive isolates were confirmed using Double Disk Synergy Test (DDST). E. coli (ATCC-25922) and K. pneumoniae (ATCC-700603) were used as reference strains.</p></sec><sec id="s2_6"><title>2.6. Confirmatory Test Using Double Disk Synergy Test (DDST)</title><p>The procedure of Amiri [<xref ref-type="bibr" rid="scirp.102738-ref36">36</xref>] was employed with modification. Briefly, the test organisms were swabbed on to a surface of Mueller-Hinton agar plates with a suspension (adjusted to 0.5 McFarland turbidity standard). A susceptibility disk containing amoxicillin-clavulanate (20/10 μg) was placed in the center of the plate, and disks of Ceftriaxone (30 μg) and Ceftadizime (30 μg) were placed around it at a distance of 15 mm apart. Plates were incubated at 37˚C for 18 hours. An enhanced zone of inhibition as shown in <xref ref-type="fig" rid="fig1">Figure 1</xref> towards the centrally placed disk was considered positive for ESBL [<xref ref-type="bibr" rid="scirp.102738-ref37">37</xref>]. K. pneumoniae ATCC 700603 and E. coli ATCC 25922 were used as quality control strains [<xref ref-type="bibr" rid="scirp.102738-ref35">35</xref>].</p></sec><sec id="s2_7"><title>2.7. Molecular Identification of SHV, TEM and CTX-M Bla Genes Using Multiplex PCR</title><p>The genomic DNA of forty (40) representative samples was extracted using the commercially available kit (Bioneer, USA) for molecular characterization. The genomic DNA extracts were thereafter stored at −20˚C until required for PCR.</p><p>The primers employed in the multiplex PCR were those described by Kaur and Aggarwal [<xref ref-type="bibr" rid="scirp.102738-ref38">38</xref>] for detection of blaTEM, blaSHV and blaCTX-M genes. The sequences of the forward and reverse primers are given in <xref ref-type="table" rid="table1">Table 1</xref>.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primer sequences used in multiplex polymerase chain reactions</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Target</th><th align="center" valign="middle" >Primer sequence (5'-3')</th><th align="center" valign="middle" >Molecular Weight (bp)</th><th align="center" valign="middle" >Melting Temperature (˚C)</th></tr></thead><tr><td align="center" valign="middle" >TEM-F TEM-R</td><td align="center" valign="middle" >GTATCCGCTCATGAGACAATA ACCCTG CCAATGCTTAATCAGTGAGGCACC</td><td align="center" valign="middle" >918</td><td align="center" valign="middle" >94</td></tr><tr><td align="center" valign="middle" >SHV-F SHV-R</td><td align="center" valign="middle" >CGCCTGTGTATTATCTCCCTGTTAGCC TTGCCAGTGCTCGATCAGCG</td><td align="center" valign="middle" >842</td><td align="center" valign="middle" >94</td></tr><tr><td align="center" valign="middle" >CTX-M-F CTX-M-R</td><td align="center" valign="middle" >CGCTTTGCGATGTGCAG ACCGCGATATCGTTGGT</td><td align="center" valign="middle" >550</td><td align="center" valign="middle" >94</td></tr></tbody></table></table-wrap><p>Sequence obtained from Kaur and Aggarwal [<xref ref-type="bibr" rid="scirp.102738-ref38">38</xref>].</p><p>Multiplex-PCR was performed using PTC-100 thermal cycler (USA) to detect beta lactamase genes (blaTEM, blaCTX-M and blaSHV) using PCR conditions as described by [<xref ref-type="bibr" rid="scirp.102738-ref39">39</xref>]. The M-PCR was carried out using 1.5 &#181;l of extracted genomic DNA in a 20 &#181;l PCR reaction mixture consisting of 2.5 &#181;l 10&#215; PCR buffer, 1.5 &#181;l MgCl<sub>2</sub> (50 mM), 0.5 &#181;l dNTPs (10 mM), 1.5 &#181;l of each primer, 0.5 &#181;l of Taq DNA polymerase, and 9 &#181;l sterile distilled water. M-PCR was performed under the following conditions: Initial denaturation at 94˚C for 1 minute, denaturation at 94˚C for 30 seconds, annealing at 60˚C for 30 seconds, and extension at 72˚C for 1 minute and a final extension at 72˚C for 6 minutes. PCR products were determined by electrophoresis in a 1.5% (g/v) agarose gel.</p></sec><sec id="s2_8"><title>2.8. Statistical Analysis</title><p>Data obtained were statistically described in forms of frequencies, relative frequencies, figures and tables where appropriate. Differences between proportions were analyzed using ANOVA, in which the P values of the null hypothesis when less than 0.05 were considered significant. All statistical calculations were done using IBM SPSS statistic 23 software.</p></sec></sec><sec id="s3"><title>3. Result</title><sec id="s3_1"><title>3.1. Antibiotic Susceptibility Pattern of K. pneumoniae and E. coli Isolates to Common Indicator Cephalosporins</title><p>The antibiotic susceptibility pattern of K. pneumoniae and E. coli isolates is presented in <xref ref-type="table" rid="table2">Table 2</xref>. Results showed that the highest resistance (66%) to Ceftriaxone (30 &#181;g) and 61.5% to Ceftadizime (30 &#181;g) were both observed in K. pneumoniae, while the least resistance of 51% to Cefpodoxime (10 &#181;g) was recorded in E. coli. The highest sensitivity to Cefpodoxime (10 &#181;g) of 49% followed by Ceftadizime (30 &#181;g) of 48% were both recorded in E. coli, while the least sensitivity to Ceftriaxone (30 &#181;g) of 33.9% followed by Ceftadizime (30 &#181;g) of 38.5% occurred both in K. pneumoniae.</p></sec><sec id="s3_2"><title>3.2. Molecular Characterization of ESBL Related Genes</title><p>Result of the percentage distribution of genotypes among E. coli and K. pneumoniae isolated from urinary clinical samples is presented in <xref ref-type="fig" rid="fig2">Figure 2</xref>. From the 40 randomly chosen representative samples (20 for each isolate) subjected to multiplex-PCR to ascertain the possible gene types (blaCTX-M, blaSHV and blaTEM) responsible for the production of beta-lactamases, test isolates were found to harbour one or more genes. The most prevalent among the detected genes (<xref ref-type="fig" rid="fig3">Figure 3</xref>) is SHV, followed by CTX-M and TEM with 10%, 5% and 0% prevalence in E. coli respectively. TEM gene alone was not detected in E. coli but in association with other genes. While in K. pneumoniae 5% prevalence recorded for all the three genes. SHV + CTX-M was 75% in E. coli and 70% in K. pneumoniae, while the combination of SHV + TEM showed 5% in both of the isolates. Co-occurrence of all three genes recorded 5% prevalence in E. coli and 10% in K. pneumoniae.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Antibiotic susceptibility pattern in E. coli and K. pneumoniae isolates</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Antibiotics (&#181;g)</th><th align="center" valign="middle"  colspan="2"  >K. pneumoniae</th><th align="center" valign="middle"  colspan="2"  >E. coli</th></tr></thead><tr><td align="center" valign="middle" >No of resistant isolates (%)</td><td align="center" valign="middle" >No of sensitive isolates (%)</td><td align="center" valign="middle" >No. of resistant isolates (%)</td><td align="center" valign="middle" >No. of sensitive isolates (%)</td></tr><tr><td align="center" valign="middle" >CAZ (30)</td><td align="center" valign="middle" >67 (61.5)</td><td align="center" valign="middle" >42 (38.5)</td><td align="center" valign="middle" >52 (52)</td><td align="center" valign="middle" >48 (48)</td></tr><tr><td align="center" valign="middle" >CRO (30)</td><td align="center" valign="middle" >72 (66)</td><td align="center" valign="middle" >37 (33.9)</td><td align="center" valign="middle" >61 (61)</td><td align="center" valign="middle" >39 (39)</td></tr><tr><td align="center" valign="middle" >CPD (10)</td><td align="center" valign="middle" >63 (57.8)</td><td align="center" valign="middle" >46 (42.2)</td><td align="center" valign="middle" >51 (51)</td><td align="center" valign="middle" >49 (49)</td></tr></tbody></table></table-wrap><p>Values before parentheses are number observed while those within are percentages. Note: CAZ: Caftadizime, CRO: Ceftriaxone, CPD: Cefpodoxime.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>This study was designed to investigate the occurrence, prevalence and molecular nature of ESBL-mediated drug resistance associated with some urinary tract clinical isolates. The resistance of K. pneumoniae and E. coli isolates to antimicrobial agents tested (ceftriaxone, ceftazidime and cefpodoxime) were observed to be high in this study with the highest resistance recorded in K. pneumoniae to ceftriaxone and ceftazidime 66% and 61.5%, respectively. This is consistent with observations made by [<xref ref-type="bibr" rid="scirp.102738-ref40">40</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref41">41</xref>] who reported that Klebsiella species were more resistance to third generation cephalosporins compared to E. coli. In addition, Chourasia et al. [<xref ref-type="bibr" rid="scirp.102738-ref42">42</xref>] buttressed our finding that Klebsiella species were the most frequent ESBL producers relative to E. coli. In contrast, Farzana et al., [<xref ref-type="bibr" rid="scirp.102738-ref43">43</xref>] reported higher ESBL production in E. coli over K. pneumoniae, Proteus spp. and Pseudomonas spp. K. pneumoniae is known to have some virulence factors like hyperviscosity, polysaccharide capsule, production of endotoxin and carbapenemases and their presence may partly account for the higher occurrence of the resistance seen [<xref ref-type="bibr" rid="scirp.102738-ref44">44</xref>]. The antimicrobial susceptibility pattern observed in this study, in addition to the roles played by the factors mentioned above, may be attributable to the large amount of third generation cephalosporins consumed in our locality as they are relatively cheap and, being an oral antibiotics, easy to administer [<xref ref-type="bibr" rid="scirp.102738-ref18">18</xref>]. Other contributors to this include indiscriminate use/abuse of antibiotics, prolonged hospitalization, incomplete/subtherapeutic antibiotic dose regimens, and the use/misuse of antimicrobials in animal husbandry [<xref ref-type="bibr" rid="scirp.102738-ref25">25</xref>].</p><p>The prevalence of Extended Spectrum Beta Lactamase (ESBL) production among K. pneumoniae and E. coli isolates observed in this study was 54.1% and 40% respectively. These high values were consistent with other reports on ESBL prevalence such as those from India and Egypt [<xref ref-type="bibr" rid="scirp.102738-ref34">34</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref38">38</xref>] where ESBL production as high as 41.5% in E. coli, and 54.5% in K. pneumoniae were found. Values higher (91% in E. coli and 89.2% in K. pneumoniae) than observed in this study, have, however, been reported [<xref ref-type="bibr" rid="scirp.102738-ref45">45</xref>] in Aljazira State of Sudan. Much lower results compared to the result from the present finding of 32% in E. coli, 20% in K. pneumoniae, 20% in Proteus spp. and 13% in Pseudomonas spp. [<xref ref-type="bibr" rid="scirp.102738-ref43">43</xref>] and 14.29% in Escherichia coli, and 7.14% Klebsiella pneumoniae in Gombe have also been seen [<xref ref-type="bibr" rid="scirp.102738-ref30">30</xref>].</p><p>Recent advances in the field of molecular biology, especially the discovery of Polymerase Chain Reaction (PCR) technique has permitted the targeting of unique genes in microorganisms thereby facilitating their molecular characterization [<xref ref-type="bibr" rid="scirp.102738-ref46">46</xref>] [<xref ref-type="bibr" rid="scirp.102738-ref47">47</xref>]. This approach to identification and detection of disease-causing pathogens is generally adjudged to be very sensitive, fast and accurate [<xref ref-type="bibr" rid="scirp.102738-ref48">48</xref>]. Several PCR types exist with emphasis on specific feature(s)/aspects of the technique, one of which, the multiplex PCR, allows for simultaneous amplification of two or more genes by optimizing conditions that favors annealing of primers to the genes in a single amplification protocol [<xref ref-type="bibr" rid="scirp.102738-ref49">49</xref>]. Therefore, multiplex PCR has had a wide useful application in molecular identification of disease-causing pathogens and, more recently, in the identification of drug resistant gene (s) in diseases associated with organisms such as SHV, CTX-M and TEM genes [<xref ref-type="bibr" rid="scirp.102738-ref38">38</xref>]. In this study, attempt was made to identify, singly or in combination, ESBL related genes using Multiplex-PCR. The study has successfully detected co-occurrence of three major genes related to ESBL in both studied organisms. The occurrence of SHV and CTX-M genes with 75% prevalence in E. coli and 70% in K. pneumoniae, appear to be the most predominant molecular manifestation of this drug resistance among K. pneumonia and E. coli isolated from urinary tract-infected individuals. Work by Lal et al. [<xref ref-type="bibr" rid="scirp.102738-ref50">50</xref>], reported 67.3% of the two genes occurring together in India and seems to agree with the observation made in this study. According to Zongo et al. [<xref ref-type="bibr" rid="scirp.102738-ref51">51</xref>], the coproduction of all the three genes (TEM + SHV + CTX-M) was 10.52% prevalent in the samples they studied in Burkina Faso, and this low figure seems to tally with the 10% and 5% prevalence seen in this work in K. pneumonia and E. coli respectively. Similar result was also reported by [<xref ref-type="bibr" rid="scirp.102738-ref18">18</xref>] in which all the three genes carried 9.09% prevalence. The most common single gene occurrence observed in this study was with respect to SHV (10% prevalence in E. coli and 5% in K. pneumonia). Al-Agamy et al. [<xref ref-type="bibr" rid="scirp.102738-ref52">52</xref>] similarly observed 6.8% prevalence of SHV in Saudi Arabia. Occurrence of CTX-M gene alone for both isolates was 5% while TEM gene alone was not detected in E. coli but had 5% prevalence in K. pneumoniae. The co-occurrence of SHV+TEM genes was 5% which is in accordance with the result of [<xref ref-type="bibr" rid="scirp.102738-ref18">18</xref>] 2.27% in Aleppo, Syria. The frequency of occurrence of these beta lactamases encoding genes in both E. coli and K. pneumoniae were almost the same. The factors that define co-occurrence has not been fully elucidated but could be partly explained by genetic recombination processes in microorganisms.</p><p>Significant association between ESBL encoding genes and Urinary Clinical isolates was observed. Higher percentages were reported by [<xref ref-type="bibr" rid="scirp.102738-ref53">53</xref>], in which CTX-M and SHV genes were 28.8% and 13.7% respectively. Much higher prevalence was reported by Ahmed et al. [<xref ref-type="bibr" rid="scirp.102738-ref54">54</xref>], in which CTX-M was 71.4% in E. coli and 68.4% in Klebsiella and TEM was 55.1% in E. coli and 58% in Klebsiella in Sudan. Yahaya et al. [<xref ref-type="bibr" rid="scirp.102738-ref55">55</xref>] reported the prevalence of ESBL genes for E. coli and K. pneumoniae having 17(38.6%) SHV and 22(66.7%) CTX-M respectively in Borno-North-Eastern Nigeria.</p><p>These variations that exist between this study and other findings indicated that the prevalence and type of ESBL and their related genes varied from one geographical region to another [<xref ref-type="bibr" rid="scirp.102738-ref56">56</xref>]. Use and or misuse of antibiotics favour the emergence and spread of drug resistant bacteria globally [<xref ref-type="bibr" rid="scirp.102738-ref32">32</xref>]. This ever-increasing health and economic burden of antimicrobial resistance requires urgent action worldwide to control the situation. Identification of these ESBL-producing isolates and the knowledge of their rates of resistance are of prime importance for the selection of an appropriate antibiotics to be used in the treatment of infectious diseases especially empirically. The predominant factor for escalation of antibiotic resistance is the acquisition of plasmid encoding antibiotics resistance genes [<xref ref-type="bibr" rid="scirp.102738-ref53">53</xref>]. Such plasmid can be easily transferred from one organism to another and as such can incorporate genetic material coding for resistance against other antimicrobial classes [<xref ref-type="bibr" rid="scirp.102738-ref18">18</xref>]. Such antibiotic resistance has been reported by Falodun et al. [<xref ref-type="bibr" rid="scirp.102738-ref57">57</xref>], to be the outcome of the acquisition of resistance genes through genetic exchange and mutation as well as physiological mechanisms, such as the possession of specific proteins and efflux pump.</p></sec><sec id="s5"><title>5. Conclusion</title><p>In conclusion, by this study, we have demonstrated, for the first time, the molecular nature of the occurrence of ESBL among E. coli and K. pneumoniae isolates causing urinary tract infection in Gombe North-eastern Nigeria. The study showed the co-occurrence of ESBL-related genes in some of the studied isolates and is probably responsible for the observed high resistance to third generation cephalosporins in the locality. To avoid poor identification of antibiotic resistance and the attendant inappropriate antibiotic prescription which may in turn select for new resistance genes, it is recommended that the use of phenotypic tests for ESBL detection be accompanied by the more efficient PCR technique wherever possible. Such molecular methods of detecting ESBL related genes, though sensitive, fast and accurate, are relatively expensive and require specialized equipment and expertise and this should be bored in mind especially when being adopted by countries having many social issues competing for attention from the available limited resource.</p></sec><sec id="s6"><title>Acknowledgements</title><p>Authors are thankful to Dr. Yusha’u Muhammad of Microbiology Department, Bayero University Kano for providing the control strains.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>Yarima, A., Haroun, A.A., Bulus, T. and Manga, M.M. (2020) Occurrence of Extended Spectrum Beta Lactamase Encoding Genes among Urinary Pathogenic Escherichia coli and Klebsiella pneumoniae Isolates Obtained from a Tertiary Hospital in Gombe Nigeria. Journal of Biosciences and Medicines, 8, 42-55. https://doi.org/10.4236/jbm.2020.89004</p></sec></body><back><ref-list><title>References</title><ref id="scirp.102738-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Bradford, A. (2001) Extended-Spectrum Beta-Lactamases in the 21st Century: Characterization; Epidemiology; and Detection of This Important Resistance Threat. Clinical Microbiology Reviews, 14, 933-951. https://doi.org/10.1128/CMR.14.4.933-951.2001</mixed-citation></ref><ref id="scirp.102738-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Maria, C.D. (2013) Beta-Lactamases in Enterobacteriaceae in Broilers. GVO Drukkers and Vormgevers B. Ponsen &amp; Looijen, Wageningen.</mixed-citation></ref><ref id="scirp.102738-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Smet, A., Martel, A., Persoons, D., Dewulf, J., Heyndrickx, M., Catry, B., Herman, L., Haesebrouck, F. and Butaye, P. (2008) Diversity of Extended-Spectrum Beta Lactamases and Class C Beta Lactamases among Cloacal E. coli Isolates in Belgian Broiler Farms. Antimicrobial Agents and Chemotherapy, 52, 1238-1243. https://doi.org/10.1128/AAC.01285-07</mixed-citation></ref><ref id="scirp.102738-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Hackman, H.K. (2015) Phenotypic and Molecular Characterization of Extended Spectrum Beta Lactamase in Klebsiella pneumoniae and Escherichia coli Isolates in Accra, Ghana. PhD Dissertation, University of Ghana, Accra.</mixed-citation></ref><ref id="scirp.102738-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Pitout, J.D. and Laupland, K.B. (2008) Extended-Spectrum b-Lactamase Producing Enterobacteriaceae: An Emerging Public Health Concern. The Lancet Infectious Disease, 8, 159-166. https://doi.org/10.1016/S1473-3099(08)70041-0</mixed-citation></ref><ref id="scirp.102738-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Al-Muharrmi, Z., Rafay, A., Balkhair, A. and Jabri, A. (2008) Antibiotic Combination as Empirical Therapy for Extended Spectrum Beta-Lactamase. Oman Medical Journal, 23, 78-81.</mixed-citation></ref><ref id="scirp.102738-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Datta, N. and Kontomichalou, P. (1965) Penicillinase Synthesis Controlled by Infectious R Factors in Enterobacteriaceae. Nature, 208, 239-241. https://doi.org/10.1038/208239a0</mixed-citation></ref><ref id="scirp.102738-ref8"><label>8</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Pitton</surname><given-names> J.S. </given-names></name>,<etal>et al</etal>. (<year>1972</year>)<article-title>Mechanism of Bacterial Resistance to Antibiotics</article-title><source> Reviews Physiology</source><volume> 65</volume>,<fpage> 15</fpage>-<lpage>93</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.102738-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Matsumoto, Y., Ikeda, F., Kamimura, T., Yokota, Y. and Mine, Y. (1988) Novel Plasmid-Mediated Beta-Lactamase from E. coli That Inactivates Oxyimino-Cephalosporins. Antimicrobial Agents and Chemotherapy, 32, 1243-1246. https://doi.org/10.1128/AAC.32.8.1243</mixed-citation></ref><ref id="scirp.102738-ref10"><label>10</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Gupta</surname><given-names> V. </given-names></name>,<etal>et al</etal>. (<year>2007</year>)<article-title>An Update on Newer β-Lactamases</article-title><source> Indian Journal of Medical Research</source><volume> 126</volume>,<fpage> 417</fpage>-<lpage>427</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.102738-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Abrar, S., Hussaini, S., Ahmad Khan, R., Noor Ul Ain, Haidar, H. and Riaz, S. (2018) Prevalence of Extended Spectrum Beta Lactamase Producing Enterobacteriaceae: First Systematic Meta-Analysis Report from Pakistan. Antimicrobial Resistance and Infection Control, 7, 26. https://doi.org/10.1186/s13756-018-0309-1</mixed-citation></ref><ref id="scirp.102738-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Todar, K. (2008) Textbook of Bacteriology: Pathogenic E. coli. University of Wisconsin, Madison, 1-4.</mixed-citation></ref><ref id="scirp.102738-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Gholipour, A., Soleimani, N., Shokri, D., Mobasherizadeh, S., Kardi M. and Baradaran, A. (2014) Phenotypic and Molecular Characterization of Extended-Spectrum Beta Lactamase Produced by Escherichia coli, and Klebsiella pneumoniae Isolates in an Educational Hospital. Jundishapur Journal of Microbiology, 7, e11758. https://doi.org/10.5812/jjm.11758</mixed-citation></ref><ref id="scirp.102738-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">McGowan, J.E., Hill, H.A., Volkova, N.V., Lawton, R.M., Haber, M.J., Tenover, F.C. and Gaynes, R.P. (2002) Does Antimicrobial Resistance Cluster in Individual Hospitals? Journal of Infectious Disease, 186, 1362-1365. https://doi.org/10.1086/344323</mixed-citation></ref><ref id="scirp.102738-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Johann, D.D., Pitout, K. and Laupland, B. (2008) Extended Spectrum Beta-Lactamase-Producing Enterobacteriaceae: An Emerging Public-Health Concern. The Lancet Infectious Diseases, 8, 159-166. https://doi.org/10.1016/S1473-3099(08)70041-0</mixed-citation></ref><ref id="scirp.102738-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Yadav, K. and Prakash, S. (2017) Screening of ESBL Producing Multidrug Resistant E. coli from Urinary Tract Infection Suspected Cases in Southern Terai of Nepal. Journal of Infectious Diseases and Diagnosis, 2, Article ID: 100116. https://doi.org/10.4172/2576-389X.1000116</mixed-citation></ref><ref id="scirp.102738-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Kim, Y.H., Yang, E.M. and Kim, C.J. (2017) Urinary Tract Infection Caused by Community-Acquired Extended-Spectrum Lactamase-Producing Bacteria in Infants. Journal of Pediatria, 93, 260-266. https://doi.org/10.1016/j.jped.2016.06.009</mixed-citation></ref><ref id="scirp.102738-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">AL-Subol, I. and Nihad Youssef, N. (2015) Prevalence of CTX-M, TEM and SHV Beta-Lactamases in Clinical Isolates of Escherichia coli and Klebsiella pneumoniae Isolated from Aleppo University Hospitals, Aleppo, Syria. Archives of Clinical Infectious Disease, 10, e22540. https://doi.org/10.5812/archcid.22540</mixed-citation></ref><ref id="scirp.102738-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Federal Ministries of Agriculture, Environment and Health (FMAEH) (2017) Antimicrobial Use and Resistance in Nigeria. Situation Analysis and Recommendations.</mixed-citation></ref><ref id="scirp.102738-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Smeltzer, S.C., Bare, B.G., Cheever, K.H. and Hinkle, J.L. (2010) Brunner &amp; Suddarth’s Textbook of Medical-Surgical-Nursing. 12th Edition, Wolters/Lippincott Williams and Wilkins, Philadelphia.</mixed-citation></ref><ref id="scirp.102738-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Akram, M., Shaid, M. and Khan, A.U. (2007) Etiology of Antibiotic Resistance Patterns of Community-Acquired Urinary Tract Infection in JNMC Hospital Aligarh, India. Annals of Clinical Microbiology and Antimicrobial, 6, 4. https://doi.org/10.1186/1476-0711-6-4</mixed-citation></ref><ref id="scirp.102738-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Hoban, D.J., Nicolle, L.E., Hawser, S., Bouchillon, S. and Badal, R. (2011) Antibiotic Susceptibility of Global Inpatient Urinary Tracts Isolates of Escherichia coli: Result from the Study for Antimicrobial Resistance Trends (SMART) Program: 2009-2010. Diagnostic Microbial Infectious Diseases, 70, 507-511. https://doi.org/10.1016/j.diagmicrobio.2011.03.021</mixed-citation></ref><ref id="scirp.102738-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Wiegand, I., Geiss, H.K., Mack, D., Stürenburg, E. and Seifert, H. (2007) Detection of Extended-Spectrum Beta-Lactamases among Enterobacteriaceae by Use of Semi-Automated Microbiology Systems and Manual Detection Procedures. Journal of Clinical Microbiology, 45, 1167-1174. https://doi.org/10.1128/JCM.01988-06</mixed-citation></ref><ref id="scirp.102738-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Iregbu, K.C. and Nwajiobi-Princewill, P.I. (2013) Urinary Tract Infections in a Tertiary Hospital in Abuja, Nigeria. African Journal of Clinical and Experimental Microbiology, 14, 169-173. https://doi.org/10.4314/ajcem.v14i3.9</mixed-citation></ref><ref id="scirp.102738-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Tajick, M.A. (2006) Detection of Antibiotic Residue in Chicken Meat Using TLC. International Journal of Poultry Science, 5, 611-612. https://doi.org/10.3923/ijps.2006.611.612</mixed-citation></ref><ref id="scirp.102738-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Ahmed, B.M. and Kudi, A.A. (2003) Chronic Supperative Otitis Media in Gombe, Nigeria. Journal of Surgical Research, 5, 3-4. https://doi.org/10.4314/njsr.v5i3.12253</mixed-citation></ref><ref id="scirp.102738-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Aiyegoro, O.A., Igbinosa, O.O., Ogunmwonyi, I.N., Odjadjare, E.E., Igbinosa, O.E. and Okoh, A.I. (2007) Incidence of Urinary Tract Infections (UTI) among Children and Adolescents in Ile-Ife, Nigeria. African Journal of Microbiology Research, 1, 13-19.</mixed-citation></ref><ref id="scirp.102738-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Akortha, E.E. and Ibadin, O.K. (2008) Incidence and Antibiotic Susceptibility Pattern of Staphylococcus aureus amongst Patients with Urinary Tract Infection (UTI) in UBTH Benin City, Nigeria. African Journal of Biotechnology, 7, 1637-1640. https://doi.org/10.5897/AJB08.176</mixed-citation></ref><ref id="scirp.102738-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Dada-Adegbola, H.O. and Muili, K.A. (2010) Antibiotic Susceptibility Pattern of Urinary Tract Pathogens in Ibadan, Nigeria. African Journal of Medicine and Medical Science, 39, 173-179.</mixed-citation></ref><ref id="scirp.102738-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Shu’aibu, I., Hadiza, A.J., Yusha’u, M., Kabiru, M.Y., Ahmad, M.M., Lawal, G., Adamu, M.T. and Khairiyya, M. (2016) Assessment of Foods and Drinks for the Presence of Extended Spectrum Beta Lactamase (ESBL) Producing Bacteria in Gombe Metropolis, Nigeria. Indian Journal of Science and Technology, 9, 1. https://doi.org/10.17485/ijst/2016/v9i48/109624</mixed-citation></ref><ref id="scirp.102738-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">European Centre for Disease Prevention and Control and European Medicines Agency (ECDC/EMEA) Joint Technical Report (2012) The Bacterial Challenge: Time to React. Stockholm.</mixed-citation></ref><ref id="scirp.102738-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">WHO (2012) The Evolving Threat of Antimicrobial Resistance Options for Action. GPS Publishing, France.</mixed-citation></ref><ref id="scirp.102738-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Leylabadlo, H.E., Kafil, H.S., Yousefi, M., Aghazadeh, M. and Asgharzadeh, M. (2016) Persistent Infection with Metallo-Beta-Lactamase and Extended Spectrum Beta-Lactamase Producer Morganella morganii in a Patient with Urinary Tract Infection after Kidney Transplantation. Journal of Natural Science, Biology and Medicine, 7, 179-181. https://doi.org/10.4103/0976-9668.184707</mixed-citation></ref><ref id="scirp.102738-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Elsayed, N., Awad, A., Omar, M. and Desouki, D. (2015) Rapid Simultaneous Detection of AmpC and ESBLs among Enterobacteriaceae Using Mast D68C Detection Set and Possible Therapeutic Options. Egyptian Journal of Medical Microbiology, 24, 1-12. https://doi.org/10.12816/0024920</mixed-citation></ref><ref id="scirp.102738-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Clinical and Laboratory Standards Institute (2015) Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement M100-S25. Wayne.</mixed-citation></ref><ref id="scirp.102738-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Amiri, A., Firoozeh, F., Moniri, R. and Mohammad Zibaei, M. (2016) Prevalence of CTX-M-Type and PER Extended-Spectrum β-Lactamases among Klebsiella Species. Isolated from Clinical Specimens in the Teaching Hospital of Kashan, Iran. Iran Red Crescent Medical Journal, 18, e22260. https://doi.org/10.5812/ircmj.22260</mixed-citation></ref><ref id="scirp.102738-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Clinical and Laboratory Standards Institute (2014) Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Fourth Informational Supplement M100-S24. Wayne.</mixed-citation></ref><ref id="scirp.102738-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Kaur, M. and Aggarwal, A. (2013) Occurrence of the CTX-M, SHV and the TEM Genes among the Extended Spectrum Beta-Lactamase Producing Isolates of Enterobacteriaceae in a Tertiary Care Hospital of North India. Journal of Clinical and Diagnostic Research, 7, 642-645. https://doi.org/10.7860/JCDR/2013/5081.2872</mixed-citation></ref><ref id="scirp.102738-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Sedighi, M., Halajzadeh, M., Ramazanzadeh, R., Amirmozafari, N., Heidary, M. and Pirouzi, S. (2017) Molecular Detection of Beta-Lactamase and Integron Genes in Clinical Strains of Klebsiella pneumoniae by Multiplex Polymerase Chain Reaction. Revista da Sociedade Brasileira de Medicina Tropical, 50, 321-328. https://doi.org/10.1590/0037-8682-0001-2017</mixed-citation></ref><ref id="scirp.102738-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Thomson, K.S., Sanders, C.C. and Washington, J.A. (1991) High-Level Resistance to Cefotaxime and Ceftazidime in Klebsiella pneumoniae Isolates from Cleveland, Ohio. Antimicrobial Agents and Chemotherapy, 35, 1001-1003. https://doi.org/10.1128/AAC.35.5.1001</mixed-citation></ref><ref id="scirp.102738-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Yasmin, T. (2012) Prevalence of ESBL among Escherichia coli and Klebsiella spp. in a Tertiary Care Hospital and Molecular Detection of Important ESBL Producing Genes by Multiplex PCR. Master’s Thesis, Mymensingh Medical College, Dhaka University, Dhaka.</mixed-citation></ref><ref id="scirp.102738-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Chourasia, E., Pratap, S.K. and Keshav Kher, S. (2015) Extended Spectrum Beta Beta Lactamases in Clinical Isolates of Gram-Negative Bacilli in Ajman, United Arab Emirates. Gulf Medical Journal, 4, 14-21.</mixed-citation></ref><ref id="scirp.102738-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Farzana, R., Shamsuzzaman, S.M., Mamun, K.Z. and Shears, P. (2013) Antimicrobial Susceptibility Pattern of Extended Spectrum b-Lactamase Producing Gram-Negative Bacteria Isolated from Wound and Urine in a Tertiary Care Hospital, Dhaka City, Bangladesh. Southeast Asian Journal of Tropical Medicine and Public Health, 44, 96-103.</mixed-citation></ref><ref id="scirp.102738-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Lin, Y., Lu, M., Tang, H., Liu, H., Chen, C., Liu, K., Lin, C., Chiou, C., Chiang, M., Chen, C., Yi, C.Y. and Lai, Y. (2011) Assessment of Hypermucoviscosity as a Virulence Factor for Experimental Klebsiella pneumoniae Infections: Comparative Virulence Analysis with Hypermucoviscosity-Negative Strain. Bio Medical Central Microbiology, 11, Article No. 50. http://www.biomedcentral.com/1471-2180/11/50 https://doi.org/10.1186/1471-2180-11-50</mixed-citation></ref><ref id="scirp.102738-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Badri, A.M., Ibrahim, I.T., Mohamed, S.G., Garbi, M.G.I., Kabbashi, A.S. and Arbab, M.H. (2017) Prevalence of Extended Spectrum Beta Lactamase (ESBL) Producing Escherichia coli and Klebsiella pneumoniae Isolated from Raw Milk Samples in Al Jazirah State, Sudan. Journal of Molecular Biology, 7, Article ID: 1000201. https://doi.org/10.4172/2168-9547.1000201</mixed-citation></ref><ref id="scirp.102738-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Toma, C.L., Higa, Y., Nakasome, N., Chinen, I., Baschkier, A., Rivas, M. and Iwanaga, M. (2003) Multiplex PCR Assay for Identification of Human Diarrhea Genic Escherichia coli. Journal of Clinical Microbiology, 41, 2669-2671. https://doi.org/10.1128/JCM.41.6.2669-2671.2003</mixed-citation></ref><ref id="scirp.102738-ref47"><label>47</label><mixed-citation publication-type="other" xlink:type="simple">Rajalakshmi, S. (2017) Different Types of PCR Techniques and Its Applications. International Journal of Pharmaceutical, Chemical and Biological Sciences, 7, 285-292.</mixed-citation></ref><ref id="scirp.102738-ref48"><label>48</label><mixed-citation publication-type="other" xlink:type="simple">Louie, M., Louie, L. and Simor, A.E. (2000) The Role of DNA Amplification Technology in the Diagnosis of Infection Diseases. Canadian Medical Association Journal, 163, 301-309.</mixed-citation></ref><ref id="scirp.102738-ref49"><label>49</label><mixed-citation publication-type="other" xlink:type="simple">Elnifro, E.M., Ashshi, A.M., Cooper, R.J. and Klapper, P.E. (2000) Multiplex PCR: Optimization and Application in Diagnostic Virology. Clinical Microbiology Reviews, 13, 559-570. https://doi.org/10.1128/CMR.13.4.559</mixed-citation></ref><ref id="scirp.102738-ref50"><label>50</label><mixed-citation publication-type="other" xlink:type="simple">Lal, P., Kapil, A., Das, B.K. and Sood, S. (2007) Occurrence of TEM and SHV Gene in Extended Spectrum Beta Lactamases (ESBLS) Producing Klebsiella sp. Isolated from a Tertiary Care Hospital. Indian Journal of Medical Research, 125, 173-178.</mixed-citation></ref><ref id="scirp.102738-ref51"><label>51</label><mixed-citation publication-type="other" xlink:type="simple">Zongo, K., MetourDabire, A., Compaore, L.G., Sanou, I., Sangare, L, Simpore, J. and Zeba, B. (2015) First Detection of bla TEM, SHV and CTX-M among Gram Negative Bacilli Exhibited Extended Spectrum Beta Lactamses Phenotype Isolated at University Hospital Center, Yalgado Ouedrago Ouagadougou, Burkina faso. African Journal of Biotechnology, 14, 1174-1180. https://doi.org/10.5897/AJB2014.13908</mixed-citation></ref><ref id="scirp.102738-ref52"><label>52</label><mixed-citation publication-type="other" xlink:type="simple">Al-Agamy, M.H., Atef, M., Shibl, M., Abdelkader, F. and Tawfik, F. (2009) Prevalence and Molecular Characterization of Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae in Riyadh, Saudi Arabia. Annals of Saudi Medicine, 29, 253-257. https://doi.org/10.4103/0256-4947.55306</mixed-citation></ref><ref id="scirp.102738-ref53"><label>53</label><mixed-citation publication-type="other" xlink:type="simple">Shahid, M., Anuradha, S., Farrukh, S., Mohammad, R., Abida, M., Indu, S. and Haris, M.K. (2011) blaCTX-M, blaTEM, and blaSHV in Enterobacteriaceae from North-Indian Tertiary Hospital: High Occurrence of Combination Genes. Asian Pacific Journal of Tropical Medicine, 4, 101-105. https://doi.org/10.1016/S1995-7645(11)60046-1</mixed-citation></ref><ref id="scirp.102738-ref54"><label>54</label><mixed-citation publication-type="other" xlink:type="simple">Ahmed, O., Omar, A., Asghar, A. and Elhassan, M. (2013) Prevalence of TEM, SHV AND CTX-M Genes in Escherichia coli and Klebsiella Species Urinary Isolates from Sudan with Confirmed ESBL Phenotype. Life Science Journal, 10, 191-195.</mixed-citation></ref><ref id="scirp.102738-ref55"><label>55</label><mixed-citation publication-type="other" xlink:type="simple">Yahaya, M., Galadima, B.G., Sambo, B.Z. and Aaron, O.A. (2016) Characterization of Extended Spectrum Beta-Lactamase from Escherichia coli and Klebsiella Species from North Eastern Nigeria. Journal of Clinical and Diagnostic Research, 10, 7-10.</mixed-citation></ref><ref id="scirp.102738-ref56"><label>56</label><mixed-citation publication-type="other" xlink:type="simple">Chauhan, S., Singh Mahawal, B. and Ramola, D.C. (2015) Extended Spectrum β-Lactamases in Urinary Isolates of Escherichia coli-Prevalence and Susceptibility Pattern at a Tertiary Care Hospital. International Journal of Research in Medical Sciences, 3, 1622-1626. https://doi.org/10.18203/2320-6012.ijrms20150240</mixed-citation></ref><ref id="scirp.102738-ref57"><label>57</label><mixed-citation publication-type="other" xlink:type="simple">Falodun, O.I., Morakinyo, Y.M. and Fagade, O.E. (2018) Determination of Water Quality and Detection of Extended Spectrum Beta-Lactamase Producing Gram-Negative Bacteria in Selected Rivers Located in Ibadan, Nigeria. Jordan Journal of Biological Sciences, 11, 107-112. https://doi.org/10.1080/00207233.2019.1705044</mixed-citation></ref></ref-list></back></article>