<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJAS</journal-id><journal-title-group><journal-title>Open Journal of Animal Sciences</journal-title></journal-title-group><issn pub-type="epub">2161-7597</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojas.2020.104042</article-id><article-id pub-id-type="publisher-id">OJAS-102205</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Oleic acid Stimulates the Formation of Adipocyte-Like Cells from Bovine Satellite Cells via &lt;i&gt;G-Protein Coupled Receptor 43&lt;/i&gt; and &lt;i&gt;CCAAT/Enhancer-Binding Protein Beta&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>J.</surname><given-names>Kim</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>K.</surname><given-names>Chung</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>B.</surname><given-names>J. Johnson</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>L.</surname><given-names>K. Fuerniss</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib></contrib-group><aff id="aff3"><addr-line>Department of Animal and Food Science, Texas Tech University, Lubbock, TX, USA</addr-line></aff><aff id="aff2"><addr-line>Department of Beef Science, Korean National College of Agriculture and Fisheries, Jeollabuk-do, South Korea</addr-line></aff><aff id="aff1"><addr-line>Department of Animal Science &amp;amp; Food Science and Human Nutrition, Michigan State University, East Lansing, MI, USA</addr-line></aff><pub-date pub-type="epub"><day>15</day><month>08</month><year>2020</year></pub-date><volume>10</volume><issue>04</issue><fpage>649</fpage><lpage>664</lpage><history><date date-type="received"><day>10,</day>	<month>July</month>	<year>2020</year></date><date date-type="rev-recd"><day>14,</day>	<month>August</month>	<year>2020</year>	</date><date date-type="accepted"><day>17,</day>	<month>August</month>	<year>2020</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Numerous physiological and pathological processes are controlled by free fatty acids, which act as signaling molecules in mammals. We hypothesized that oleic acid (Ole) might stimulate the formation of satellite-cell-derived intramuscular adipose tissue. The role of Ole as a ligand of 
  <em>G-protein-coupled receptor 43</em> (
  <em>GPR4</em>3) was previously identified. Thus, the objective of the current study was to determine the effect of Ole on 
  <em>GPR43</em> and factors related to the adipogenic differentiation of bovine satellite cells (BSC). Treatments of 100 μM and 500 μM Ole tended to induce greater (P &lt; 0.10) mRNA expression of 
  <em>CCAAT/enhancer-binding protein β</em> (
  <em>C/EBPβ</em>) compared to all other doses. The mRNA abundance of peroxisome proliferator-activated receptor γ (
  <em>PPARγ</em>) was not altered (
  <em>P</em> &gt; 0.10) by treatment. The addition of 100 μM and 500 μM of Ole upregulated (
  <em>P</em> &lt; 0.05) 
  <em>GPR43</em> mRNA expression. Protein level of GPR43 was increased (
  <em>P</em> &lt; 0.05) by 100 μM of Ole treatments. Addition of Ole to BSC cultures induced transformation of myogenic cells into adipocyte-like cells that formed cytoplasmic lipid droplets. Increased expression of
  <em> C/EBPβ</em> in response to Ole might suppress myogenic differentiation. After the treatment of cells with Ole, increased expression of GPR43 could lead to phosphorylation of 5’ AMP-activated protein kinase α (AMPKα). Altogether, the results indicated that increased Ole might stimulate adipose tissue accumulation within the skeletal muscle of cattle by promoting adipogenic differentiation and activation of GPR43 in satellite cells.
 
</p></abstract><kwd-group><kwd>Bovine Satellite Cells</kwd><kwd> GPR43</kwd><kwd> Intramuscular Adipose Tissue</kwd><kwd> Oleic Acid</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The biology of intramuscular (IM) adipose tissue is widely discussed in meat-producing animals due to its economic value [<xref ref-type="bibr" rid="scirp.102205-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref4">4</xref>]. Beef steaks with greater IM fat deposition are recognized by consumers in the U.S. as more palatable [<xref ref-type="bibr" rid="scirp.102205-ref5">5</xref>]. Adipose tissue within the skeletal muscle is derived from the various lineages. During fetal growth, progenitor cells of IM fat, muscle fibers, satellite cells, and fibroblasts are derived from a shared pool of mesenchymal stem cells [<xref ref-type="bibr" rid="scirp.102205-ref6">6</xref>]. These mononucleated myogenic cells play a pivotal role in postnatal muscle hypertrophy, and muscle regeneration by mesenchymal stem cell differentiation has been demonstrated in various animal models [<xref ref-type="bibr" rid="scirp.102205-ref7">7</xref>]. Since myonuclei of skeletal muscle are post-mitotic, satellite cells (the primary stem cells in adult skeletal muscle) are responsible for postnatal muscle hypertrophy and muscle regeneration [<xref ref-type="bibr" rid="scirp.102205-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref10">10</xref>]. In addition to the role as myogenic progenitor cells, satellite cells are multipotent [<xref ref-type="bibr" rid="scirp.102205-ref11">11</xref>]. This is supported by Asakura, Rudnicki and Komaki [<xref ref-type="bibr" rid="scirp.102205-ref12">12</xref>], who reported that satellite cells have the ability to differentiate into adipogenic and osteogenic cell types. Additionally, Joe, Yi, Natarajan, Le Grand, So, Wang, Rudnicki and Rossi [<xref ref-type="bibr" rid="scirp.102205-ref13">13</xref>] suggested that the subpopulation of the mononuclear mesenchymal cells called fibro/adipogenic progenitors within myogenic progenitors is possibly the primary source of fibroblasts and adipocytes in adult tissue.</p><p>The mechanism by which cells gain adipocyte-like characteristics has been investigated in livestock species, specifically with respect to increasing IM adipose tissue. The lipid filling process could be partially controlled by G-protein-coupled receptor 43 (GPR43), an adipocyte-specific membrane receptor that is activated by short and long-chain fatty acids; the receptor may regulate lipid accumulation by intracellular signals that limit lipolysis [<xref ref-type="bibr" rid="scirp.102205-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref16">16</xref>]. It is also reported that oleic acid (Ole), one of the most abundant unsaturated fatty acids in the animal body, could upregulate GPR43 expression in cultured bovine intramuscular adipocytes [<xref ref-type="bibr" rid="scirp.102205-ref14">14</xref>]. Therefore, the objective of the study was to determine the effect of Ole, a long-chain fatty acid, on adipogenic differentiation, lipid-filing, and GPR43 activity in bovine satellite cells.</p></sec><sec id="s2"><title>2. Materials and Methods</title><p>Bovine Satellite Cell Isolation and Culture</p><p>The isolation and cultivation of bovine satellite cells were conducted as previously reported by Johnson, Halstead, White, Hathaway, DiCostanzo and Dayton [<xref ref-type="bibr" rid="scirp.102205-ref17">17</xref>] and Kim, Wellmann, Smith and Johnson [<xref ref-type="bibr" rid="scirp.102205-ref18">18</xref>]. Bovine satellite cells were isolated from 3 16-month-old crossbred steers (predominantly Angus, 474.5 &#177; 50.2 kg). Cattle were harvested under USDA inspection at the Gordon W. Davis Meat Sciences Lab at Texas Tech University (Lubbock, TX). Approximately 800g of semimembranosus muscle tissue was collected upon harvest and immediately transported to the laboratory.</p><p>Satellite cell isolation procedures were then conducted under sterile conditions. Connective tissue, blood vessels, and adipose tissue were dissected from the muscle samples before passing the muscle pieces through a sterile meat grinder. The ground muscle was aliquoted into sterile tubes and incubated in Earl’s Balanced Salt Solution (Sigma Aldrich, St. Louis, MO) with 0.1% Pronase (Calbiochem, LaJolla, CA) for 1 hour at 37˚C, mixing the samples every 10 min. After incubation, the mixture was centrifuged at 1500 &#215; g for 4 min at room temperature. The resulting pellet was suspended in phosphate-buffered saline (PBS; Sigma Aldrich), and the suspension was centrifuged at 500 &#215; g for 10 min at room temperature. The supernatant was collected and centrifuged at 1500 &#215; g for 10 min at room temperature to pellet the mononucleated cells. The resulting mononucleated-cell preparation was suspended in warm (37˚C) Dubecco’s Modified Eagle’s medium (DMEM; Gibco, Waltham, MA) supplemented with 10% Fetal Bovine Serum (Thermo Fisher science, Waltham, MA), and 1 &#215; Antibiotic-Antimycotic (Gibco). Cells were incubated at 37˚C with a humidified atmosphere of 95% air and 5% CO<sub>2</sub>. Once cells are reached 80% to 90% confluence, the growth medium was replaced with differentiation media. The differentiation cocktail was composed of DMEM supplemented with 2% horse serum, 10 μg/mL insulin, 10 μg/mL hydrocortisone, 10 μM ciglitizone, and 1 &#215; Antibiotic-Antimycotic. Treatments of 0, 1, 10, 100, or 500 μM of Ole (Sigma Aldrich) were included in the differentiation cocktail. An additional treatment of 100 μM of stearic acid (St, Sigma Aldrich) was evaluated to compare the effect of saturated fatty acid (St) and unsaturated fatty acid (Ole) on lipid filling. After 96 h of incubation, cells were harvested and prepared for mRNA and protein analysis.</p><p>Fluorescence Microscopy</p><p>Isolated satellite cells were grown on three-well microscopy glass slides (Cat. #: 80381, Ibidi, Fitchburg, WI, USA) for 96 h after inducing differentiation. Slides were fixed with 4% paraformaldehyde (Thermo Fisher Scientific, USA) for 10 min at room temperature. In order to prevent nonspecific background staining, fixed cells were incubated in 1% bovine serum albumin for 30 min. Fixed cells were incubated with BODIPY (493/503, Thermo Fisher Scientific) and diluted in 1 mg/ml of dimethyl sulfoxide (DMSO, Sigma-Aldrich) for 30 min to stain intracellular neutral lipid green. Glass slides were then rinsed 3 times with PBS for 5 min at room temperature. Fixed cells were then incubated with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) for 5 min to stain nuclei blue.</p><p>In order to stain GPR43, satellite cells were grown on three-well microscopy glass slides (Ibidi, Fitchburg) for 24 h after inducing differentiation. Slides were then fixed and incubated overnight at 4˚C in the anti-GPR 43 primary antibodies (mouse polyclonal, ab12571, Abcam, Cambridge, MA). After 3 rinses with PBS for 5 min, samples were dark-incubated for 30 min at 25˚C in the secondary antibody (1:1000 goat anti-mouse, IgG1, Alexa-Fluor 633 (Invitrogen). Slides were then incubated with 1 &#181;g/mL of 4’6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) for 1 min, rinsed twice briefly in PBS, and then covered with AquaMount mounting media (Lerner Laboratories, Pittsburgh, PA) and thin glass coverslips (VWR International). The slides were cured at 4˚C for 24 h in the dark. The slides were imaged at 200&#215; using an inverted fluorescence microscope (Nikon Eclipse, Ti-E; Nikon Instruments Inc., Mellville, NY) equipped with a UV light source (Nikon Intensilight Inc.; C-HGFIE).</p><p>RNA Isolation and Real-Time Quantitative PCR</p><p>The protocol for the isolation of mRNA from bovine satellite cells was conducted as described by Chomczynski and Sacchi [<xref ref-type="bibr" rid="scirp.102205-ref19">19</xref>]. Cellular mRNA was isolated with acid guanidinium thiocyanate-phenol-chloroform extraction reagent (TRI reagent; Sigma, St. Louis, MO). The concentration and purity of RNA were determined by absorbance at 260 nm and 280 nm using a NanoDrop 1000 (NanoDrop products, Wilmington, DE). An acceptable range of 1.76 to 2.05 was established for the 260/280 ratio. Genomic DNA removal and cDNA synthesis were performed using the QuantiTect reverse transcription kit (Qiagen, Germantown, MD) according to manufacturer recommendations. Real-time quantitative polymerase chain reaction (RT-qPCR; 7900HT Real-Time PCR System, Applied Biosystems, Foster City, CA) was used to measure the quantity of the genes of interest (<xref ref-type="table" rid="table1">Table 1</xref>) relative to the quantity of ribosomal protein subunit 9 (RPS9) mRNA in total RNA. Since the expression of RPS9 has previously not differed across bovine tissues [<xref ref-type="bibr" rid="scirp.102205-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref21">21</xref>], RPS9 was used as the endogenous control to normalize gene expression. Measurement of the relative quantity of the cDNA of interest was carried out using TAMRA PCR Master Mix (Applied Biosystems, Foster City, CA). Assays were performed using a 7900HT Real-Time PCR System (Applied Biosystems) using thermal cycling parameters recommended by the manufacturer (40 cycles of 15 s at 95˚C and one min at 60˚C). Titration of mRNA primers against increasing amounts of cDNA gave linear responses with slopes between −2.8 and −3.0. RQ values based on ΔΔCT were analyzed by the RQ manager (Applied Biosystems).</p><p>Western Blotting</p><p>Cultured satellite cells were isolated with 200 μl of ice-cold buffer containing M-PER (Fisher Scientific, Fair Lawn, NJ), a protease inhibitor (Roche, Switzerland), and 2 mM Na<sub>3</sub>VO<sub>4</sub> (Fisher Scientific). Cell homogenate was mixed with an equal volume of 2&#215; standard SDS sample loading buffer (Invitrogen). The concentration of samples was determined with Pierce BCA protein assay following the manufacturer’s guidance (Thermo Fisher Science) using a NanoDrop 1000 (NanoDrop products), with absorbance at 562 nm. Samples were loaded onto Novex 4% - 12% Bis-Tris gels (Invitrogen, Grand Island, NY) and separated by gel electrophoresis for 35 min. Proteins were then transferred to a nitrocellulose membrane (Invitrogen). Membranes were then incubated overnight</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Sequence for bovine PCR primers and TaqMan probes for adipogenic genes<sup>1</sup></title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Item</th><th align="center" valign="middle" >Sequence (5’ to 3’)</th></tr></thead><tr><td align="center" valign="middle"  colspan="2"  >AMPKα (accession no. NM_001109802)</td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >ACCATTCTTGGTTGCTGAAACTC</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >CACCTTGGTGTTTGGATTTCTG</td></tr><tr><td align="center" valign="middle" >TaqMan Probe</td><td align="center" valign="middle" >6FAM-CAGGGCGCGCCATACCCTTG-TAMRA</td></tr><tr><td align="center" valign="middle"  colspan="2"  >CEBPβ (accession no. NM_176788)</td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >CCAGAAGAAGGTGGAGCAACTG</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >TCGGGCAGCGTCTTGAAC</td></tr><tr><td align="center" valign="middle" >TaqMan Probe</td><td align="center" valign="middle" >6FAM-CGCGAGGTCAGCACCCTGC-TAMRA</td></tr><tr><td align="center" valign="middle"  colspan="2"  >GPR43 (accession no. FJ562212)</td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >GGCTTTCCCCGTGCAGTA</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >ATCAGAGCAGCCATCACTCCAT</td></tr><tr><td align="center" valign="middle" >TaqMan Probe</td><td align="center" valign="middle" >6FAM-AAGCTGTCCCGCCGGCCC-TAMRA</td></tr><tr><td align="center" valign="middle"  colspan="2"  >PPARγ (accession no. NM_181024)</td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >ATCTGCTGCAAGCCTTGGA</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >TGGAGCAGCTTGGCAAAGA</td></tr><tr><td align="center" valign="middle" >TaqMan Probe</td><td align="center" valign="middle" >6FAM-CTGAACCACCCCGAGTCCTCCCAG-TAMRA</td></tr><tr><td align="center" valign="middle"  colspan="2"  >RPS9 (accession no. DT860044)</td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >GAGCTGGGTTTGTCGCAAAA</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >GGTCGAGGCGGGACTTCT</td></tr><tr><td align="center" valign="middle" >TaqMan Probe</td><td align="center" valign="middle" >6FAM-ATGTGACCCCGCGGAGACCCTTC-TAMRA</td></tr><tr><td align="center" valign="middle"  colspan="2"  >SCD (accession no. AB075020)</td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >TGCCCACCACAAGTTTTCAG</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >GCCAACCCACGTGAGAGAAG</td></tr><tr><td align="center" valign="middle" >TaqMan Probe</td><td align="center" valign="middle" >6FAM-CCGACCCCCACAATTCCCG-TAMRA</td></tr></tbody></table></table-wrap><p><sup>1</sup>AMPKα (adenosine monophosphate-activated protein kinase-α); C/EBPβ (CCAAT/enhancer-binding protein β); GPR43 (G protein couple receptor 43); PPARγ (Peroxisme proliferated activate receptor γ); RPS9 (ribosomal protein subunit 9); SCD (stearoyl CoA desaturase).</p><p>.</p><p>at 4˚C at a dilution of 1:1000 of the following rabbit polyclonal primary antibodies: anti-AMPKα (Cell Signaling, Danvers, MA), anti-phosphorylated AMPKα (Cell Signaling), anti-GPR43 (ab12571, Abcam, Cambridge, MA), anti-GPR41 (ab103718, Abcam), and anti-GPR120 (ab230869, Abcam). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH; epr16891, Abcam) served as the loading control.</p><p>Membranes were then incubated with a secondary antibody, Alexa-Fluor 633, goat anti-rabbit, at 1:2000 dilution for 2 h at room temperature. After 3 washes, membranes were visualized using an enhanced chemiluminescent substrate, Western blotting reagents (Amersham Bioscience), and exposure to film (MR, Kodak, Rochester, NY). The density of bands was quantified using Imager Scanner II and ImageQuant TL software. Tissue lysates of all groups were run in a single gel to reduce variation. Band density was normalized by GAPDH content.</p><p>Statistical Analysis</p><p>Cells used in this experiment were isolated from three steers; all six treatments were applied to cells from each steer, and the resulting cultures were for both mRNA and protein analysis. Data were analyzed using the MIXED procedure (PROC MIXED) of SAS (SAS Institute, Cary, NC) as appropriate for completely randomized designs. When a significant preliminary F-test was detected, the least-square means of each Ole dose were separated and denoted to be different using the pairwise comparison option of SAS. An α level of 0.05 was used to determine significance; tendencies were identified by P-value between 0.05 and 0.10.</p></sec><sec id="s3"><title>3. Results and Discussion</title><p>Morphological Changes</p><p>It has been reported that satellite cells have the ability to differentiate into adipocytes in the presence of adipogenic inducers in cattle [<xref ref-type="bibr" rid="scirp.102205-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref23">23</xref>], mice [<xref ref-type="bibr" rid="scirp.102205-ref12">12</xref>], swine [<xref ref-type="bibr" rid="scirp.102205-ref24">24</xref>], and humans [<xref ref-type="bibr" rid="scirp.102205-ref25">25</xref>]. In our current study, the major morphological change observed during adipogenic differentiation was the accumulation of lipid droplets within cells (<xref ref-type="fig" rid="fig1">Figure 1</xref>). After 24 h of incubation with the myogenic differentiation media (2% horse serum in DMEM) supplemented with adipogenic differentiation factors (insulin and ciglitizone), the succession of primary myotubes was observed. After myotube formation, treatments of Ole (100 &#181;M and 500 &#181;M) resulted in the creation of lipid droplets within the myotubes (approximately 96 h after differentiation); visually, Ole promoted accumulation of neutral lipid (<xref ref-type="fig" rid="fig2">Figure 2</xref>). Given the morphological changes, the results suggested that satellite cells treated with Ole were committed to exhibiting adipogenic characteristics. This result is in agreement with Asakura, Rudnicki and Komaki [<xref ref-type="bibr" rid="scirp.102205-ref12">12</xref>], who demonstrated that myoblasts were able to transdifferentiate into adipocytes with differentiation media containing myogenic and adipogenic inducers. Teboul, Gaillard, Staccini, Inadera, Amri and Grimaldi [<xref ref-type="bibr" rid="scirp.102205-ref26">26</xref>] also observed a homogenous monolayer of lipid-containing cells when C2C12N cells were exposed to rosiglitazone, an adipogenic differentiation factor. Starkey, Yamamoto, Yamamoto and Goldhamer [<xref ref-type="bibr" rid="scirp.102205-ref27">27</xref>] suggested that satellite cells accumulated cytoplasmic lipid while expressing myogenic genes under the adipogenesis-inducing conditions applied to murine primary cell cultures. Using bovine satellite cells [<xref ref-type="bibr" rid="scirp.102205-ref28">28</xref>] found ciglitizone and Ole treatment increased the accumulation of triglyceride and lipid droplet area. Based on the morphological characteristics observed in the present study, adipogenic induction of muscle satellite cells might generate lipid droplets or promote lipid infiltration from supplementary lipid sources while simultaneously forming muscle fibers.</p><p>mRNA Gene Expression of Adipogenic and Myogenic Factors</p><p>Further analysis by RT-qPCR partially indicated that muscle cells simultaneously express adipogenic genes and myogenic genes (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The addition of 100 μM and 500 μM Ole tended to increase (P &lt; 0.10) mRNA gene expression of C/EBPβ compared to all other doses. C/EBPβ belongs to a family of basic leucine zipper transcription factors and acts as a commitment factor during adipogenic differentiation [<xref ref-type="bibr" rid="scirp.102205-ref29">29</xref>]. As adipogenic differentiation proceeds, the expression</p><p>of C/EBPβ follows the expression of PPARγ [<xref ref-type="bibr" rid="scirp.102205-ref30">30</xref>]. However, the mRNA expression of PPARγ was not altered (P &gt; 0.10) by treatment. This is partially in agreement with the findings of Chung and Johnson [<xref ref-type="bibr" rid="scirp.102205-ref23">23</xref>] that bovine satellite cells, in the presence of melengestrol acetate in the adipogenic cocktail with 100 μM of Ole acid, increased mRNA expression of C/EBPβ and PPARγ. Another study conducted using primary satellite cells from Yanbian yellow cattle found that Ole treatment with an absence of PPAR activator inducers, such as thiazolidinedione (TZD), upregulated gene expression of C/EBPβ and C/EBPα [<xref ref-type="bibr" rid="scirp.102205-ref28">28</xref>]. The results of the current study concur with the findings of Teboul, Gaillard, Staccini, Inadera, Amri and Grimaldi [<xref ref-type="bibr" rid="scirp.102205-ref26">26</xref>] that mice satellite cell cultures supplemented with TZD and fatty acid formed adipogenic-like cells without upregulating PPARγ and C/EBPα.</p><p>While C/EBPβ has a pivotal role in adipose cells, the protein is also detected in other cell types, including the liver, smooth muscle, and skeletal muscle [<xref ref-type="bibr" rid="scirp.102205-ref31">31</xref>]. Potentially, C/EBPβ expression by skeletal muscle cells suppresses the expression of myogenic factors. Lala-Tabbert, AlSudais, Marchildon, Fu and Wiper-Bergeron [<xref ref-type="bibr" rid="scirp.102205-ref32">32</xref>] demonstrated that downregulation of C/EBPβ resulted in larger muscle fiber cross-sectional area and improved muscle repair. Marchildon, Lala, Li, St-Louis, Lamothe, Keller and Wiper-Bergeron [<xref ref-type="bibr" rid="scirp.102205-ref33">33</xref>] suggested that C/EBPβ inhibited MyoD protein expression and myogenesis in both primary myoblasts and C2C12 cells. However, results of the present study indicated that mRNA expression of myogenin was increased by treatment of 100 μM of Ole while C/EBPβ tended to be upregulated by both 100 μM and 500 μM of Ole (P &lt; 0.10). Myogenin is one of four myogenic regulatory factors that bind to regulatory regions of DNA in order to regulate transcription during myogenic differentiation of satellite cells [<xref ref-type="bibr" rid="scirp.102205-ref34">34</xref>]. Expression of myogenin has previously been identified during myogenic differentiation and in the formation of myofibers; in adult animals, however, myogenin was not identified in the maintenance or development of satellite cells [<xref ref-type="bibr" rid="scirp.102205-ref35">35</xref>]. In the present study, bovine satellite cells likely retained some myogenic characteristics, while adipogenic differentiation was progressing. Adipogenic gene expression, lipid droplet formation, myogenic gene expression, and myofiber formation occurred simultaneously.</p><p>Contrary to the C/EBPβ expression, mRNA abundance of stearoyl CoA desaturase (SCD) was downregulated (P &lt; 0.05) by high levels of Ole treatments (100 and 500 &#181;M). Stearoyl CoA desaturase is an enzyme which catalyzes the formation of monounsaturated fatty acids, specifically Ole, from saturated fatty acid such as St [<xref ref-type="bibr" rid="scirp.102205-ref36">36</xref>]. The addition of unsaturated fatty acids to various cell types seems to reduce the expression of SCD consistently. Jones, Maher, Banz, Zemel, Whelan, Smith and Moustaid [<xref ref-type="bibr" rid="scirp.102205-ref37">37</xref>] reported that the addition of polyunsaturated fatty acid reduced mRNA expression of SCD in 3T3-L1 adipocytes. Others also detected similar results in bovine subcutaneous and IM adipocytes; linoleic and α-linoleic acid treatment decreased SCD expression [<xref ref-type="bibr" rid="scirp.102205-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref38">38</xref>]. This may be due to the feedback inhibition by monounsaturated fatty acids. The expression of SCD might be inhibited or controlled by the product of its catalysis, especially Ole.</p><p>G-protein Coupled Receptor 43</p><p>G-protein coupled receptor 43 (GPR43) is expressed in mammalian tissues including adipose tissues [<xref ref-type="bibr" rid="scirp.102205-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref39">39</xref>], inflammatory cells [<xref ref-type="bibr" rid="scirp.102205-ref40">40</xref>], gastrointestinal tract tissue [<xref ref-type="bibr" rid="scirp.102205-ref40">40</xref>], and myogenic-derived satellite cells [<xref ref-type="bibr" rid="scirp.102205-ref23">23</xref>]. The primary activator of GPR43 is known to be short-chain fatty acids. Acetic and propionic acid bind to GPR43 with high affinity and regulate intracellular signaling pathways [<xref ref-type="bibr" rid="scirp.102205-ref41">41</xref>]. Previous findings have demonstrated that select long-chain fatty acids could also act as ligands of GPR43 in bovine adipose and satellite cells [<xref ref-type="bibr" rid="scirp.102205-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.102205-ref23">23</xref>]. The current study confirmed previous results demonstrating that Ole treatment increased mRNA expression and protein level of GPR43 (Figures 3-5). The addition of 100 μM and 500 μM of Ole increased (P &lt; 0.05) mRNA gene expression of GPR43 and protein level (P &lt; 0.05; <xref ref-type="fig" rid="fig3">Figure 3</xref> and <xref ref-type="fig" rid="fig4">Figure 4</xref>).</p><p>The role of GPR43 in lipid accumulation of adipose tissue has long been discussed from a diagnostic perspective. In essence, the expression of GPR43 is closely related to body fat mass and is highly regulated by nutrient intake in various animal models. Bjursell, Admyre, G&#246;ransson, Marley, Smith, Oscarsson and Bohlooly-Y [<xref ref-type="bibr" rid="scirp.102205-ref42">42</xref>] reported that GPR43-deficient mice fed a high-fat diet reduced fat mass but increased muscle mass. [<xref ref-type="bibr" rid="scirp.102205-ref43">43</xref>], Canfora, Jocken and Blaak [<xref ref-type="bibr" rid="scirp.102205-ref44">44</xref>] reported that GPR43 suppressed intracellular lipolysis via decreased phosphorylation of hormone-sensitive lipase, leading to increased PPARγ-mediated adipogenesis. This resulted in increased triglyceride accumulation in adipose tissue and reduced lipolysis. From these factors, it appears that lipid filling of bovine muscle cells might be regulated through the GPR43 pathway. In the current study, satellite cells incubated with Ole expressed both myogenic and adipogenic characteristics. In other words, cells accumulated lipid droplets within the multinucleated muscle fibers. Since adipogenic gene expression was limited, especially PPARγ, the role of GPR43 might be critical during the lipid filling process. Satellite cells have been considered a precursor of IM adipose tissue due to their multipotent characteristics and adipogenic potential. However, this lipid filling phenomenon seems to be attributed to lipid infiltration of formed muscle fibers, not because of adipogenic-differentiation of mononucleated satellite cells.</p><p>Fatty Acid Sources and GPR43</p><p>In order to investigate the effect of other sources of long-chain fatty acids on GPR43 expression, St was also tested with BSC. The addition of St did not alter (P &gt; 0.10) the protein level of GPR43, and only Ole increased (P &lt; 0.05) GPR43 level (<xref ref-type="fig" rid="fig6">Figure 6</xref>). This was also confirmed by Chung, Smith, Choi and Johnson [<xref ref-type="bibr" rid="scirp.102205-ref14">14</xref>] who reported that Ole increased mRNA expression of GPR43 in bovine IM preadipocytes but did not have an influence on subcutaneous preadipocytes; however, the addition of St decreased GPR43 expression in both bovine IM and subcutaneous preadipocytes.</p><p>Oleic Acid and Phosphorylation of AMPKα</p><p>The addition of 100 μM of Ole increased (P &lt; 0.05) protein level of phosphorylated AMPKα (<xref ref-type="fig" rid="fig4">Figure 4</xref>). This might be the consequence of activated GPR43. Supplied long-chain fatty acids have previously assimilated intracellularly and were converted to acetyl-CoA for incorporation into the tricarboxylic acid cycle [<xref ref-type="bibr" rid="scirp.102205-ref45">45</xref>]. As AMP in the cytosol is increased during the activity of acetyl-CoA, the increase in AMP/ATP ratio results in the phosphorylation of AMPK in the skeletal muscle [<xref ref-type="bibr" rid="scirp.102205-ref44">44</xref>]. In the early stages of AMPK activation, fatty acid oxidation is</p><p>inhibited, but prolonged AMPK activation eventually stimulates fatty acid oxidation [<xref ref-type="bibr" rid="scirp.102205-ref46">46</xref>].</p></sec><sec id="s4"><title>4. Conclusion</title><p>The addition of Ole in BSC cultures induced intramyocellular lipid accumulation in skeletal muscle cells derived from satellite cells. The expression of C/EBPβ, one of the early markers of adipogenic differentiation, was observed in response to high levels of Ole supplementation, but myogenin was simultaneously upregulated by 100 &#181;M of Ole treatment. This result could indicate that muscle cells containing intramyocellular lipid express muscle-like characteristics along with characteristics of adipose cells. The addition of Ole also increased GPR43 and seemingly activated AMPKα; however, the long-term response to Ole is unclear. It is likely that long-chain fatty acids act as potential ligands for GPR43 and control the intracellular signaling pathways promoting lipid filling. This finding indicates that intramuscular lipid accumulation could be induced in steers by long-chain fatty acids. Future studies should examine the effect of long-chain fatty acids on lipid metabolism of bovine cells for short- and long-term periods.</p></sec><sec id="s5"><title>Funded</title><p>This project was funded in part by the Gordon W. Davis Regent’s Chair Endowment at Texas Tech University.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s7"><title>Cite this paper</title><p>Kim, J., Chung, K., Fuerniss, L.K. and Johnson, B.J. (2020) Oleic acid Stimulates the Formation of Adipocyte-Like Cells from Bovine Satellite Cells via G-Protein Coupled Receptor 43 and CCAAT/Enhancer-Binding Protein Beta. Open Journal of Animal Sciences, 10, 649-664. https://doi.org/10.4236/ojas.2020.104042</p></sec><sec id="s8"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.102205-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">[1]Pethick, D., Harper, G., Hocquette, J. and Wang, Y. (2006) Marbling Biology—What Do We Know about Getting Fat into Muscle. Proceedings of Australian Beef—The Leader, Armidale, 7-8 March 2006, 103-110.</mixed-citation></ref><ref id="scirp.102205-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Smith, S.B. and Lunt, D.K. (Year) Marbling: Management of Cattle to Maximize the Deposition of Intramuscular Adipose Tissue.</mixed-citation></ref><ref id="scirp.102205-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Smith, S., Kawachi, H., Choi, C., Choi, C., Wu, G. and Sawyer, J. (2009) Cellular Regulation of Bovine Intramuscular Adipose Tissue Development and Composition. Journal of Animal Science, 87, E72-E82. https://doi.org/10.2527/jas.2008-1340</mixed-citation></ref><ref id="scirp.102205-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Smith, S. and Johnson, B. (2014) Marbling: Management of Cattle to Maximize the Deposition of Intramuscular Adipose Tissue.</mixed-citation></ref><ref id="scirp.102205-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Savell, J. and Cross, H. (1988) The Role of Fat in the Palatability of Beef, Pork, and Lamb. In: Designing Foods: Animal Product Options in the Marketplace, National Academy Press, Washington DC, 345-355.</mixed-citation></ref><ref id="scirp.102205-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Hausman, G.J., Basu, U., Du, M., Fernyhough-Culver, M. and Dodson, M.V. (2014) Intermuscular and Intramuscular Adipose Tissues: Bad vs. Good Adipose Tissues. Adipocyte, 3, 242-255. https://doi.org/10.4161/adip.28546</mixed-citation></ref><ref id="scirp.102205-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Schultz, E. and McCormick, K.M. (1994) Skeletal Muscle Satellite Cells. Reviews of Physiology, Biochemistry and Pharmacology, 123, 213-257. https://doi.org/10.1007/BFb0030904</mixed-citation></ref><ref id="scirp.102205-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Luz, M., Marques, M. and Santo Neto, H. (2002) Impaired Regeneration of Dystrophin-Deficient Muscle Fibers Is Caused by Exhaustion of Myogenic Cells. Brazilian Journal of Medical and Biological Research, 35, 691-695. https://doi.org/10.1590/S0100-879X2002000600009</mixed-citation></ref><ref id="scirp.102205-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Charge, S.B. and Rudnicki, M.A. (2004) Cellular and Molecular Regulation of Muscle Regeneration. Physiological Reviews, 84, 209-238. https://doi.org/10.1152/physrev.00019.2003</mixed-citation></ref><ref id="scirp.102205-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Dhawan, J. and Rando, T.A. (2005) Stem Cells in Postnatal Myogenesis: Molecular Mechanisms of Satellite Cell Quiescence, Activation and Replenishment. Trends in Cell Biology, 15, 666-673. https://doi.org/10.1016/j.tcb.2005.10.007</mixed-citation></ref><ref id="scirp.102205-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Brack, A.S., Conboy, M.J., Roy, S., Lee, M., Kuo, C.J., Keller, C. and Rando, T.A. (2007) Increased WNT Signaling during Aging Alters Muscle Stem Cell Fate and Increases Fibrosis. Science, 317, 807-810. https://doi.org/10.1126/science.1144090</mixed-citation></ref><ref id="scirp.102205-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Asakura, A., Rudnicki, M.A. and Komaki, M. (2001) Muscle Satellite Cells Are Multipotential Stem Cells That Exhibit Myogenic, Osteogenic, and Adipogenic Differentiation. Differentiation, 68, 245-253. https://doi.org/10.1046/j.1432-0436.2001.680412.x</mixed-citation></ref><ref id="scirp.102205-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Joe, A.W., Yi, L., Natarajan, A., Le Grand, F., So, L., Wang, J., Rudnicki, M.A. and Rossi, F.M. (2010) Muscle Injury Activates Resident Fibro/Adipogenic Progenitors That Facilitate Myogenesis. Nature Cell Biology, 12, 153. https://doi.org/10.1038/ncb2015</mixed-citation></ref><ref id="scirp.102205-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Chung, K., Smith, S., Choi, S. and Johnson, B. (2016) Oleic Acid Enhances G Protein Coupled Receptor 43 Expression in Bovine Intramuscular Adipocytes But Not in Subcutaneous Adipocytes. Journal of Animal Science, 94, 1875-1883. https://doi.org/10.2527/jas.2015-0010</mixed-citation></ref><ref id="scirp.102205-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Hong, Y.H., Nishimura, Y., Hishikawa, D., Tsuzuki, H., Miyahara, H., Gotoh, C., Choi, K.C., Feng, D.D., Chen, C., Lee, H.G., Katoh, K., Roh, S.G. and Sasaki, S. (2005) Acetate and Propionate Short Chain Fatty Acids Stimulate Adipogenesis via GPCR43. Endocrinology, 146, 5092-5099. https://doi.org/10.1210/en.2005-0545</mixed-citation></ref><ref id="scirp.102205-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Ge, H., Li, X., Weiszmann, J., Wang, P., Baribault, H., Chen, J.L., Tian, H. and Li, Y. (2008) Activation of G Protein-Coupled Receptor 43 in Adipocytes Leads to Inhibition of Lipolysis and Suppression of Plasma Free Fatty Acids. Endocrinology, 149, 4519-4526. https://doi.org/10.1210/en.2008-0059</mixed-citation></ref><ref id="scirp.102205-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Johnson, B., Halstead, N., White, M., Hathaway, M., DiCostanzo, A. and Dayton, W. (1998) Activation State of Muscle Satellite Cells Isolated from Steers Implanted with a Combined Trenbolone Acetate and Estradiol Implant. Journal of Animal Science, 76, 2779-2786. https://doi.org/10.2527/1998.76112779x</mixed-citation></ref><ref id="scirp.102205-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Kim, J., Wellmann, K.B., Smith, Z.K. and Johnson, B.J. (2018) All-Trans Retinoic Acid Increases the Expression of Oxidative Myosin Heavy Chain through the PPARδ Pathway in Bovine Muscle Cells Derived from Satellite Cells. Journal of Animal Science, 96, 2763-2776. https://doi.org/10.1093/jas/sky155</mixed-citation></ref><ref id="scirp.102205-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Chomczynski, P. and Sacchi, N. (2006) The Single-Step Method of RNA Isolation by Acid Guanidinium Thiocyanate-Phenol-Chloroform Extraction: Twenty-Something Years on. Nature Protocols, 1, 581. https://doi.org/10.1038/nprot.2006.83</mixed-citation></ref><ref id="scirp.102205-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Bionaz, M. and Loor, J.J. (2007) Identification of Reference Genes for Quantitative Real-Time PCR in the Bovine Mammary Gland during the Lactation Cycle. Physiological Genomics, 29, 312-319. https://doi.org/10.1152/physiolgenomics.00223.2006</mixed-citation></ref><ref id="scirp.102205-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Janovick-Guretzky, N., Dann, H., Carlson, D., Murphy, M., Loor, J. and Drackley, J. (2007) Housekeeping Gene Expression in Bovine Liver Is Affected by Physiological State, Feed Intake, and Dietary Treatment. Journal of Dairy Science, 90, 2246-2252. https://doi.org/10.3168/jds.2006-640</mixed-citation></ref><ref id="scirp.102205-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Kook, S., Choi, K., Son, Y., Lee, K., Hwang, I., Lee, H., Chang, J., Choi, I. and Lee, J. (2006) Satellite Cells Isolated from Adult Hanwoo Muscle Can Proliferate and Differentiate into Myoblasts and Adipose-Like Cells. Molecules and Cells, 22, 239.</mixed-citation></ref><ref id="scirp.102205-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Chung, K.Y. and Johnson, B.J. (2009) Melengestrol Acetate Enhances Adipogenic Gene Expression in Cultured Muscle-Derived Cells. Journal of Animal Science, 87, 3897-3904. https://doi.org/10.2527/jas.2008-1645</mixed-citation></ref><ref id="scirp.102205-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Singh, N., Chae, H., Hwang, I., Yoo, Y., Ahn, C., Lee, S., Lee, H., Park, H. and Chung, H. (2007) Transdifferentiation of Porcine Satellite Cells to Adipoblasts with Ciglitizone. Journal of Animal Science, 85, 1126-1135. https://doi.org/10.2527/jas.2006-524</mixed-citation></ref><ref id="scirp.102205-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Agley, C.C., Rowlerson, A.M., Velloso, C.P., Lazarus, N.R. and Harridge, S.D. (2013) Human Skeletal Muscle Fibroblasts, But Not Myogenic Cells, Readily Undergo Adipogenic Differentiation. Journal of Cell Science, 126, 5610-5625. https://doi.org/10.1242/jcs.132563</mixed-citation></ref><ref id="scirp.102205-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Teboul, L., Gaillard, D., Staccini, L., Inadera, H., Amri, E.-Z. and Grimaldi, P.A. (1995) Thiazolidinediones and Fatty Acids Convert Myogenic Cells into Adipose-Like Cells. Journal of Biological Chemistry, 270, 28183-28187. https://doi.org/10.1074/jbc.270.47.28183</mixed-citation></ref><ref id="scirp.102205-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Starkey, J.D., Yamamoto, M., Yamamoto, S. and Goldhamer, D.J. (2011) Skeletal Muscle Satellite Cells Are Committed to Myogenesis and Do Not Spontaneously Adopt Nonmyogenic Fates. Journal of Histochemistry &amp; Cytochemistry, 59, 33-46. https://doi.org/10.1369/jhc.2010.956995</mixed-citation></ref><ref id="scirp.102205-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Li, X.Z., Yan, Y., Zhang, J.F., Sun, J.F., Sun, B., Yan, C.G., Choi, S.H., Johnson, B.J., Kim, J.K. and Smith, S.B. (2019) Oleic Acid in the Absence of a PPARγ Agonist Increases Adipogenic Gene Expression in Bovine Muscle Satellite Cells. Journal of Animal Science, 97, 4114-4123. https://doi.org/10.1093/jas/skz269</mixed-citation></ref><ref id="scirp.102205-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Rosen, E.D., Walkey, C.J., Puigserver, P. and Spiegelman, B.M. (2000) Transcriptional Regulation of Adipogenesis. Genes &amp; Development, 14, 1293-1307.</mixed-citation></ref><ref id="scirp.102205-ref30"><label>30</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Tan</surname><given-names> M. </given-names></name>,<etal>et al</etal>. (<year>2000</year>)<article-title>Current Treatment of Insulin Resistance in Type 2 Diabetes Mellitus</article-title><source> International Journal of Clinical Practice</source><volume> 113</volume>,<fpage> 54</fpage>-<lpage>62</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.102205-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Friedman, A. (2007) Transcriptional Control of Granulocyte and Monocyte Development. Oncogene, 26, 6816-6828. https://doi.org/10.1038/sj.onc.1210764</mixed-citation></ref><ref id="scirp.102205-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Lala-Tabbert, N., AlSudais, H., Marchildon, F., Fu, D. and Wiper-Bergeron, N. (2016) CCAAT/Enhancer Binding Protein β Is Required for Satellite Cell Self-Renewal. Skeletal Muscle, 6, 40. https://doi.org/10.1186/s13395-016-0112-8</mixed-citation></ref><ref id="scirp.102205-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Marchildon, F., Lala, N., Li, G., St-Louis, C., Lamothe, D., Keller, C. and Wiper-Bergeron, N. (2012) CCAAT/Enhancer Binding Protein Beta Is Expressed in Satellite Cells and Controls Myogenesis. Stem Cells, 30, 2619-2630. https://doi.org/10.1002/stem.1248</mixed-citation></ref><ref id="scirp.102205-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Blais, A., Tsikitis, M., Acosta-Alvear, D., Sharan, R., Kluger, Y. and Dynlacht, B.D. (2005) An Initial Blueprint for Myogenic Differentiation. Genes &amp; Development, 19, 553-569. https://doi.org/10.1101/gad.1281105</mixed-citation></ref><ref id="scirp.102205-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Gayraud-Morel, B., Chrétien, F., Flamant, P., Gomès, D., Zammit, P.S. and Tajbakhsh, S. (2007) A Role for the Myogenic Determination Gene Myf5 in Adult Regenerative Myogenesis. Developmental Biology, 312, 13-28. https://doi.org/10.1016/j.ydbio.2007.08.059</mixed-citation></ref><ref id="scirp.102205-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Smith, S.B., Gill, C.A., Lunt, D.K. and Brooks, M.A. (2009) Regulation of Fat and Fatty Acid Composition in Beef Cattle. Asian-Australasian Journal of Animal Sciences, 22, 1225-1233. https://doi.org/10.5713/ajas.2009.r.10</mixed-citation></ref><ref id="scirp.102205-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Jones, B.H., Maher, M.A., Banz, W.J., Zemel, M.B., Whelan, J., Smith, P.J. and Moustaid, N. (1996) Adipose Tissue Stearoyl-CoA Desaturase mRNA Is Increased by Obesity and Decreased by Polyunsaturated Fatty Acids. American Journal of Physiology-Endocrinology and Metabolism, 271, E44-E49. https://doi.org/10.1152/ajpendo.1996.271.1.E44</mixed-citation></ref><ref id="scirp.102205-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Choi, S.H., Chung, K.Y., Johnson, B.J., Go, G.W., Kim, K.H., Choi, C.W. and Smith, S.B. (2013) Co-Culture of Bovine Muscle Satellite Cells with Preadipocytes Increases PPARγ and C/EBPβ Gene Expression in Differentiated Myoblasts and Increases GPR43 Gene Expression in Adipocytes. The Journal of Nutritional Biochemistry, 24, 539-543. https://doi.org/10.1016/j.jnutbio.2012.01.015</mixed-citation></ref><ref id="scirp.102205-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Hu, J., Kyrou, I., Tan, B.K., Dimitriadis, G.K., Ramanjaneya, M., Tripathi, G., Patel, V., James, S., Kawan, M., Chen, J. and Randeva, H.S. (2016) Short-Chain Fatty Acid Acetate Stimulates Adipogenesis and Mitochondrial Biogenesis via GPR43 in Brown Adipocytes. Endocrinology, 157, 1881-1894. https://doi.org/10.1210/en.2015-1944</mixed-citation></ref><ref id="scirp.102205-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Maslowski, K.M., Vieira, A.T., Ng, A., Kranich, J., Sierro, F., Yu, D., Schilter, H.C., Rolph, M.S., Mackay, F. and Artis, D. (2009) Regulation of Inflammatory Responses by Gut Microbiota and Chemoattractant Receptor GPR43. Nature, 461, 1282-1286. https://doi.org/10.1038/nature08530</mixed-citation></ref><ref id="scirp.102205-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Bindels, L.B., Dewulf, E.M. and Delzenne, N.M. (2013) GPR43/FFA2: Physiopathological Relevance and Therapeutic Prospects. Trends in Pharmacological Sciences, 34, 226-232. https://doi.org/10.1016/j.tips.2013.02.002</mixed-citation></ref><ref id="scirp.102205-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Bjursell, M., Admyre, T., G&amp;#246;ransson, M., Marley, A.E., Smith, D.M., Oscarsson, J. and Bohlooly-Y, M. (2011) Improved Glucose Control and Reduced Body Fat Mass in Free Fatty Acid Receptor 2-Deficient Mice Fed a High-Fat Diet. American Journal of Physiology-Endocrinology and Metabolism, 300, E211-E220. https://doi.org/10.1152/ajpendo.00229.2010</mixed-citation></ref><ref id="scirp.102205-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Dewulf, E.M., Ge, Q., Bindels, L.B., Sohet, F.M., Cani, P.D., Brichard, S.M. and Delzenne, N.M. (2013) Evaluation of the Relationship between GPR43 and Adiposity in Human. Nutrition &amp; Metabolism, 10, 1-5. https://doi.org/10.1186/1743-7075-10-11</mixed-citation></ref><ref id="scirp.102205-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Canfora, E.E., Jocken, J.W. and Blaak, E.E. (2015) Short-Chain Fatty Acids in Control of Body Weight and Insulin Sensitivity. Nature Reviews Endocrinology, 11, 577-591. https://doi.org/10.1038/nrendo.2015.128</mixed-citation></ref><ref id="scirp.102205-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Maruta, H., Yoshimura, Y., Araki, A., Kimoto, M., Takahashi, Y. and Yamashita, H. (2016) Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells. PLoS ONE, 11, e0158055. https://doi.org/10.1371/journal.pone.0158055</mixed-citation></ref><ref id="scirp.102205-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Winder, W., Holmes, B., Rubink, D., Jensen, E., Chen, M. and Holloszy, J. (2000) Activation of AMP-Activated Protein Kinase Increases Mitochondrial Enzymes in Skeletal Muscle. Journal of Applied Physiology, 88, 2219-2226. https://doi.org/10.1152/jappl.2000.88.6.2219</mixed-citation></ref></ref-list></back></article>