<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJAS</journal-id><journal-title-group><journal-title>Open Journal of Animal Sciences</journal-title></journal-title-group><issn pub-type="epub">2161-7597</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojas.2020.103025</article-id><article-id pub-id-type="publisher-id">OJAS-100997</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Interactive Effects of Zinc and Zilpaterol Hydrochloride on Bovine &lt;i&gt;β&lt;/i&gt;-Adrenergic Receptors
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>J.</surname><given-names>E. Hergenreder</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>T.</surname><given-names>L. Harris</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>J.</surname><given-names>O. Baggerman</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>A.</surname><given-names>D. Hosford</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>M.</surname><given-names>Branine</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>B.</surname><given-names>J. Johnson</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Animal and Food Sciences, Texas Tech University, Lubbock, TX, USA</addr-line></aff><aff id="aff2"><addr-line>Zinpro Corporation, Eden Prairie, MN, USA</addr-line></aff><pub-date pub-type="epub"><day>18</day><month>05</month><year>2020</year></pub-date><volume>10</volume><issue>03</issue><fpage>402</fpage><lpage>413</lpage><history><date date-type="received"><day>17,</day>	<month>April</month>	<year>2020</year></date><date date-type="rev-recd"><day>15,</day>	<month>June</month>	<year>2020</year>	</date><date date-type="accepted"><day>18,</day>	<month>June</month>	<year>2020</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  The objective of this study was to determine if the addition of zinc (Zn) in combination with zilpaterol HCL (ZH) affected the interaction of ZH with the beta2-adrenergic receptor (
  
  β-AR) by altering cAMP production, gene expression, and protein abundance in cultured skeletal muscle cells. Cultures of muscle bovine satellite cells were established and treated at 120 h with: 1) 0 μM Zn/zilpaterol hydrochloride (ZH; 
  CON); 2) 0 μM Zn/10 μM ZH (
  ZH); 3) 1 μM Zn from Zn chloride/0 μM ZH (
  Zn); 4) 1 μM Zn from Zn chloride/10 μM ZH (
  ZN/ZH) in differentiation media for an additional 0, 6, 24, 48 and 96 h. Protein and mRNA were isolated and quantified at 24 and 96 h, and cAMP was measured at 0, 6, 24, 48 and 96 h. At 0, 24, 48 and 96 h, no differences (
  P &gt; 0.05) were detected in cAMP production. At 6 h, Zn cells had the greatest concentration of cAMP (
  
  P &lt; 0.05) compared to ZH treatments. No differences (
  P &gt; 0.05) were detected in mRNA abundance at 24 h. At 96 h, 0 μM Zn/10 μM ZH cells had an increased abundance of myosin heavy chain (MHC)-I mRNA (
  P &lt; 0.05) compared to CON. Furthermore, ZH had a greater abundance of MHC-IIX mRNA (
  P &lt; 0.05) and a tendency for a greater abundance of IGF-1 mRNA (
  
  P &lt; 0.15) compared to CON and ZN/ZH. No differences (
  P &gt; 0.05) were detected in the protein abundance of 
  β1AR and the 
  β2AR. These results indicated Zn and ZH in combination did not have an additive effect on
  <em> β</em>2-AR function as indicated by cAMP concentrations.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;β&lt;/i&gt;-Adrenergic Receptor</kwd><kwd> Zilpaterol Hydrochloride</kwd><kwd> Zinc</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Beta-adrenergic agonists (β-AA) are commonly used in the beef cattle feedlot industry to improve growth performance and carcass characteristics through increased protein synthesis and decreased protein degradation [<xref ref-type="bibr" rid="scirp.100997-ref1">1</xref>]. Beta-adrenergic agonists have also been reported to increase lipolysis and decrease lipogenesis in adipose tissue [<xref ref-type="bibr" rid="scirp.100997-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref3">3</xref>]. These β-AA work through an interaction with the beta-adrenergic receptors (β-AR) [<xref ref-type="bibr" rid="scirp.100997-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref5">5</xref>]. Zilpaterol HCl (ZH), a β-AA used in cattle, primarily binds with the β<sub>2</sub>-AR, which is the most predominant β-AR found in cattle muscle and adipose tissue [<xref ref-type="bibr" rid="scirp.100997-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref2">2</xref>]. Via a secondary messenger signal cascade event, cyclic adenosine monophosphate (cAMP) is activated thereby resulting in protein accretion and lipid catabolism [<xref ref-type="bibr" rid="scirp.100997-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref3">3</xref>].</p><p>Overstimulation of the β-ARs by β-AA has been reported to result in receptor desensitization [<xref ref-type="bibr" rid="scirp.100997-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref7">7</xref>]. Receptor desensitization results in a down regulation of adenylate cyclase catalytic activity resulting in a reduction of cAMP synthesis [<xref ref-type="bibr" rid="scirp.100997-ref8">8</xref>]. When the β-ARs become desensitized, they are sequestered within an intracellular vesicle, thus losing the ability to induce signal transduction [<xref ref-type="bibr" rid="scirp.100997-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref7">7</xref>].</p><p>Research has shown that the β<sub>2</sub>-AR potentially have multiple allosteric binding sites for zinc (Zn) [<xref ref-type="bibr" rid="scirp.100997-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref9">9</xref>]. Swaminath, Lee and Kobilka [<xref ref-type="bibr" rid="scirp.100997-ref10">10</xref>], suggested there are two main binding sites for Zn on the β-AR; one affects the agonist’s ability to bind to the receptor, while the other affects the antagonist’s ability to bind to the receptor thus increasing cAMP production. Zinc also regulates adenylate cyclase (AC) and cyclic nucleotide phosphodiesterase (PDE) which are involved in the synthesis and degradation of cAMP after the β-AR is activated [<xref ref-type="bibr" rid="scirp.100997-ref11">11</xref>]. Several studies have reported that the catalytic activity of AC is inhibited by Zn; however, the mechanism responsible for this phenomenon is still unknown [<xref ref-type="bibr" rid="scirp.100997-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.100997-ref14">14</xref>]. von B&#252;low, Rink and Haase [<xref ref-type="bibr" rid="scirp.100997-ref15">15</xref>] reported the addition of Zn to cellular lysate inhibits cyclic nucleotide degradation, signifying increases in cellular Zn will block PDE activity.</p><p>Little is known about how the combination of ZH and Zn might influence the β-AR’s ability to produce cAMP, and its regulation of mRNA and protein synthesis. Thus, the objective of the present research was to determine if utilizing Zn in combination with ZH would affect the downstream signal transduction of cascade events commonly associated with β-AA thus altering cAMP activation, and mRNA and protein abundance.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Experimental Design and Treatments</title><p>This experiment was conducted as a 2 &#215; 2 factorial, and each replicate (n = 4) was plated and cultured simultaneously. These experiments were conducted in 2017 in the Department of Animal and Food Sciences at Texas Tech University. The cells were treated with a laboratory grade Zn chloride (Acros Organics, Fisher Scientific, Fair Lawn, NJ), ZH, or a combination of the two. Each well was randomly assigned to one of four treatments: 1) 0 &#181;M Zn/0 &#181;M ZH (CON); 2) 0 &#181;M Zn/10 &#181;M ZH (ZH); 3) 1 &#181;M Zn/0 &#181;M ZH (Zn); 4) 1 &#181;M Zn/10 &#181;M ZH (ZN/ZH).</p></sec><sec id="s2_2"><title>2.2. Satellite Cell Isolation</title><p>Satellite cell isolation was performed following procedures outlined by Johnson et al. [<xref ref-type="bibr" rid="scirp.100997-ref6">6</xref>]. Muscle tissue samples were extracted from the semimembranosus muscle of market age cattle at harvest. Tissue was then subjected to satellite cell extraction procedures, to isolate satellite cells from muscle tissue. Under a sterile hood, adipose and connective tissue were removed from muscle. The muscle was ground through a sterile grinder sterilized in 70% ethanol for 24 h prior to use. Ground muscle was then incubated in a solution consisting of 0.1% pronase (Calbiochem, La Jolla, CA) and Earl’s Balanced Salt Solution (EBSS; Sigma, St. Louis, MO) for 1 h at 37˚C. At 10 min intervals, the samples were shaken vigorously. Following incubation, differential centrifugation at 1500 &#215; g for 4 min at 25˚C was performed on the sample. The resulting supernatant was removed, and the pellet suspended in phosphate buffered saline (PBS; Invitrogen, Grand Island, NY; 140 mM NaCl, 3 mM Na<sub>2</sub>-H-PO<sub>4</sub>). The resulting pellet was then centrifuged at 500 &#215; g for 10 min at 25˚C. The supernatant was transferred into another container and centrifuged at 15,000 &#215; g for 10 min at 25˚C to form a pellet consisting of mononucleated cells. The differential centrifugation and the PBS wash steps were repeated twice. Total mononucleated cells were then suspended in cold Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen, Grand Island, NY) containing 10% fetal bovine serum (FBS; Invitrogen) and 10% dimethylsulfoxide (DMSO; Sigma). The cell solution was then aliquoted into 1.8 mL nunc cryo tube vials (Fisher Scientific). Cells were then placed in a −80˚C freezer for 24 h and stored in liquid nitrogen until needed.</p></sec><sec id="s2_3"><title>2.3. Satellite Cell Culture</title><p>Bovine satellite cells were cultured in 6-well plates (RNA and Protein analysis) or 24-well plates (cAMP analysis). Plates were coated with reduced factor matrigel (Matrigel; BD Biosciences, Bedford, MA) at least 1 h prior to plating cells and kept at 37˚C. Cells were plated and placed in a 37˚C incubator for 24 h in 10% Fetal Bovine Serum (FBS; GIBCO<sup>&#210;</sup>; Invitrogen)/DMEM-3X antibiotic antimycotic (Invitrogen) 0.3X gentamycin (Sigma) media. Cells were rinsed and allowed to proliferate for 120 h in 10% FBS/DMEM-3X antibiotic antimycotic 0.3X gentamycin at 37˚C. At 120 h media was changed from proliferation to differentiation media (3% Horse Serum; GIBCO<sup>&#210;</sup>; Invitrogen)/DMEM-3X antibiotic antimycotic 0.3X gentamycin). The treatment substrates were added to the differentiation media. Cells that were designated for mRNA and protein quantification were treated and incubated for either 24 or 96 h in differentiation media, while cells destined for cAMP analysis were treated and incubated for a total of 0, 6, 24, 48, or 96 h in differentiation media.</p></sec><sec id="s2_4"><title>2.4. RNA Isolation and Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction</title><p>At 24 or 96 h of treatment, cells from 6-well plates were harvested for mRNA analysis. The cells were rinsed 3 times in PBS, and total mRNA isolated with ice-cold buffer containing TRI Reagent<sup>&#210;</sup> (Sigma, St. Louis, MO). Approximately 200 mL of TRI Reagent<sup>&#210;</sup> were added to each well, and then incubated for 5 min at 25˚C. The wells were then scraped to ensure release of all cells from the bottom of the well. Homogenate was pipetted into a microcentrifuge tube, 100 &#181;L of chloroform were added, vortexed for 30 s and incubated for 5 min at 25˚C. The sample was then centrifuged at 15,000 &#215; g for 15 min that causing the samples to separate into 3 layers. The top supernatant layer was pipetted off and placed into a new microcentrifuge tube. Ice cold isopropyl alcohol (250 μL) was added to the supernatant, shaken, and incubated for 10 min at 25˚C. Samples were centrifuged at 15,000 &#215; g for 10 min. The supernatant was poured off, the RNA pellet at the bottom of each tube air dried, and 500 &#181;L of 75% ethanol was added to each tube to rinse and suspend the RNA pellet. Samples were then placed in a −80˚C freezer until needed (no longer than 3 months). Samples were removed from the freezer and thawed on ice and centrifuged at 250 &#215; g for 10 min, ethanol poured off, and the pellet air dried. Nuclease free water (30 μL) was added to dissolve the RNA pellet. The concentration of RNA was determined with a spectrophotometer at an absorbance of 260 nm using a NanoDrop 1000 (NanoDrop products, Wilmington, DE). Samples were treated with DNAse to remove any DNA contaminants using a DNA-free kit (Life Technologies). The RNA was then subjected to reverse-transcription to produce cDNA. The resulting cDNA was used for real-time quantitative reverse transcription-PCR (RT-qPCR) to measure the abundance of AMP-activated protein kinase alpha (AMPKα), beta-1 adrenergic receptor (β1AR), beta-2 adrenergic receptor (β2AR), insulin-like growth factor-I (IGF-I), myosin heavy chain (MHC)-I, MHC-IIA, MHC-IIX, C-enhancer binding protein beta (CEBPβ), G-protein coupled receptor 43 (GPR43), peroxisome proliferator-activated receptor gamma (PPARγ), and stearoyl-CoA desaturase (SCD) mRNA relative to the abundance of ribosomal protein subunit 9 (RPS9) mRNA in total RNA isolated from cells. Bovine primers and probes for AMPKα, β1AR, β2AR, IGF-I, MHC-I, MHC-IIA, MHC-IIX, GPR43, SCD, CEBPβ, and PPARγ are presented in <xref ref-type="table" rid="table1">Table 1</xref>. Assays were performed in the GeneAmp 7900HT Sequence Detection System (Applied Biosystems, Life Technologies) using thermal cycling parameters recommended by the manufacturer (40 cycles of 15 s at 95˚C and 1 min at 60˚C).</p></sec><sec id="s2_5"><title>2.5. Protein Extraction and Western Blots</title><p>At 24 or 96 h of treatment, cells from 6-well plates were harvested for protein analysis. The cells were rinsed 3 times with PBS. Protein from cells was isolated with ice-cold buffer containing mammalian protein extraction reagent (M-PER; Fisher Scientific, Fair Lawn, NJ), protein inhibitor (Roche, Branchburg, NJ), and 2 mM Na<sub>3</sub>VO<sub>4</sub> (Fisher Scientific). Approximately 500 &#181;L of M-PER was added to each well and incubated for 5 min at 25˚C while shaking. The wells were then scraped to ensure all cells were released from the bottom of the well. Samples</p><table-wrap-group id="1"><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Sequence of bovine-specific PCR primers and TaqMan probes to be used for determination of expression of mRNA of AMPKα, MHC-I, MHC-IIA, MHC-IIX, IGF-I, β1AR, β2AR, β3AR, CEBPβ, GPR43, GPR41, Glut4, PPARγ, SCD and RPS9*</title></caption><table-wrap id="1_1"><table><tbody><thead><tr><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Sequence (5’ to 3’)</th></tr></thead><tr><td align="center" valign="middle" >AMPkα (accession #NM_001109802)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >ACCATTCTTGGTTGCTGAAACTC</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >CACCTTGGTGTTTGGATTTCTG</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-CAGGGCGCGCCATACCCTTG-TAMRA</td></tr><tr><td align="center" valign="middle" >MHC-I (accession #AB059400)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >CCCACTTCTCCCTGATCCACTAC</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >TTGAGCGGGTCTTTGTTTTTCT</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-CCGGCACGGTGGACTACAACATCATAG-TAMRA</td></tr><tr><td align="center" valign="middle" >MHC-IIA (accession #AB059398)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >GCAATGTGGAAACGATCTCTAAAGC</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >GCTGCTGCTCCTCCTCCTG</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-TCTGGAGGACCAAGTGAACGAGCTGA-TAMRA</td></tr><tr><td align="center" valign="middle" >MHC-IIX (accession #AB059399)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >GGCCCACTTCTCCCTCATTC</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >CCGACCACCGTCTCATTCA</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-CGGGCACTGTGGACTACAACATTACT-TAMRA</td></tr><tr><td align="center" valign="middle" >IGF-I (accession #X15726)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >TGTGATTTCTTGAAGCAGGTGAA</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >AGCACAGGGCCAGATAGAAGAG</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-GCCCATCACATCCTCCTCGCA-TAMRA</td></tr><tr><td align="center" valign="middle" >β1AR (accession #AF188187)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >GTGGGACCGCTGGGAGTAT</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >TGACACACAGGGTCTCAATGC</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-CTCCTTCTTCTGCGAGCTCTGGACCTC-TAMRA</td></tr><tr><td align="center" valign="middle" >β2AR (accession #NM_174231)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >CAGCTCCAGAAGATCGACAAATC</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >CTGCTCCACTTGACTGACGTTT</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-AGGGCCGCTTCCATGCCC-TAMRA</td></tr><tr><td align="center" valign="middle" >CEBPβ (accession #NM_176788)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >CCAGAAGAAGGTGGAGCAACTG</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >TCGGGCAGCGTCTTGAAC</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-CGCGAGGTCAGCACCCTGC-TAMRA</td></tr><tr><td align="center" valign="middle" >GPR43 (accession #FJ562212)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >GGCTTTCCCCGTGCAGTA</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >ATCAGAGCAGCCATCACTCCAT</td></tr></tbody></table></table-wrap><table-wrap id="1_2"><table><tbody><thead><tr><th align="center" valign="middle" >TaqMan probe</th><th align="center" valign="middle" >6FAM-AAGCTGTCCCGCCGGCCC-TAMRA</th></tr></thead><tr><td align="center" valign="middle" >PPARγ (accession #NM_181024)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >ATCTGCTGCAAGCCTTGGA</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >TGGAGCAGCTTGGCAAAGA</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-CTGAACCACCCCGAGTCCTCCCAG-TAMRA</td></tr><tr><td align="center" valign="middle" >SCD (accession #AB075020)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >TGCCCACCACAAGTTTTCAG</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >GCCAACCCACGTGAGAGAAG</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-CCGACCCCCACAATTCCCG-TAMRA</td></tr><tr><td align="center" valign="middle" >RPS9 (accession #DT860044)</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Forward</td><td align="center" valign="middle" >GAGCTGGGTTTGTCGCAAAA</td></tr><tr><td align="center" valign="middle" >Reverse</td><td align="center" valign="middle" >GGTCGAGGCGGGACTTCT</td></tr><tr><td align="center" valign="middle" >TaqMan probe</td><td align="center" valign="middle" >6FAM-ATGTGACCCCGCGGAGACCCTTC-TAMRA</td></tr></tbody></table></table-wrap></table-wrap-group><p>*AMPKα = AMP-activated protein kinase alpha, MHC-I = myosin heavy chain-I, MHC-IIA = myosin heavy chain-IIA, MHC-IIX = myosin heavy chain-IIX, β1AR = beta 1 adrenergic receptor, β2AR = beta 2 adrenergic receptor, β3AR = beta 3 adrenergic receptor, CEBPβ = C-enhancer binding protein beta, GPR43 = G-protein coupled receptor 43, GPR41 = G-protein coupled receptor 41, Glut4 = glucose transporter type 4, PPARγ = peroxisome proliferator-activated receptor gamma, SCD = stearoyl-CoA desaturase and RPS9 = ribosomal protein S9.</p><p>were centrifuged at 1500 &#215; g for 15 min., separating the sample into 3 layers. The middle supernatant layer was removed and placed into a microcentrifuge tube. Protein samples were then diluted with either M-PER to determine protein concentration using the Pierce<sup>TM</sup> BCA<sup>TM</sup> protein assay (Thermo Fisher Scientific, Fairlawn, NJ). Protein concentration was then determined using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE) at 562 nm. All samples were then diluted to the same concentration. Modified Wangs tracking dye was added to samples for western blot analysis. Samples were denatured with β-mercaptoethanol and incubated for 2 min at 95˚C. Samples were then loaded onto Novex 4% - 12% Bis-Tris gels (Invitrogen), and protein was separated by gel electrophoresis run for approximately 35 min at 165V and 27 mA. Proteins were transferred onto a nitrocellulose membrane (Invitrogen) for 7 min. Following transfer, the membrane were incubated with non-fat dry milk (BIO RAD, Hercules, CA), 10% 10 &#215; Tris-buffered saline (TBS) in NanoPure water for 1 h at 25˚C to block non-specific antibody binding. The blocking solution was then removed from the membrane. The appropriate primary antibody: 1:1000 α-beta 1 AR, rabbit, IgG (abcam<sup>&#210;</sup>, Cambridge, MA); 1:1000 α-beta 2 AR, goat, IgG (abcam) was mixed into 1 &#215; TBS-Tween solution, added to the membrane and allowed to incubate for 2 h (β1AR) or 1 h (β2AR) at 25˚C. The membrane was then rinsed 3 times for 10 min in TBS-Tween. The appropriate Alexa fluorescent antibodies: goat α-rabbit, IgG, Alexa-Fluor 633 (Invitrogen); donkey α-goat, IgG, Alexa-Fluor 633 (Invitrogen) were then added at a dilution of 1:2000 in TBS-Tween to the membrane and incubated for 1 h at 25˚C in the absence of light. The membranes were then rinsed 3 times for 10 min in TBS-Tween in unlighted conditions. The membranes were then dried and visualized using Imager Scanner II and ImageQuant TL software. Densitometry measurements were made on the bands corresponding to β1AR and β2AR using a molecular weight standard for reference (Precision Plus Protein<sup>TM</sup> All Blue Standards; BIO RAD).</p></sec><sec id="s2_6"><title>2.6. cAMP Isolation and ELISA</title><p>After 0, 6, 24, 48, and 96 h, cells from 24-well plates were harvested for cAMP analysis. Cells were rinsed 3 times in PBS. Then 100 &#181;L of 0.1 M HCl was used to lyse the cells. Cells were incubated for 5 min at 25˚C while shaking. The wells were then scraped to ensure all cells were lysed and released from the bottom of the well. The sample was taken from the wells and placed into microcentrifuge tubes. An enzyme-linked immunosorbent assay (ELISA; Sigma, St. Louis, MO) was performed on samples to determine cAMP concentration, following instructions provided by the manufacturer. The results were read with a Spectra max 380pc plate reader and Softmax Pro software.</p></sec><sec id="s2_7"><title>2.7. Statistical Analysis</title><p>Data were analyzed using the GLIMMIX procedure of SAS (v.9.3, SAS Institute; Carey, NC). The model included treatment as the fixed effect, and the Kenward-Roger adjustment was used to correct degrees of freedom. Means were separated using the LSMEANS procedure PDIFF option and considered different when P ≤ 0.05. Tendencies for differences among treatment means were declared when 0.05 &lt; P ≤ 0.15.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><p>At 0, 6, 24, 48, and 96 h of incubation, cAMP was measured with no difference observed between treatments at 0, 24, 48, and 96 h (P &gt; 0.05; <xref ref-type="table" rid="table2">Table 2</xref>). However,</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Relative cAMP concentration<sup>1</sup> changes in bovine skeletal muscle satellite cells treated with zinc (Zn) and zilpaterol hydrochloride (ZH)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle"  colspan="4"  >Treatment<sup>2 </sup></th><th align="center" valign="middle" ></th><th align="center" valign="middle" ><sup> </sup></th></tr></thead><tr><td align="center" valign="middle" >Hour</td><td align="center" valign="middle" >Control</td><td align="center" valign="middle" >ZH</td><td align="center" valign="middle" >Zn</td><td align="center" valign="middle" >Zn/ZH</td><td align="center" valign="middle" >SEM<sup>3 </sup></td><td align="center" valign="middle" >P-Value</td></tr><tr><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.228</td><td align="center" valign="middle" >0.233</td><td align="center" valign="middle" >0.225</td><td align="center" valign="middle" >0.225</td><td align="center" valign="middle" >0.009</td><td align="center" valign="middle" >0.857</td></tr><tr><td align="center" valign="middle" >06</td><td align="center" valign="middle" >0.336<sup>ab</sup></td><td align="center" valign="middle" >0.322<sup>b</sup></td><td align="center" valign="middle" >0.354<sup>a</sup></td><td align="center" valign="middle" >0.327<sup>b</sup></td><td align="center" valign="middle" >0.010</td><td align="center" valign="middle" >0.028</td></tr><tr><td align="center" valign="middle" >24</td><td align="center" valign="middle" >0.265</td><td align="center" valign="middle" >0.241</td><td align="center" valign="middle" >0.266</td><td align="center" valign="middle" >0.248</td><td align="center" valign="middle" >0.014</td><td align="center" valign="middle" >0.231</td></tr><tr><td align="center" valign="middle" >48</td><td align="center" valign="middle" >0.211</td><td align="center" valign="middle" >0.201</td><td align="center" valign="middle" >0.203</td><td align="center" valign="middle" >0.198</td><td align="center" valign="middle" >0.009</td><td align="center" valign="middle" >0.590</td></tr><tr><td align="center" valign="middle" >96</td><td align="center" valign="middle" >0.202</td><td align="center" valign="middle" >0.198</td><td align="center" valign="middle" >0.206</td><td align="center" valign="middle" >0.204</td><td align="center" valign="middle" >0.014</td><td align="center" valign="middle" >0.955</td></tr></tbody></table></table-wrap><p><sup>a,b</sup>Means in the same row having different superscripts are significant at P = 0.05. <sup>1</sup>Picomoles of cAMP/ml. <sup>2</sup>Control = 0 μM ZH/0 μM Zn chloride, ZH = 10 μM ZH/0 μM Zn chloride, Zn = 0 μM ZH/1 μM Zn chloride, Zn/ZH = 1 μM Zn chloride/10 μM ZH. <sup>3</sup>Pooled standard error of the mean.</p><p>at 6 h, the ZN cells had a greater concentration of cAMP compared to ZH treatments (P &lt; 0.05; <xref ref-type="table" rid="table2">Table 2</xref>). This is in contrast to that reported by [<xref ref-type="bibr" rid="scirp.100997-ref16">16</xref>], who reported no difference in cAMP concentration at 6 h between bovine satellite cells treated with Zn and ractopamine HCl (RH). In the Harris [<xref ref-type="bibr" rid="scirp.100997-ref16">16</xref>] study, using Zn and RH, cells treated with 1 &#181;M Zn/10 &#181;M RH exhibited the greatest cAMP concentration at 24 h and by 96 h the control group had a greater concentration of cAMP compared to the cells treated with RH only [<xref ref-type="bibr" rid="scirp.100997-ref16">16</xref>]. Ractopamine HCl is β-AA used in beef and pork production that primarily binds to β1AR [<xref ref-type="bibr" rid="scirp.100997-ref17">17</xref>]. Ractopamine HCl does not affect bovine cells to the extent as ZH because the majority of the β-AR are β2AR [<xref ref-type="bibr" rid="scirp.100997-ref1">1</xref>]. Klein, Sunahara, Hudson, Heyduk and Howlett [<xref ref-type="bibr" rid="scirp.100997-ref13">13</xref>] reported decreased concentrations of cAMP in N18TG2 Neurblastoma cells treated with 300 &#181;M Zn<sup>2+</sup> and forskolin or PGE<sub>1</sub> for 2 h. In the study, cells treated only with Zn<sup>2+</sup>, resulted in no effect on cAMP concentration [<xref ref-type="bibr" rid="scirp.100997-ref13">13</xref>]. Swaminath, Steenhuis, Kobilka and Lee [<xref ref-type="bibr" rid="scirp.100997-ref9">9</xref>] reported Zn binds to the β2AR, causing increased agonist affinity and a greater production of cAMP. Swaminath, Lee and Kobilka [<xref ref-type="bibr" rid="scirp.100997-ref10">10</xref>] further reported multiple binding sites on the β2AR for Zn, with the most prominent binding site for Zn causing an increase in agonist binding affinity and a decrease in antagonist affinity.</p><p>Relative mRNA abundance of β1AR, β2AR, AMPKα, IGF-1, MHC-I, MHC-IIA, MHC-IIX, GPR43, SCD, CEBPβ, and PPARγ yielded no difference between treatments at 24 h (P &gt; 0.05; <xref ref-type="table" rid="table3">Table 3</xref>). At 96 h, ZH cells tended to increase the abundance of MHC-I mRNA (P &lt; 0.10; <xref ref-type="table" rid="table3">Table 3</xref>) compared to CON. Furthermore, ZH cells had a greater abundance of MHC-IIX mRNA (P &lt; 0.05; <xref ref-type="table" rid="table3">Table 3</xref>) and a tendency for greater abundance of IGF-I mRNA (P &lt; 0.15; <xref ref-type="table" rid="table3">Table 3</xref>) compared to CON and Zn/ZH. Harris [<xref ref-type="bibr" rid="scirp.100997-ref16">16</xref>] reported no differences in β1AR, β2AR, AMPKα, IGF-1, MHC-I, MHC-IIA, MHC-IIX mRNA abundance of bovine cells treated with Zn and RH at 24 and 96 h. Miller, Chung, Hutcheson, Yates, Smith and Johnson [<xref ref-type="bibr" rid="scirp.100997-ref2">2</xref>] however, reported a decrease in β1AR and β2AR mRNA abundance compared to control bovine cells, when cells were treated with 1 &#181;M ZH. Tokach [<xref ref-type="bibr" rid="scirp.100997-ref18">18</xref>] found bovine cells treated with ZH increased the abundance of IGF-I mRNA; however, ZH decreased MHC-I mRNA abundance and increased MHC-IIX mRNA abundance compared to control cells at 120 h. In the current study, ZH increased the abundance of MHC-IIX mRNA (P &lt; 0.05) and tended (P &lt; 0.15) to increase the abundance of MHC-I mRNA compared to control cells at 96 h.</p><p>Protein abundance of β1AR and β2AR showed no difference between treatments at either 24 or 96 h (P &gt; 0.05; <xref ref-type="table" rid="table4">Table 4</xref>). Our data support that of [<xref ref-type="bibr" rid="scirp.100997-ref16">16</xref>], who reported no change in β1AR and β2AR protein abundance of bovine cells treated with Zn and RH for 24 and 96 h. Miller, Chung, Hutcheson, Yates, Smith and Johnson [<xref ref-type="bibr" rid="scirp.100997-ref2">2</xref>] reported a decrease in β2AR protein when bovine cells were treated with varying levels of ZH compared to control cells.</p><p>Just as Zn and ZH affected protein expression in the cells, the combination also affected product signal transduction events downstream of binding. The increased binding affinity of ZH to the β2AR resulting from binding of Zn may</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Relative alterations of mRNA concentrations of AMPKα, IGF-I, MHC-I, MHC-IIA, MHC-IIX, β1AR, β2AR, GPR43, SCD, CEBPβ, and PPARγ genes in bovine skeletal muscle satellite cells treated with zinc (Zn) and zilpaterol hydrochloride (ZH)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle"  colspan="4"  >Treatment<sup>2 </sup></th><th align="center" valign="middle" ></th><th align="center" valign="middle" ><sup> </sup></th></tr></thead><tr><td align="center" valign="middle" >Gene*<sup>1</sup></td><td align="center" valign="middle" >Control</td><td align="center" valign="middle" >ZH</td><td align="center" valign="middle" >Zn</td><td align="center" valign="middle" >Zn/ZH</td><td align="center" valign="middle" >SEM<sup>3 </sup></td><td align="center" valign="middle" >P-Value</td></tr><tr><td align="center" valign="middle" >24 Hour</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >AMPkα</td><td align="center" valign="middle" >0.792</td><td align="center" valign="middle" >0.819</td><td align="center" valign="middle" >1.134</td><td align="center" valign="middle" >0.862</td><td align="center" valign="middle" >0.206</td><td align="center" valign="middle" >0.328</td></tr><tr><td align="center" valign="middle" >IGF-I</td><td align="center" valign="middle" >2.394</td><td align="center" valign="middle" >18.566</td><td align="center" valign="middle" >5.474</td><td align="center" valign="middle" >10.172</td><td align="center" valign="middle" >8.642</td><td align="center" valign="middle" >0.339</td></tr><tr><td align="center" valign="middle" >MHC-I</td><td align="center" valign="middle" >34.292</td><td align="center" valign="middle" >40.735</td><td align="center" valign="middle" >46.494</td><td align="center" valign="middle" >43.229</td><td align="center" valign="middle" >36.289</td><td align="center" valign="middle" >0.843</td></tr><tr><td align="center" valign="middle" >MHC-IIA</td><td align="center" valign="middle" >92.801</td><td align="center" valign="middle" >208.030</td><td align="center" valign="middle" >81.721</td><td align="center" valign="middle" >59.259</td><td align="center" valign="middle" >84.236</td><td align="center" valign="middle" >0.458</td></tr><tr><td align="center" valign="middle" >MHC-IIX</td><td align="center" valign="middle" >39.623</td><td align="center" valign="middle" >76.555</td><td align="center" valign="middle" >31.411</td><td align="center" valign="middle" >36.516</td><td align="center" valign="middle" >55.969</td><td align="center" valign="middle" >0.676</td></tr><tr><td align="center" valign="middle" >β1AR</td><td align="center" valign="middle" >0.431</td><td align="center" valign="middle" >1.014</td><td align="center" valign="middle" >0.808</td><td align="center" valign="middle" >0.497</td><td align="center" valign="middle" >0.557</td><td align="center" valign="middle" >0.681</td></tr><tr><td align="center" valign="middle" >β2AR</td><td align="center" valign="middle" >0.611</td><td align="center" valign="middle" >0.342</td><td align="center" valign="middle" >0.613</td><td align="center" valign="middle" >0.583</td><td align="center" valign="middle" >0.219</td><td align="center" valign="middle" >0.550</td></tr><tr><td align="center" valign="middle" >GPR43</td><td align="center" valign="middle" >0.037</td><td align="center" valign="middle" >4.179</td><td align="center" valign="middle" >0.836</td><td align="center" valign="middle" >0.455</td><td align="center" valign="middle" >2.300</td><td align="center" valign="middle" >0.168</td></tr><tr><td align="center" valign="middle" >SCD</td><td align="center" valign="middle" >1.921</td><td align="center" valign="middle" >1.830</td><td align="center" valign="middle" >2.366</td><td align="center" valign="middle" >1.869</td><td align="center" valign="middle" >1.122</td><td align="center" valign="middle" >0.789</td></tr><tr><td align="center" valign="middle" >CEBPβ</td><td align="center" valign="middle" >1.051</td><td align="center" valign="middle" >1.421</td><td align="center" valign="middle" >1.528</td><td align="center" valign="middle" >1.836</td><td align="center" valign="middle" >0.648</td><td align="center" valign="middle" >0.944</td></tr><tr><td align="center" valign="middle" >PPARγ</td><td align="center" valign="middle" >0.133</td><td align="center" valign="middle" >1.699</td><td align="center" valign="middle" >0.403</td><td align="center" valign="middle" >0.393</td><td align="center" valign="middle" >0.760</td><td align="center" valign="middle" >0.148</td></tr><tr><td align="center" valign="middle" >96 Hour</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >AMPkα</td><td align="center" valign="middle" >1.074</td><td align="center" valign="middle" >1.232</td><td align="center" valign="middle" >1.522</td><td align="center" valign="middle" >1.120</td><td align="center" valign="middle" >0.621</td><td align="center" valign="middle" >0.511</td></tr><tr><td align="center" valign="middle" >IGF-I</td><td align="center" valign="middle" >54.439</td><td align="center" valign="middle" >89.368</td><td align="center" valign="middle" >73.977</td><td align="center" valign="middle" >59.397</td><td align="center" valign="middle" >16.307</td><td align="center" valign="middle" >0.053</td></tr><tr><td align="center" valign="middle" >MHC-I</td><td align="center" valign="middle" >54.265</td><td align="center" valign="middle" >106.870</td><td align="center" valign="middle" >74.478</td><td align="center" valign="middle" >58.965</td><td align="center" valign="middle" >23.594</td><td align="center" valign="middle" >0.054</td></tr><tr><td align="center" valign="middle" >MHC-IIA</td><td align="center" valign="middle" >62.873</td><td align="center" valign="middle" >115.700</td><td align="center" valign="middle" >75.909</td><td align="center" valign="middle" >26.646</td><td align="center" valign="middle" >93.129</td><td align="center" valign="middle" >0.403</td></tr><tr><td align="center" valign="middle" >MHC-IIX</td><td align="center" valign="middle" >31.955b</td><td align="center" valign="middle" >90.481a</td><td align="center" valign="middle" >52.485ab</td><td align="center" valign="middle" >17.720b</td><td align="center" valign="middle" >18.407</td><td align="center" valign="middle" >0.003</td></tr><tr><td align="center" valign="middle" >β1AR</td><td align="center" valign="middle" >0.372</td><td align="center" valign="middle" >0.375</td><td align="center" valign="middle" >0.888</td><td align="center" valign="middle" >0.819</td><td align="center" valign="middle" >0.715</td><td align="center" valign="middle" >0.941</td></tr><tr><td align="center" valign="middle" >β2AR</td><td align="center" valign="middle" >0.295</td><td align="center" valign="middle" >0.253</td><td align="center" valign="middle" >0.418</td><td align="center" valign="middle" >0.331</td><td align="center" valign="middle" >0.216</td><td align="center" valign="middle" >0.876</td></tr><tr><td align="center" valign="middle" >GPR43</td><td align="center" valign="middle" >0.906</td><td align="center" valign="middle" >2.522</td><td align="center" valign="middle" >3.351</td><td align="center" valign="middle" >5.837</td><td align="center" valign="middle" >2.731</td><td align="center" valign="middle" >0.814</td></tr><tr><td align="center" valign="middle" >SCD</td><td align="center" valign="middle" >2.579</td><td align="center" valign="middle" >3.239</td><td align="center" valign="middle" >1.841</td><td align="center" valign="middle" >2.154</td><td align="center" valign="middle" >2.347</td><td align="center" valign="middle" >0.913</td></tr><tr><td align="center" valign="middle" >CEBPβ</td><td align="center" valign="middle" >1.626</td><td align="center" valign="middle" >1.523</td><td align="center" valign="middle" >1.529</td><td align="center" valign="middle" >2.235</td><td align="center" valign="middle" >1.108</td><td align="center" valign="middle" >0.593</td></tr><tr><td align="center" valign="middle" >PPARγ</td><td align="center" valign="middle" >0.454</td><td align="center" valign="middle" >0.993</td><td align="center" valign="middle" >1.166</td><td align="center" valign="middle" >1.435</td><td align="center" valign="middle" >0.636</td><td align="center" valign="middle" >0.755</td></tr></tbody></table></table-wrap><p><sup>a,b</sup>Means in the same row having different superscripts are significant at P = 0.05. *AMPKα = AMP-activated protein kinase alpha, IGF-1 = insulin like growth factor-1, MHC-I = myosin heavy chain-I, MHC-IIA = myosin heavy chain-IIA, MHC-IIX = myosin heavy chain-IIX, β1AR = beta 1 adrenergic receptor, β2AR = beta 2 adrenergic receptor, GPR43 = G-protein coupled receptor 43, SCD = stearoyl-CoA desaturase, CEBPβ = C-enhancer binding protein beta and PPARγ = peroxisome proliferator-activated receptor gamma. <sup>1</sup>Relative abundance of the AMPKα, MHC-I, MHC-IIA, MHC-IIX, β1AR, β2AR, GPR43, SCD, CEBPβ, and PPARγ genes were normalized with the RPS9 endogenous control by using the change in cycle threshold (ΔCT). <sup>2</sup>Control = 0 μM ZH/0 μM Zn chloride, ZH = 10 μM ZH/0 μM Zn chloride, Zn = 0 μM ZH/1 μM Zn chloride, Zn/ZH = 1 μM Zn chloride/10 μM ZH. <sup>3</sup>Pooled standard error of the mean.</p><p>consequently result in an inhibition of the synthesis of cAMP. The cAMP data indicated that 1&#181;M Zn/10 &#181;M ZH may be inhibiting the production or accelerating the degradation of cAMP. Lynch, Patson, Goodman, Trapolsi and Kimball [<xref ref-type="bibr" rid="scirp.100997-ref19">19</xref>] reported that Zn became inhibitory to cell growth at concentrations over</p><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Relative protein concentration changes of beta<sub>1 </sub>and beta<sub>2</sub>-adrenergic receptors (βAR) in bovine skeletal muscle satellite cells treated with zinc (Zn) and zilpaterol hydrochloride (ZH)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle"  colspan="4"  >Treatment<sup>1 </sup></th><th align="center" valign="middle" ></th><th align="center" valign="middle" ><sup> </sup></th></tr></thead><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Control</td><td align="center" valign="middle" >ZH</td><td align="center" valign="middle" >Zn</td><td align="center" valign="middle" >Zn/ZH</td><td align="center" valign="middle" >SEM<sup>2 </sup></td><td align="center" valign="middle" >P-Value<sup> </sup></td></tr><tr><td align="center" valign="middle" >24 Hour</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >β1AR<sup>3 </sup></td><td align="center" valign="middle" >22,521</td><td align="center" valign="middle" >22,256</td><td align="center" valign="middle" >21,880</td><td align="center" valign="middle" >21,575</td><td align="center" valign="middle" >2266</td><td align="center" valign="middle" >0.976</td></tr><tr><td align="center" valign="middle" >β2AR<sup>3 </sup></td><td align="center" valign="middle" >27,676</td><td align="center" valign="middle" >27,173</td><td align="center" valign="middle" >26,441</td><td align="center" valign="middle" >26,462</td><td align="center" valign="middle" >2741</td><td align="center" valign="middle" >0.961</td></tr><tr><td align="center" valign="middle" >96 Hour</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >β1AR<sup>3 </sup></td><td align="center" valign="middle" >21,120</td><td align="center" valign="middle" >20,173</td><td align="center" valign="middle" >20,942</td><td align="center" valign="middle" >21,012</td><td align="center" valign="middle" >2582</td><td align="center" valign="middle" >0.980</td></tr><tr><td align="center" valign="middle" >β2AR<sup>3 </sup></td><td align="center" valign="middle" >26,203</td><td align="center" valign="middle" >25,588</td><td align="center" valign="middle" >25,514</td><td align="center" valign="middle" >29,001</td><td align="center" valign="middle" >3672</td><td align="center" valign="middle" >0.760</td></tr></tbody></table></table-wrap><p><sup>1</sup>Control = 0 μM ZH/0 μM Zn chloride, ZH = 10 μM ZH/0 μM Zn chloride, Zn = 0 μM ZH/1 μM Zn chloride, Zn/ZH = 1 μM Zn chloride/10 μM ZH. <sup>2</sup>Pooled standard error of the mean. <sup>3</sup>The values shown are the ratio of relative light units per second based on the intensity of the sample’s protein band.</p><p>100 &#181;M. When β-AAs bind to a β-AR, intrinsic Zn is released. With ZH having a high affinity to bind to β2ARs, which is the predominant β-AR found in beef cattle muscle and adipose tissue, and the β2AR potentially having multiple allosteric binding sites for Zn [<xref ref-type="bibr" rid="scirp.100997-ref9">9</xref>], the cell may be flooded with Zn from intrinsic and free sources of Zn. This may in part cause Zn to become inhibitory towards AC thus reducing the amount of cAMP produced. Since cAMP is a secondary messenger in the β-AR pathway that leads to an increase in myogenic mRNA transcription and ultimately muscle protein accretion, this could possibly explain the decreased myogenic activity we observed. However, large concentrations of Zn increase the uptake of glucose and de novo lipogenesis [<xref ref-type="bibr" rid="scirp.100997-ref19">19</xref>], possibly partially elucidating the reason for increased adipogenic activity observed in this study.</p><p>Based on the results of this study, we can conclude that independently, Zn and ZH positively impact myogenic synthesis; however, cAMP production, β-AR protein and mRNA abundance may not be affected by the combination of the two compounds. Increasing Zn supplementation may increase the concentration of extracellular free Zn; possibly increasing the binding affinity of the β-AA, therefore amplifying the signal transduction associated with β-AA. This amplified affect may result in over stimulation of the β-AR, thereby activating AC causing an increased release of intracellular Zn, which could negatively impact cAMP. While there is conflicting evidence on the implications between the interactions of Zn, β-AA and β-AR, these mechanisms are not fully understood, and future research should be conducted to further elucidate the molecular mechanisms that impact cellular muscle metabolism in biological processes involving Zn. Caution should be used extrapolating these in vitro results to expected results of feeding ZH to beef cattle.</p></sec><sec id="s4"><title>Supported</title><p>Supported in part by funding from Zinpro Corporation, Eden Prairie, Minnesota, and the Gordon W. Davis Regent’s Chair in Meat and Muscle Biology Endowment at Texas Tech University, Lubbock.</p></sec><sec id="s5"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s6"><title>Cite this paper</title><p>Hergenreder, J.E., Harris, T.L., Baggerman, J.O., Hosford, A.D., Branine, M. and Johnson, B.J. (2020) Interactive Effects of Zinc and Zilpaterol Hydrochloride on Bovine β-Adrenergic Receptors. Open Journal of Animal Sciences, 10, 402-413. https://doi.org/10.4236/ojas.2020.103025</p></sec></body><back><ref-list><title>References</title><ref id="scirp.100997-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Mersmann, H.J. (1998) Overview of the Effects of Beta-Adrenergic Receptor Agonists on Animal Growth Including Mechanisms of Action. Journal of Animal Science, 76, 160-172. https://doi.org/10.2527/1998.761160x</mixed-citation></ref><ref id="scirp.100997-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Miller, E.K., Chung, K.Y., Hutcheson, J.P., Yates, D.A., Smith, S.B. and Johnson, B.J. (2012) Zilpaterol Hydrochloride Alters Abundance of β-Adrenergic Receptors in Bovine Muscle Cells But Has Little Effect on de Novo Fatty Acid Biosynthesis in Bovine Subcutaneous Adipose Tissue Explants. Journal of Animal Science, 90, 1317-1327. https://doi.org/10.2527/jas.2011-4589</mixed-citation></ref><ref id="scirp.100997-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Tokach, R.J., Ribeiro, F.R.B., Chung, K.Y., Rounds, W. and Johnson, B.J. (2015) Chromium Propionate Enhances Adipogenic Differentiation of Bovine Intramuscular Adipocytes. Frontiers in Veterinary Science, 2, 26. https://doi.org/10.3389/fvets.2015.00026</mixed-citation></ref><ref id="scirp.100997-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Abney, C.S., Vasconcelos, J.T., McMeniman, J.P., Keyser, S.A., Wilson, K.R., Vogel, G.J. and Galyean, M.L. (2007) Effects of Ractopamine Hydrochloride on Performance, Rate and Variation in Feed Intake, and Acid-Base Balance in Feedlot Cattle. Journal of Animal Science, 85, 3090-3098. https://doi.org/10.2527/jas.2007-0263</mixed-citation></ref><ref id="scirp.100997-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Avenda&amp;#241;o-Reyes, L., Torres-Rodríguez, V., Meraz-Murillo, F.J., Pérez-Linares, C., Figueroa-Saavedra, F. and Robinson, P.H. (2006) Effects of Two Beta-Adrenergic Agonists on Finishing Performance, Carcass Characteristics, and Meat Quality of Feedlot Steers. Journal of Animal Science, 84, 3259-3265. https://doi.org/10.2527/jas.2006-173</mixed-citation></ref><ref id="scirp.100997-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Lohse, M.J., Benovic, J.L., Caron, M.G. and Lefkowitz, R.J. (1990) Multiple Pathways of Rapid Beta 2-Adrenergic Receptor Desensitization. Delineation with Specific Inhibitors. Journal of Biological Chemistry, 265, 3202-3211.</mixed-citation></ref><ref id="scirp.100997-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Waldo, G.L., Northup, J.K., Perkins, J.P. and Harden, T.K. (1983) Characterization of an Altered Membrane Form of the Beta-Adrenergic Receptor Produced during Agonist-Induced Desensitization. Journal of Biological Chemistry, 258, 13900-13908.</mixed-citation></ref><ref id="scirp.100997-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Pippig, S., Andexinger, S., Daniel, K., Puzicha, M., Caron, M.G., Lefkowitz, R.J. and Lohse, M.J. (1993) Overexpression of Beta-Arrestin and Beta-Adrenergic Receptor Kinase Augment Desensitization of Beta 2-Adrenergic Receptors. Journal of Biological Chemistry, 268, 3201-3208.</mixed-citation></ref><ref id="scirp.100997-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Swaminath, G., Steenhuis, J., Kobilka, B. and Lee, T.W. (2002) Allosteric Modulation of beta2-Adrenergic Receptor by Zn(2+). Molecular Pharmacology, 61, 65-72. https://doi.org/10.1124/mol.61.1.65</mixed-citation></ref><ref id="scirp.100997-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Swaminath, G., Lee, T.W. and Kobilka, B. (2003) Identification of an Allosteric Binding Site for Zn2+ on the beta2 Adrenergic Receptor. Journal of Biological Chemistry, 278, 352-356. https://doi.org/10.1074/jbc.M206424200</mixed-citation></ref><ref id="scirp.100997-ref11"><label>11</label><mixed-citation publication-type="book" xlink:type="simple">Hasse, H. and Rink, L. (2011) Zinc Signaling. In: Rink, L., Ed., Zinc in Human Health, IOS Press, Amsterdam, 94-117.</mixed-citation></ref><ref id="scirp.100997-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Brown, K.H., Peerson, J.M., Rivera, J. and Allen, L.H. (2002) Effect of Supplemental Zinc on the Growth and Serum Zinc Concentrations of Prepubertal Children: A Meta-Analysis of Randomized Controlled Trials. The American Journal of Clinical Nutrition, 75, 1062-1071. https://doi.org/10.1093/ajcn/75.6.1062</mixed-citation></ref><ref id="scirp.100997-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Klein, C., Sunahara, R.K., Hudson, T.Y., Heyduk, T. and Howlett, A.C. (2002) Zinc Inhibition of cAMP Signaling. Journal of Biological Chemistry, 277, 11859-11865. https://doi.org/10.1074/jbc.M108808200</mixed-citation></ref><ref id="scirp.100997-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Klein, C., Heyduk, T. and Sunahara, R.K. (2004) Zinc Inhibition of Adenylyl Cyclase Correlates with Conformational Changes in the Enzyme. Cell Signal, 16, 1177-1185. https://doi.org/10.1016/j.cellsig.2004.03.008</mixed-citation></ref><ref id="scirp.100997-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">von Bülow, V., Rink, L. and Haase, H. (2005) Zinc-Mediated Inhibition of Cyclic Nucleotide Phosphodiesterase Activity and Expression Suppresses TNF-Alpha and IL-1 Beta Production in Monocytes by Elevation of Guanosine 3’,5’-Cyclic Monophosphate. Journal of Immunology, 175, 4697-4705. https://doi.org/10.4049/jimmunol.175.7.4697</mixed-citation></ref><ref id="scirp.100997-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Harris, T. (2013) The Effect of Zinc on the β-Adrenergic Receptor in Bovine Satellite Cells and the Use of β-Agonists and Steroid Implants on Muscle Protein and mRNA Levels in Feedlot Cattle. Master Thesis, Texas Tech University, Lubbock.</mixed-citation></ref><ref id="scirp.100997-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Apple, J.K., Rincker, P.J., McKeith, F.K., Carr, S.N., Armstrong, T.A. and Matzat, P.D. (2007) Meta-Analysis of the Ractopamine Response in Finishing Swine. The Professional Animal Scientist, 23, 179-196. https://doi.org/10.15232/S1080-7446(15)30964-5</mixed-citation></ref><ref id="scirp.100997-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Tokach, R. (2011) The Effects of Zilpaterol Hydrochloride and Chromium Propionate on Bovine Muscle Satellite Cells and Preadipocytes. Master Thesis, Texas Tech University, Lubbock.</mixed-citation></ref><ref id="scirp.100997-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Lynch, C.J., Patson, B.J., Goodman, S.A., Trapolsi, D. and Kimball, S.R. (2001) Zinc Stimulates the Activity of the Insulin- and Nutrient-Regulated Protein Kinase mTOR. American Journal of Physiology Endocrinology and Metabolism, 281, E25-E34. https://doi.org/10.1152/ajpendo.2001.281.1.E25</mixed-citation></ref></ref-list></back></article>